ID: 1162927098

View in Genome Browser
Species Human (GRCh38)
Location 19:13936170-13936192
Sequence TTGAGTAGGGATGGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 933
Summary {0: 1, 1: 2, 2: 5, 3: 98, 4: 827}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162927098 Original CRISPR TTGAGTAGGGATGGGGAGGA GGG (reversed) Intronic
900199182 1:1395687-1395709 TTGGGAAGGGATGAGGAGGTTGG - Intronic
900269757 1:1781051-1781073 GTCAGCAGGGATGGGGAGGGTGG + Intergenic
900548997 1:3244316-3244338 ATTAGGAGGGATGGGGAGGTGGG + Intronic
900989052 1:6089599-6089621 CTGGGTTGGGGTGGGGAGGATGG - Intronic
901258990 1:7857271-7857293 GTGAGTAGGGAGAGGAAGGAGGG - Intergenic
901386896 1:8916265-8916287 TTGTCAAGGGATGGGGAGGGGGG + Intergenic
902229906 1:15021407-15021429 TTTAGTGGTGATTGGGAGGAAGG + Intronic
902477742 1:16697135-16697157 GTGAGTAGGGTGGGGGAGGATGG - Intergenic
902687937 1:18091051-18091073 GTGAGAAGGGATGGGGAGAAGGG + Intergenic
902893813 1:19464865-19464887 TTGTCTAGGGATGGGGAACAAGG + Intronic
903538192 1:24081268-24081290 TTGGGTAGGTTTGGGAAGGAGGG + Intronic
904076971 1:27850474-27850496 TTGGGTGGGAATGGGGTGGAAGG + Exonic
904345163 1:29863108-29863130 CTGAGTAGGGGTGGGGAGGGAGG + Intergenic
904445467 1:30570206-30570228 TGGGGTAGGGATGGAGAGGGAGG + Intergenic
904493935 1:30876520-30876542 TTGAGAAGGGACAGGGAGGAGGG - Intronic
905537254 1:38732188-38732210 TAGAATAGGGATGGGAAGGTGGG - Intergenic
906013320 1:42550312-42550334 TGGAGAATGGATTGGGAGGAGGG - Intronic
906621032 1:47279421-47279443 TGGGGTAGGTATGTGGAGGAAGG + Intronic
906743796 1:48207619-48207641 GTGAGTAGGTCTGAGGAGGATGG - Intergenic
906756750 1:48325028-48325050 TTGGGTGGGAATGGGGTGGAAGG - Intronic
907081148 1:51623319-51623341 TGGTGTAGGGATGGGAAGCAAGG + Intronic
907273829 1:53306010-53306032 TAGAATAGAGAAGGGGAGGAGGG - Intronic
907368893 1:53985300-53985322 TTGCCTAGGGATGGGGAGTTGGG + Intergenic
907670557 1:56471323-56471345 TGGGGTAGGGACAGGGAGGATGG + Intergenic
907787359 1:57625723-57625745 TAGAGGAGGGAAAGGGAGGAGGG + Intronic
907796188 1:57720251-57720273 TTGAGTAGGGAATGGGATTATGG - Intronic
907868331 1:58420306-58420328 TTGAGTATTGATGGTGAGGTGGG - Intronic
908021314 1:59901383-59901405 TTCAGTAGGGCTTGGAAGGAGGG + Intronic
908187920 1:61670378-61670400 TAGAGTGGGGAGGGAGAGGAGGG + Intergenic
909169154 1:72272253-72272275 CAGAGTAGAGATGGGGAGGAAGG - Intronic
909659574 1:78067195-78067217 TTGAGATCAGATGGGGAGGAGGG + Intronic
909905218 1:81186076-81186098 TGCAGTAGAGATGGGGAGAAAGG + Intergenic
910254428 1:85233584-85233606 TTGAATAGGAATGGTGAGAATGG + Intergenic
910256509 1:85253509-85253531 GGGAGTGGGGATGGGGAGGGCGG - Intronic
910768409 1:90806441-90806463 TTGTGTGGGGGTGGGGAGTAGGG + Intergenic
911029598 1:93472062-93472084 TAGAGTAGGGTTAGGGAGTATGG - Intronic
911358200 1:96846644-96846666 TGGAATAGGGATGGGGAGGGAGG + Intergenic
911627565 1:100142414-100142436 TTGCATTGGGATGGAGAGGAGGG + Intronic
911667629 1:100571995-100572017 TTGAGTAGGAGTGGTGAGAAAGG - Intergenic
911850280 1:102809543-102809565 CTGATTAGGGATGGGCAGAAAGG - Intergenic
912140752 1:106723194-106723216 TGGGGTGGGGAGGGGGAGGAAGG - Intergenic
912413229 1:109491799-109491821 TTGTGCAGGGAAAGGGAGGAAGG + Intronic
912487332 1:110039534-110039556 CTGAGTAGGGAAGGGGAGGCTGG + Intronic
912790958 1:112650163-112650185 GTGGGTAGGGATGGGGAGACAGG + Intronic
912927984 1:113929940-113929962 GTGAGTGGGGACGGGCAGGAGGG + Intronic
913355739 1:117919869-117919891 TTGCTTGGGGATGGGGAGGGAGG + Intronic
