ID: 1162926992

View in Genome Browser
Species Human (GRCh38)
Location 19:13935782-13935804
Sequence GATCCGCGACACGGAGGGAC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 36}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162926982_1162926992 22 Left 1162926982 19:13935737-13935759 CCCCAAAGGTGAGGGGGAAGATC 0: 1
1: 0
2: 0
3: 18
4: 164
Right 1162926992 19:13935782-13935804 GATCCGCGACACGGAGGGACCGG 0: 1
1: 0
2: 0
3: 1
4: 36
1162926987_1162926992 -2 Left 1162926987 19:13935761-13935783 CCATCACTTGGTTGGCAGCCAGA 0: 1
1: 0
2: 0
3: 8
4: 132
Right 1162926992 19:13935782-13935804 GATCCGCGACACGGAGGGACCGG 0: 1
1: 0
2: 0
3: 1
4: 36
1162926983_1162926992 21 Left 1162926983 19:13935738-13935760 CCCAAAGGTGAGGGGGAAGATCT 0: 1
1: 0
2: 1
3: 20
4: 150
Right 1162926992 19:13935782-13935804 GATCCGCGACACGGAGGGACCGG 0: 1
1: 0
2: 0
3: 1
4: 36
1162926984_1162926992 20 Left 1162926984 19:13935739-13935761 CCAAAGGTGAGGGGGAAGATCTC 0: 1
1: 0
2: 0
3: 11
4: 115
Right 1162926992 19:13935782-13935804 GATCCGCGACACGGAGGGACCGG 0: 1
1: 0
2: 0
3: 1
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162926992 Original CRISPR GATCCGCGACACGGAGGGAC CGG Exonic
909402636 1:75251231-75251253 GTTTAGCAACACGGAGGGACTGG + Exonic
911618309 1:100038442-100038464 GGTCCGCGACCCCGAGGCACCGG - Intronic
920543862 1:206799435-206799457 GCTGCACGACACAGAGGGACTGG + Intronic
1073339680 10:102735405-102735427 GAGGAGCGACATGGAGGGACAGG - Intronic
1076135893 10:128045612-128045634 GACCCCTGACACGGAGGGAGGGG - Intronic
1083654962 11:64225149-64225171 GATCTGCCTCACGGAGGGGCAGG + Intronic
1088259248 11:107928763-107928785 GCTCTGGGACACGGCGGGACAGG + Exonic
1092287137 12:7135178-7135200 GATACGGCACATGGAGGGACAGG - Intronic
1104410511 12:128553927-128553949 GAGCTGCAACAAGGAGGGACTGG - Intronic
1105776811 13:23669986-23670008 GATCTGGGGCAGGGAGGGACAGG - Intronic
1128866022 15:71115671-71115693 GGTCCGCGTCCCGGAGCGACCGG - Intronic
1132765280 16:1531408-1531430 GAACAGGGACACGGAGGGAGGGG - Intronic
1144735881 17:17555240-17555262 GAAGGGCGACACGGAGGGATGGG + Intronic
1151756673 17:76079245-76079267 CATCGGCTGCACGGAGGGACTGG - Exonic
1161162378 19:2768478-2768500 GATCCGGGGCTCGGAGGGAAAGG - Intronic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
1162926992 19:13935782-13935804 GATCCGCGACACGGAGGGACCGG + Exonic
1163018359 19:14470313-14470335 GATCCGAGACACACAGGGGCGGG - Intronic
927215317 2:20665380-20665402 CATCCGCGTCAGGGAGAGACCGG + Intergenic
931869774 2:66445450-66445472 GTTCAGCGCCCCGGAGGGACAGG - Intronic
935901498 2:107798366-107798388 GATCCCCTGCACTGAGGGACAGG - Intergenic
949042831 2:241857443-241857465 GAGCCGGGACACGGGGGGAGAGG + Intronic
1176510616 21:7745161-7745183 GATCCCCGACCCGGCGCGACCGG - Intronic
1178644729 21:34375690-34375712 GATCCCCGACCCGGCGCGACCGG - Exonic
1183738057 22:39654754-39654776 CATCAGCGAGACAGAGGGACAGG + Intronic
953883111 3:46701584-46701606 AGGCCGCGGCACGGAGGGACTGG + Intronic
967037471 3:185658541-185658563 GATCTGAGACACAGAGGGACAGG - Intronic
979478975 4:121192385-121192407 TATCAGCTACACGAAGGGACTGG - Intronic
983229152 4:165112540-165112562 GATCCGCGACACGTTGGCTCCGG - Intronic
986553129 5:8981175-8981197 GATCCACCACACTGAGGAACTGG - Intergenic
993072342 5:83181016-83181038 AATCAGGGACAGGGAGGGACAGG - Intronic
997161020 5:131609360-131609382 GATCAGGGACAAGGAGGGATAGG + Intronic
1018655627 6:166032975-166032997 GATCAGCCACATGGAGAGACTGG + Intergenic
1025057432 7:55776350-55776372 GATCCACCACACTGAGGAACTGG - Intergenic
1031198204 7:118643393-118643415 GATCTGGGACAAGGTGGGACAGG + Intergenic
1034979294 7:155466241-155466263 GATCCGCGGCACGCAGAGCCCGG - Intergenic
1053379556 9:37637092-37637114 GATCTGGGACACGGCGGGCCAGG - Intronic
1061394801 9:130338041-130338063 GATGGGGGACAGGGAGGGACTGG - Intronic