ID: 1162924481

View in Genome Browser
Species Human (GRCh38)
Location 19:13923368-13923390
Sequence CCTGGTCCAGCGGCCTGGCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 309}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162924472_1162924481 6 Left 1162924472 19:13923339-13923361 CCTGCCCCTGTCAACAAGGACGA 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1162924481 19:13923368-13923390 CCTGGTCCAGCGGCCTGGCCCGG 0: 1
1: 0
2: 1
3: 36
4: 309
1162924474_1162924481 1 Left 1162924474 19:13923344-13923366 CCCTGTCAACAAGGACGACTTTG 0: 1
1: 0
2: 0
3: 12
4: 421
Right 1162924481 19:13923368-13923390 CCTGGTCCAGCGGCCTGGCCCGG 0: 1
1: 0
2: 1
3: 36
4: 309
1162924473_1162924481 2 Left 1162924473 19:13923343-13923365 CCCCTGTCAACAAGGACGACTTT 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1162924481 19:13923368-13923390 CCTGGTCCAGCGGCCTGGCCCGG 0: 1
1: 0
2: 1
3: 36
4: 309
1162924468_1162924481 17 Left 1162924468 19:13923328-13923350 CCCAGGTGCCGCCTGCCCCTGTC 0: 1
1: 0
2: 2
3: 21
4: 256
Right 1162924481 19:13923368-13923390 CCTGGTCCAGCGGCCTGGCCCGG 0: 1
1: 0
2: 1
3: 36
4: 309
1162924469_1162924481 16 Left 1162924469 19:13923329-13923351 CCAGGTGCCGCCTGCCCCTGTCA 0: 1
1: 0
2: 1
3: 23
4: 255
Right 1162924481 19:13923368-13923390 CCTGGTCCAGCGGCCTGGCCCGG 0: 1
1: 0
2: 1
3: 36
4: 309
1162924471_1162924481 9 Left 1162924471 19:13923336-13923358 CCGCCTGCCCCTGTCAACAAGGA 0: 1
1: 0
2: 0
3: 25
4: 304
Right 1162924481 19:13923368-13923390 CCTGGTCCAGCGGCCTGGCCCGG 0: 1
1: 0
2: 1
3: 36
4: 309
1162924475_1162924481 0 Left 1162924475 19:13923345-13923367 CCTGTCAACAAGGACGACTTTGC 0: 1
1: 0
2: 0
3: 0
4: 73
Right 1162924481 19:13923368-13923390 CCTGGTCCAGCGGCCTGGCCCGG 0: 1
1: 0
2: 1
3: 36
4: 309
1162924466_1162924481 21 Left 1162924466 19:13923324-13923346 CCTCCCCAGGTGCCGCCTGCCCC 0: 1
1: 0
2: 3
3: 91
4: 564
Right 1162924481 19:13923368-13923390 CCTGGTCCAGCGGCCTGGCCCGG 0: 1
1: 0
2: 1
3: 36
4: 309
1162924467_1162924481 18 Left 1162924467 19:13923327-13923349 CCCCAGGTGCCGCCTGCCCCTGT 0: 1
1: 0
2: 1
3: 21
4: 298
Right 1162924481 19:13923368-13923390 CCTGGTCCAGCGGCCTGGCCCGG 0: 1
1: 0
2: 1
3: 36
4: 309
1162924465_1162924481 27 Left 1162924465 19:13923318-13923340 CCTCGTCCTCCCCAGGTGCCGCC 0: 1
1: 0
2: 7
3: 51
4: 1570
Right 1162924481 19:13923368-13923390 CCTGGTCCAGCGGCCTGGCCCGG 0: 1
1: 0
2: 1
3: 36
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162924481 Original CRISPR CCTGGTCCAGCGGCCTGGCC CGG Exonic