913460810 1:119084257-119084279 GTTGCTAGGGATGGGGAGGAGGG + Intronic
913531793 1:119738799-119738821 TTGCAGAGAGATGGGGAGGAGGG + Intronic
913532066 1:119740533-119740555 TTGCAGAGGGAGGGGGAGGAGGG + Intronic
914957728 1:152179529-152179551 TAAAGTAGGGATGGGAAGGGTGG + Intergenic
914994401 1:152529265-152529287 TTGAATAGGGATGGTGAGAGAGG + Intronic
915469375 1:156116337-156116359 TTGAGTAGGGTGGGGTAGGGTGG - Intronic
915816080 1:158966815-158966837 TTGAATAGGAATGGTGAGGGAGG - Intronic
915943432 1:160133484-160133506 TGGAGTTGGGATGGGGAGGGTGG - Intronic
916090855 1:161306683-161306705 GTGAGAAGGGATGGGGACAAGGG - Intronic
916399333 1:164429037-164429059 TAGATTTGGGATGGGGTGGAAGG - Intergenic
916459967 1:165013490-165013512 TGGAGTTGGGATGGAGAGGCTGG + Intergenic
916641561 1:166734057-166734079 TTGAATAGGAATGGTGAGAATGG - Intergenic
916804744 1:168248395-168248417 TTGAGTAGGAATGGTGAGAGAGG + Exonic
917458859 1:175210227-175210249 ATGGGAAGGGATGGGAAGGAAGG - Intergenic
917470620 1:175323132-175323154 TTGAGGAGGCCTGGGTAGGAGGG + Exonic
917568207 1:176233931-176233953 TTGAATAGGAGTGGTGAGGAAGG + Intergenic
917794766 1:178525305-178525327 CAGAGTAGGCATGGGGAGGCAGG - Intronic
918066004 1:181102162-181102184 TGGAGAAGGTGTGGGGAGGAGGG - Intergenic
918211855 1:182358241-182358263 TAGAGTTGGGATGGGGATGCAGG + Intergenic
918340338 1:183563358-183563380 TGGAGGAGGGAAGAGGAGGATGG - Intronic
918921899 1:190722998-190723020 TTGATTAGGAATGGGGAGAGGGG + Intergenic
919093757 1:193004771-193004793 TTGAGTAGAAATGGTGAAGAGGG - Intergenic
919502107 1:198349982-198350004 TGGAGGTGGGATGGGGTGGAGGG + Intergenic
919653820 1:200178527-200178549 CAGAGTAGGGATGGGAAGGGTGG - Intergenic
919772164 1:201169145-201169167 TAGAGGTGGGTTGGGGAGGAGGG + Intronic
919992296 1:202716671-202716693 TAGGGTAGGTTTGGGGAGGAGGG + Intergenic
920296247 1:204958929-204958951 ATCAGCAGGGATAGGGAGGAAGG - Intronic
920350750 1:205336481-205336503 TGGTGTGGGGATGGGGCGGAAGG - Exonic
920437216 1:205955122-205955144 TTTGTTAGGGAGGGGGAGGAGGG - Intergenic
920452242 1:206068299-206068321 TTGAGTTGGGGTAGGGTGGAGGG + Intronic
920910933 1:210215683-210215705 TAGAGTAGGGAGGAGGAGGAGGG + Intergenic
921127070 1:212187508-212187530 TTTAGTAGAGATGGGGAGACGGG + Intergenic
922879414 1:228969428-228969450 TGGTGTATGGTTGGGGAGGATGG - Intergenic
922943885 1:229493665-229493687 TTGAGTAAAGGTGGAGAGGAAGG + Intronic
923006580 1:230054611-230054633 TTGAGTTGGGCTTTGGAGGATGG - Intergenic
923145825 1:231196954-231196976 CTGTGTAGGGATGGGGTGGACGG + Intronic
923187815 1:231591027-231591049 TGGAGAAGGGATGGGGTGGAGGG - Intronic
923548236 1:234940456-234940478 CTGAGAAAGCATGGGGAGGAGGG - Intergenic
924326355 1:242898218-242898240 TTGAATAGGAATGGCGAGAATGG + Intergenic
924746308 1:246836790-246836812 TTGCTTAGGGATGGGAAGTAGGG + Intergenic
1063116737 10:3076930-3076952 TTATGTAGGCATGGGGAGGTGGG - Intronic
1063731172 10:8698880-8698902 GAGAGTAGGGAGTGGGAGGAGGG - Intergenic
1063957759 10:11282166-11282188 TTTAGAAGGGATAGGGAGGGAGG - Intronic
1064018201 10:11788805-11788827 TTGAGGAGGGCTGGGCATGATGG - Intergenic
1064049741 10:12049692-12049714 ATGAGTGTGGATGGGGAAGATGG + Intergenic
1065073212 10:22049183-22049205 TTGGGTAGGGGCTGGGAGGATGG - Intergenic
1065276197 10:24088436-24088458 TTGAGTAGGGGGAGGGGGGAGGG - Intronic
1065488363 10:26255904-26255926 CTGGGGAGGGATGGGGAGGAAGG + Intronic
1065697925 10:28397230-28397252 TAGAGCAGGAATGGGGAGAAAGG - Intergenic
1066075813 10:31875503-31875525 TTGGGTAGGGTAGGGAAGGATGG + Intronic
1066391599 10:34981244-34981266 TGGAGTAGAGATGGGAATGATGG + Intergenic
1067003485 10:42638957-42638979 GAGAGCAGGGATGGGGGGGATGG + Intergenic
1067053036 10:43035975-43035997 TTGCCTAGGGATGGGGCGGGAGG + Intergenic
1067256470 10:44647452-44647474 TGGGGTGGGGATGGGGAGGGTGG - Intergenic
1067411379 10:46067670-46067692 TTGCCTAGGGCTGGGGAGGATGG + Intergenic
1067706564 10:48610667-48610689 GGAAGCAGGGATGGGGAGGAAGG + Intronic
1067947782 10:50701304-50701326 GTGCGTAGGCATGGGGAGGAGGG + Intergenic
1068093813 10:52465645-52465667 TTGGGTAGGGGTGGCGGGGAAGG + Intergenic
1069546464 10:69332842-69332864 TTGAGTAGCCAAGTGGAGGACGG + Intronic
1069705058 10:70453829-70453851 TTGCCTAGGGATGGGGGAGAGGG + Intergenic
1069754341 10:70764058-70764080 TGGAGAAGGGATCGGGGGGATGG + Intergenic
1069870775 10:71531609-71531631 TAGGGTAGGGATGGGGAGCCAGG + Intronic
1070039681 10:72763569-72763591 ATGAGTAGGGATGGAGAGAAAGG + Intronic
1070191960 10:74119175-74119197 TTTAGAAAGGATGTGGAGGAAGG - Exonic
1070338103 10:75472749-75472771 TTGACAAGAGATGGAGAGGAGGG + Intronic
1070883099 10:79866297-79866319 GTGCGTAGGCATGGGGAGGAGGG + Intergenic
1071323392 10:84487778-84487800 TTGAATAGGAATGGTGAGAAAGG + Intronic
1071385550 10:85116622-85116644 TTGCCTGGGGATGGGGAGGCAGG - Intergenic
1071425926 10:85551140-85551162 TTGAATAGGGATAGTGAGAAAGG - Intergenic
1071471005 10:85984072-85984094 TGGAGGAGAGATGGAGAGGAGGG - Intronic
1071649667 10:87382612-87382634 GTGCGTAGGCATGGGGAGGAGGG + Intergenic
1071719148 10:88125417-88125439 TTGTTTAGGGCTGAGGAGGACGG + Intergenic
1071786441 10:88905574-88905596 TGGAGTAGAGATGGAGAGGATGG + Exonic
1071847985 10:89539326-89539348 CTGAGTAGGGAAGAAGAGGAAGG - Intronic
1072741415 10:97912312-97912334 TTCAGCAGGGATGGGCAGGGAGG - Intronic
1072778472 10:98225285-98225307 GTGAAGAGGGATGGGGAGGTAGG - Intronic
1073112283 10:101069914-101069936 TTGGGGAGGGATGGGGTGGTGGG + Intergenic
1073160963 10:101394535-101394557 TGGAGTAGGGAAGCGGAAGAAGG - Intronic
1073257871 10:102166288-102166310 TTGCCAAGGGCTGGGGAGGAGGG - Intergenic
1073347432 10:102794472-102794494 TTTTGTGGGGGTGGGGAGGATGG - Intronic
1073374759 10:103023547-103023569 TTTTGTGGGGATGGGGAGGGGGG - Intronic
1073438968 10:103541134-103541156 AGGATTAGGGATGGGGTGGAAGG + Intronic
1073480109 10:103781036-103781058 TGCAGGAGTGATGGGGAGGAGGG - Intronic
1073483201 10:103799823-103799845 TTGAGGAGGGAAGAGGAAGAAGG + Intronic
1073546364 10:104353022-104353044 GGGAGTAGGGATGGGGATAAAGG + Intergenic
1073835704 10:107438512-107438534 TTAAGTAGTGATAAGGAGGAAGG - Intergenic
1074060563 10:109961779-109961801 TTGGGGAGGGTGGGGGAGGAAGG + Intergenic
1074424382 10:113338228-113338250 CTGGGTAGGGGTGGGGAGGAGGG + Intergenic
1074436088 10:113435643-113435665 TTGTGTAGGGCTGGAGAGGCTGG + Intergenic
1074780117 10:116796507-116796529 TTGAGTGGGGATGGGGAGGCAGG - Intergenic
1075075876 10:119349787-119349809 TTGAGGAAGGAAGAGGAGGAAGG + Intronic
1075092149 10:119449843-119449865 TTGAGCAGGCAGGGGGAGGATGG + Intronic
1075559508 10:123458404-123458426 GGGAGGAGAGATGGGGAGGAAGG - Intergenic
1075798171 10:125135621-125135643 GTGCGTGGGGATGGAGAGGAGGG - Intronic
1075816723 10:125270375-125270397 TAGATTAGGGATGGGTAGGAAGG + Intergenic
1075827464 10:125371280-125371302 TTGCCTAGGGCTGGGGAGGATGG - Intergenic
1075838624 10:125477732-125477754 TGGAGTGGGGATGGGAAGGAGGG + Intergenic
1076350484 10:129811716-129811738 GTGGATAGGGATGGGGAGAAGGG - Intergenic
1076650060 10:131981612-131981634 GTGGGTACGGAAGGGGAGGATGG + Intronic
1076801773 10:132834352-132834374 TTGATTTGGGGTGGGAAGGAAGG - Intronic
1077281155 11:1746850-1746872 GTGCGTCGGGGTGGGGAGGAGGG + Intronic
1077363648 11:2152449-2152471 TGGAGGACGGATGGGCAGGAGGG + Intronic
1077520797 11:3032737-3032759 AGGAGTTGGGGTGGGGAGGAAGG + Intronic
1078126835 11:8574097-8574119 GTGAGTGGGGATAGGGAGGGAGG - Intronic
1078148446 11:8738592-8738614 AGCAGCAGGGATGGGGAGGAGGG - Intronic
1078510058 11:11978313-11978335 GTGAGTGGGTACGGGGAGGAAGG - Intronic
1078628813 11:12983276-12983298 TGGAGAAGGGATGGGGAGAACGG - Intergenic
1078684990 11:13521000-13521022 GTGAGGTGGGATGGGCAGGATGG + Intergenic
1079350486 11:19687638-19687660 TGCAGGAGGGATGTGGAGGAGGG + Intronic
1080031991 11:27671157-27671179 TGGAGTAGGGGTAGGGGGGAGGG + Intronic
1080125307 11:28726998-28727020 TTGACTAGGCCTGGAGAGGATGG - Intergenic
1080547454 11:33334949-33334971 TGAGGTAGGGATGGAGAGGAGGG + Intronic
1080990102 11:37522313-37522335 TGGAGTAGGGGCCGGGAGGAAGG + Intergenic
1081079847 11:38728158-38728180 TTGAATAGGGGTGGTGAGAAAGG + Intergenic
1081961527 11:47141267-47141289 TTGCCTAGGGTTGGGGAAGACGG - Intronic
1082106949 11:48230811-48230833 TGGGGTAGGGGTAGGGAGGAGGG - Intergenic
1083326309 11:61874729-61874751 GTGAGCAGGGACAGGGAGGAGGG - Intronic
1083380637 11:62265624-62265646 ATGAGCAGGGACAGGGAGGAAGG + Intergenic
1083454910 11:62772043-62772065 GTAAGTAGGGAGGGGGAGCAAGG - Intronic
1083861312 11:65421834-65421856 TTGGGTGGGGGTGGGGAGAAAGG - Intergenic
1083910776 11:65708207-65708229 TTGATCAGGGATGTGGGGGATGG + Intergenic
1083979720 11:66157183-66157205 TTTAGTGGGGTTGGGGAGGGAGG - Intronic
1084932959 11:72571400-72571422 TGGAGTTTGGATGAGGAGGACGG - Intergenic
1085466407 11:76726678-76726700 TTGAGTAAGCACGGGGAGGGGGG + Intergenic
1085588052 11:77730512-77730534 TTGAGTAGGAAAGGACAGGAGGG - Intronic
1085592588 11:77778099-77778121 TTGGGAAGGGGAGGGGAGGAGGG + Intronic
1085630542 11:78112295-78112317 TTGAATAGGAATGGTGAGAAGGG + Intronic
1085741016 11:79078434-79078456 TAAAGTGGGGGTGGGGAGGATGG + Intronic
1086370322 11:86150129-86150151 TGGAGTGGGGGTGGGGAGGGGGG - Intergenic
1086473168 11:87139251-87139273 TTGGGTGGGACTGGGGAGGAGGG + Intronic
1086566865 11:88237002-88237024 TTTAATAGGGAAGGGGAGAAGGG + Intergenic
1087284777 11:96253374-96253396 TTGAGTAAGGAAGGGGAGCTTGG - Intronic
1087406369 11:97735824-97735846 TTTAGTAGAGATGGGGAGACGGG - Intergenic
1087588702 11:100156041-100156063 TTGAGTAGGAATGGTGAGAGGGG + Intronic
1087625396 11:100589813-100589835 TTGAGTAGGAGTGGTGAGGGAGG + Intergenic
1087762064 11:102111485-102111507 TGGAGGAGGGGTGGGGAGGAAGG + Intronic
1088037701 11:105337145-105337167 TTGAATAGGAATGGTGAGAAAGG - Intergenic
1088059332 11:105627277-105627299 TAGAGTAGGGGTAGGGGGGATGG + Intronic
1088300165 11:108349695-108349717 TTTAGAAGGGAAGGGAAGGATGG + Intronic
1088531893 11:110819479-110819501 GGGAGTAGGGATTGGGAGGAGGG + Intergenic
1088765283 11:112969479-112969501 GGGAGGAGTGATGGGGAGGAAGG + Intronic
1088941249 11:114459067-114459089 CTGAGGATGGATGGGGAGAAGGG + Intergenic
1088973617 11:114795218-114795240 TGGAGAAGGGATGTGAAGGAAGG + Intergenic
1089090909 11:115874309-115874331 GAGAGTAGTGAGGGGGAGGAGGG - Intergenic
1089269821 11:117294394-117294416 TTCAGTAGAGATGGGGTAGATGG + Intronic
1089575864 11:119442672-119442694 TAGTGTGGGGGTGGGGAGGAAGG - Intergenic
1089673876 11:120075962-120075984 GTGTGTTGGGGTGGGGAGGAGGG + Intergenic
1090007648 11:123017215-123017237 ATGGTTGGGGATGGGGAGGAGGG - Intergenic
1090225564 11:125070117-125070139 ATGAGCAGGAATGGGCAGGAGGG + Intronic
1090451431 11:126809840-126809862 TTGAGTGGGGAAGGGAAGGAGGG - Intronic
1090567466 11:128010565-128010587 TTGAATAGGAGTGGGGAGAAAGG - Intergenic
1090809250 11:130222209-130222231 GGGAGTAGGGCTGGAGAGGAAGG - Intergenic
1090837835 11:130466221-130466243 TTGAGTGTGGATGGTGAAGAGGG - Intronic
1090838340 11:130469494-130469516 TGGAGTAGGGGTGGGGTGGGGGG - Intronic
1091176167 11:133559960-133559982 TTGCTTAGGGATGGGGAGATTGG - Intergenic
1091486735 12:896542-896564 TTAAGTAGGGATGTGGATGATGG + Exonic
1091804111 12:3343653-3343675 TTTAATAGTGATGGGGAGCAAGG + Intergenic
1091910479 12:4226753-4226775 TAGAGATGGGATGAGGAGGAAGG - Intergenic
1092068776 12:5615531-5615553 TTGAGTAGACAAGAGGAGGAAGG - Intronic
1092164846 12:6336498-6336520 TTGAGTGGGGATGGGAAGGAGGG - Intronic
1092286306 12:7130836-7130858 CTGAGAACGGATGGGAAGGAGGG - Intronic
1092393629 12:8104721-8104743 CTGAGTGGGGAGGGGGAGAAGGG - Intergenic
1092547917 12:9467646-9467668 TTGCTGAGGGAAGGGGAGGAGGG + Intergenic
1093405575 12:18800488-18800510 GTGACTGGCGATGGGGAGGAGGG - Intergenic
1093465253 12:19441719-19441741 CTGTGTAGGCATGGGTAGGAAGG + Intronic
1095320004 12:40815687-40815709 TTGAATAGGAATGGTGAGAAAGG + Intronic
1095564836 12:43610929-43610951 TTGAATAGGGGTGGTGAGAAAGG - Intergenic
1095808395 12:46345953-46345975 TTGTGTGGGGAAGGGGGGGAGGG - Intergenic
1096665117 12:53159461-53159483 AGGGGTGGGGATGGGGAGGAAGG - Intronic
1096777704 12:53974124-53974146 TGGAGAAGGGGTGGGGAGGGAGG + Intronic
1096802921 12:54123550-54123572 TCGAGCAGGGGTGGGGAGGTGGG - Intergenic
1096925519 12:55140319-55140341 TTGAATAGGAATGGTGAGCATGG - Intergenic
1097502454 12:60422184-60422206 GTGAGGAAGGAAGGGGAGGAAGG - Intergenic
1097957910 12:65505632-65505654 CAGTGTAGGGCTGGGGAGGAGGG - Intergenic
1098237336 12:68429994-68430016 TTCAATAGGGATGGGCGGGAGGG + Intergenic
1098538174 12:71619517-71619539 TTGAGTGGGTAAGGGGCGGAGGG + Intronic
1098541884 12:71666110-71666132 TAGAGTAGAAATGGAGAGGAGGG + Intronic
1099458572 12:82894986-82895008 TTTAGTAGAGATGGGGAGATGGG + Intronic
1099853987 12:88141599-88141621 GTGGGTAGGGGTGTGGAGGAAGG - Intronic
1100122770 12:91388164-91388186 TGGAAAGGGGATGGGGAGGATGG + Intergenic
1100330955 12:93581800-93581822 ATGAGAAAGGATGGAGAGGATGG + Intronic
1101013437 12:100474783-100474805 TTCAGAAGGGAGGGGCAGGAGGG + Intronic
1101014403 12:100484650-100484672 GTCAGTAGAGATGGGAAGGAAGG - Intronic
1101126730 12:101642847-101642869 GTGAGTGGGGATGTGGAGGCTGG - Intronic
1101346554 12:103891302-103891324 TGGAGCAGGGATGGGGAAGTGGG - Intergenic
1102042712 12:109810817-109810839 TGGGGTAGGGGTGGGGAGGAGGG + Intronic
1102384737 12:112499035-112499057 TTGAGTAGGGAGGGGGAAATAGG + Intronic
1103148298 12:118614506-118614528 GTGAGCAGGGAAGGGGAAGAGGG + Intergenic
1103217092 12:119210305-119210327 TGGAGTGGGGATGGGGAGAGGGG - Intronic
1103429082 12:120866207-120866229 TTTTCTATGGATGGGGAGGAGGG - Intronic
1104045583 12:125160310-125160332 GTGGGTAGGGATGGGGATGGGGG + Intergenic
1104420669 12:128631985-128632007 TGGAGTGGGGATGGGGGGAAGGG + Intronic
1104812651 12:131627818-131627840 TTAAGTGTGGATGGGGAGAAGGG - Intergenic
1105241647 13:18614435-18614457 ATAAGTATGGATGGGGAGGCTGG + Intergenic
1105668907 13:22590403-22590425 TCATGTAGGGATGGGGAAGAGGG + Intergenic
1106296997 13:28423395-28423417 TTTAGTAGGTCTGGGGTGGAGGG - Intronic
1106364891 13:29068969-29068991 TGGAGTAGGGTAGGGTAGGAAGG + Intronic
1106550686 13:30768444-30768466 TTTAGTAGAGATGGGGTAGATGG - Intergenic
1106553101 13:30788314-30788336 ATGAGTAGGGAGTGGGCGGAAGG + Intergenic
1106816105 13:33408901-33408923 TTGAGCAGAGATGTGAAGGAAGG - Intergenic
1106817013 13:33419489-33419511 TTGATTGGTGATGGGGAGAATGG + Intergenic
1107511604 13:41091211-41091233 TTCAGTGGGGAAGGGTAGGAGGG + Intergenic
1107571400 13:41662770-41662792 TTGAATAGGAATGGTGAGCATGG + Intronic
1107664307 13:42673239-42673261 CTGAGAAGGGATGGGGAGTGGGG - Intergenic
1107872431 13:44759689-44759711 TGGAAGAGGGATAGGGAGGAAGG + Intergenic
1108031373 13:46233198-46233220 TTGAGTAGAAATGAGGAAGATGG - Intronic
1108034774 13:46278681-46278703 TAAAGGGGGGATGGGGAGGAGGG + Intergenic
1108068581 13:46604268-46604290 TGGGGTGGGGATGGTGAGGAGGG + Intronic
1108304995 13:49122452-49122474 TTGAGTAGGAATGGTGAGAGAGG - Intronic
1108344488 13:49531376-49531398 TTGGTCAGGGGTGGGGAGGATGG + Intergenic
1108887975 13:55212993-55213015 TTGAGTAAGGATGTGAAGGATGG + Intergenic
1108962384 13:56250265-56250287 ATGAGTAGGGAGGGATAGGAGGG + Intergenic
1110434325 13:75462590-75462612 TGGTGTAGGGATGGGGGGCAGGG - Intronic
1111108852 13:83681251-83681273 ATGGGAAGGGATGGTGAGGAAGG + Intergenic
1112526060 13:100148410-100148432 TAGAGTAGGGGTGGGGTGGGTGG - Intronic
1113246855 13:108405952-108405974 ATCAGTAGAGATAGGGAGGAGGG - Intergenic
1113313888 13:109158381-109158403 TTGTGGAGGGAGGGGGAGGTAGG - Intronic
1113558364 13:111256620-111256642 GTGAGCAGGGAAGAGGAGGAAGG - Intronic
1114133161 14:19816732-19816754 TTGAATAAGGATGGTGAGAAAGG + Intronic
1114529470 14:23386732-23386754 CTGAGAAGAGATGGGGAGGTGGG + Intronic
1114861850 14:26532545-26532567 GTGAGGATGGATGGGAAGGATGG + Intronic
1115254404 14:31383942-31383964 TTGAATAGGAATGGTGAGAAGGG - Intronic
1115748084 14:36459132-36459154 TAGAGCAGGTAGGGGGAGGAAGG - Intergenic
1116177978 14:41497446-41497468 ATGTGTGGGGCTGGGGAGGATGG - Intergenic
1116178149 14:41499962-41499984 TTGTGTGGGGGAGGGGAGGAGGG - Intergenic
1116185153 14:41591035-41591057 TTGAATAGGGATGGTGAGAGAGG - Intergenic
1116294905 14:43094582-43094604 GTGGGTAGGGGTTGGGAGGAGGG + Intergenic
1116532769 14:45993062-45993084 TTGAGTAGGAGTGGGGAGAGAGG + Intergenic
1116750468 14:48877404-48877426 TTTAGTAGGGATGTAGGGGAAGG - Intergenic
1117080615 14:52148429-52148451 TTGAATAGGAATGGTGAGAATGG + Intergenic
1117601977 14:57385540-57385562 TTGAGGATGGATGGGTGGGATGG + Intergenic
1117802580 14:59460236-59460258 TGGAGCAGGAATGGGGAAGATGG + Intronic
1117925560 14:60775601-60775623 TTGAGTAGGGATTAGGAAGTGGG + Intronic
1118195339 14:63620448-63620470 TTAATCAGGGCTGGGGAGGAGGG + Intronic
1118351697 14:64976801-64976823 TGGGGTGGGGATGGGGTGGATGG - Intronic
1118491818 14:66268588-66268610 TGGAGTAGGGTTGGATAGGATGG + Intergenic
1118964889 14:70571589-70571611 TTGTATAGGCATGGGGAGAATGG - Intergenic
1119073641 14:71613670-71613692 TTTAGCAGGGAAGGGGAGTAAGG - Intronic
1119457780 14:74771010-74771032 TTGAGTAGTTATGGAGAGGGAGG + Intronic
1119464364 14:74843150-74843172 GTGGGTAAGGATGGGGGGGAAGG - Intronic
1119772056 14:77226235-77226257 TTGGGTAGGGGTGGGGTGGAGGG - Intronic
1119952962 14:78764883-78764905 TTGAGTGAGGCTGGGGAGGTTGG - Intronic
1120540255 14:85742258-85742280 TTGAGGAGGAGTGGGGAGGGGGG + Intergenic
1120840716 14:89082844-89082866 GGGAGGAGGGAGGGGGAGGAAGG - Intergenic
1120907847 14:89635718-89635740 TTGAGTAGGGAAGGGGTGAAGGG - Intronic
1121068905 14:90998187-90998209 TTGTTTAGGACTGGGGAGGATGG + Intronic
1121447773 14:93988914-93988936 TGGAGGAGGGAATGGGAGGAGGG + Intergenic
1121676784 14:95760039-95760061 TTGCAGAGGGATGGGGAGGAAGG - Intergenic
1121933563 14:97995771-97995793 TGGAGTAGAGAGAGGGAGGATGG - Intergenic
1122078919 14:99253676-99253698 TTGAGGAGGGGTGAGGAGAAAGG - Intronic
1122137735 14:99644686-99644708 TGGCGTAGGGGTGGGGAGGGAGG - Intergenic
1122529409 14:102415409-102415431 TTGACCAGTGATGTGGAGGAAGG + Intronic
1123050016 14:105536802-105536824 TGGAGTAGGGACGGGCAGCAGGG + Intergenic
1123489701 15:20770714-20770736 ATAAGTATGGATGGGGAGGCTGG - Intergenic
1123546200 15:21339801-21339823 ATAAGTATGGATGGGGAGGCTGG - Intergenic
1123895810 15:24828912-24828934 TGGACTAAGGATGGGGAGGCTGG + Intronic
1124628770 15:31325902-31325924 CTGCGGCGGGATGGGGAGGAAGG + Intergenic
1124667108 15:31602557-31602579 TTGAATAGGAATGGTGAAGAGGG - Intronic
1124951814 15:34329926-34329948 TTGGGGAGGAGTGGGGAGGAAGG + Intronic
1125408763 15:39382981-39383003 GTGAGTGGGGAAGGGGAGAAGGG + Intergenic
1125616276 15:41016481-41016503 CTGAGTAAGGATGTGGAGCAGGG - Intronic
1126502199 15:49358190-49358212 TTGAATAGGAGTGGTGAGGAGGG - Intronic
1127024771 15:54791910-54791932 TTGCTTAGGGATGGGGGGGATGG + Intergenic
1127114364 15:55709839-55709861 TTGCCTGGCGATGGGGAGGAGGG + Intronic
1127145904 15:56023405-56023427 TTTAGTAGAGATGGGGAGGGTGG + Intergenic
1127221386 15:56884862-56884884 TAGAGAAGGGAGGGAGAGGAGGG + Intronic
1127251166 15:57239799-57239821 AAGAGTAGAGATGGGAAGGATGG + Intronic
1127657836 15:61071919-61071941 ATGAGTAGAGATGGGGTAGAGGG + Intronic
1128392418 15:67191090-67191112 TAGACTTGGGATGGGGAGGGAGG + Exonic
1128949376 15:71860350-71860372 TTGAGTTGTGATTGGGAAGATGG + Intronic
1129033903 15:72638464-72638486 TTGTGTGGGTATGGGGAAGAAGG + Intergenic
1129207614 15:74046340-74046362 ATGAGTAGGGATGGGAAGGAGGG - Exonic
1129215979 15:74098752-74098774 TTGTGTGGGTATGGGGAAGAAGG - Intergenic
1129252344 15:74315949-74315971 TGGAGTGGGGAGGGAGAGGAGGG - Intronic
1129408814 15:75337700-75337722 TTGTGTGGGTATGGGGAAGAGGG + Intronic
1129583309 15:76835647-76835669 TTGAATAGGAATGGTGAGGTGGG - Intronic
1129657470 15:77533749-77533771 TGGGGAAGGGAAGGGGAGGAGGG - Intergenic
1129733117 15:77943087-77943109 TTGTGTGGGTATGGGGAAGAGGG - Intergenic
1130029798 15:80301943-80301965 TTGAATAGGGGTGGTGAGAATGG + Intergenic
1130120187 15:81041300-81041322 TTGTTTGGGGATGGGGAAGATGG + Intronic
1130224199 15:82045422-82045444 TCGAGGAGGGATGGGGAGGTGGG - Intronic
1130966685 15:88702571-88702593 TGGAGTAGGGAGGGGCAGAAGGG - Intergenic
1131264968 15:90910404-90910426 TAGAGGAGGGGTGGGAAGGAAGG + Intronic
1131284138 15:91043630-91043652 GTGAGCAGGGCTGGGGAGGCAGG - Intergenic
1131313655 15:91313031-91313053 TGGAGTAGGGGTAGGGAGTAGGG + Intergenic
1131880881 15:96860671-96860693 GTGGGTAGGGATTGGAAGGAAGG - Intergenic
1131947892 15:97647974-97647996 GGGAGGGGGGATGGGGAGGAAGG + Intergenic
1132232239 15:100192868-100192890 TGGGGGAGTGATGGGGAGGAGGG - Intronic
1202954527 15_KI270727v1_random:67017-67039 ATAAGTATGGATGGGGAGGCTGG - Intergenic
1133587713 16:7211957-7211979 GTGAGAAGGGGTGGGTAGGAGGG - Intronic
1133611814 16:7440707-7440729 CTGTTTAGGGCTGGGGAGGAGGG + Intronic
1134368150 16:13598430-13598452 CAGAGATGGGATGGGGAGGAGGG - Intergenic
1134449475 16:14354388-14354410 GAGAGGAGGGAAGGGGAGGAGGG + Intergenic
1134948706 16:18342113-18342135 GAGAGGAGGGAGGGGGAGGAGGG + Intergenic
1135526370 16:23216316-23216338 TTGGGTGGGGAGGGGGAGCATGG + Exonic
1136081033 16:27852764-27852786 TTGGGTGGGGATGGTGAGCATGG + Intronic
1136105220 16:28025500-28025522 TTGAGCCGGGCTTGGGAGGATGG - Intronic
1136449546 16:30345624-30345646 TTTAGTAGAGATGGGGGAGATGG - Intergenic
1137374952 16:47944385-47944407 TGGACTAGTGAGGGGGAGGATGG + Intergenic
1137398002 16:48130659-48130681 TTGAGTTGACATTGGGAGGAGGG - Intronic
1137495380 16:48965326-48965348 TGAAGGAGGGACGGGGAGGAGGG + Intergenic
1137665831 16:50248358-50248380 TTCAGCAGGGATGGGGAGGAGGG - Intronic
1138137061 16:54532287-54532309 CTGGGGAGGGATGGGGAGTAGGG + Intergenic
1138423806 16:56916940-56916962 TAGAGTGGTGAGGGGGAGGAGGG + Intergenic
1138532043 16:57639789-57639811 AGGGGAAGGGATGGGGAGGAAGG - Intronic
1139122156 16:64033552-64033574 TGGACTGGGGCTGGGGAGGATGG + Intergenic
1139326423 16:66155938-66155960 TGGTGTAGGGAGGGGTAGGATGG - Intergenic
1139392918 16:66616785-66616807 ACGCGTAGGGATGGTGAGGAGGG - Exonic
1139588929 16:67922448-67922470 TAGAGAAGGGATGGGAAGGGAGG - Intronic
1139847450 16:69930894-69930916 ATAAGATGGGATGGGGAGGAAGG + Intronic
1140116984 16:72050579-72050601 ATGAGGTGGGAGGGGGAGGAGGG + Intronic
1140163736 16:72527332-72527354 TTGAATAGGAGTGGTGAGGAGGG + Intergenic
1140415900 16:74774032-74774054 GTGAGGTGGGATGGGGAGGTGGG + Intronic
1140448337 16:75049990-75050012 GGTATTAGGGATGGGGAGGAGGG - Intronic
1140669569 16:77263929-77263951 CTGTGTGGGGGTGGGGAGGAGGG - Intronic
1141184870 16:81779690-81779712 TTGAATGGGGACCGGGAGGAAGG + Intronic
1141614558 16:85202958-85202980 GTGGGGAGGGAGGGGGAGGAGGG - Intergenic
1141631801 16:85291813-85291835 TGGCGGGGGGATGGGGAGGAAGG - Intergenic
1141749030 16:85946014-85946036 GTGCATAAGGATGGGGAGGATGG + Intergenic
1142128284 16:88420929-88420951 GTGAGTGGGGGTCGGGAGGAAGG + Intergenic
1142138860 16:88463689-88463711 TTGAGGAGGGAACGAGAGGAGGG + Intronic
1142238045 16:88931855-88931877 TGCAGAGGGGATGGGGAGGAGGG + Intronic
1142292842 16:89200755-89200777 GTGAGAAGAGATGGGGAGGCGGG - Intronic
1142817165 17:2435662-2435684 TGGGGTAGTGGTGGGGAGGAAGG + Intronic
1142958237 17:3535425-3535447 GTGAGGAGGGAGAGGGAGGAAGG - Intronic
1143014535 17:3884558-3884580 TTGAGTTTGGATGGGGAAGTTGG + Intronic
1143166113 17:4897982-4898004 TTGAGGAGGGGTGGGGGGGGAGG - Exonic
1143264202 17:5623561-5623583 TTGATTAGGGAGGAGGAGAACGG + Intergenic
1143521610 17:7447348-7447370 TGGGGGAGGGATGGGGAGGGCGG - Intronic
1143574366 17:7781679-7781701 TTGAGTAGGTCAGCGGAGGAGGG - Intronic
1143761297 17:9105936-9105958 TTGGGTGGGGATGGGGAGTGGGG + Intronic
1143825735 17:9605514-9605536 TTTAGTAGAGATGGCCAGGATGG - Intronic
1144094380 17:11886696-11886718 GTGAAGAGGGATGGGGATGATGG - Intronic
1144399379 17:14880942-14880964 TTGAGTAGGAATGGTGAGAGTGG + Intergenic
1144698566 17:17322121-17322143 TAGAGCAGGAATGGAGAGGATGG + Intronic
1144729506 17:17518425-17518447 TGGAGTGTGAATGGGGAGGAAGG - Intronic
1145271350 17:21406511-21406533 ATGATGAGGGATGGGGAAGAAGG + Intronic
1145309555 17:21693915-21693937 ATGATGAGGGATGGGGAAGAAGG + Intronic
1146000208 17:29126299-29126321 AGGAGGAGGGACGGGGAGGAGGG + Intronic
1146000214 17:29126312-29126334 GGGAGGAGGGACGGGGAGGAGGG + Intronic
1146018155 17:29249965-29249987 CAGAGTAGGGATGAGGTGGAGGG - Intronic
1146147813 17:30437113-30437135 TGGAGTGGGGGTGGGGAGTAGGG + Intronic
1146370768 17:32264646-32264668 TAGAGTAGGGATGGGGAGGAGGG + Intergenic
1146379052 17:32314998-32315020 GTGAGGAAGGATGGGGAGAAGGG + Intronic
1146692529 17:34886518-34886540 TGGAGTAAGGATGGGGATGGAGG + Intergenic
1146801626 17:35828749-35828771 TTGAAGAGGTATGGGGCGGAGGG - Intronic
1146806009 17:35865447-35865469 TTGTGAGGGTATGGGGAGGAGGG + Intronic
1147658514 17:42104720-42104742 TGTGGGAGGGATGGGGAGGAGGG - Intronic
1147842242 17:43379977-43379999 CTGAGTAGGGTGGGGGAGAATGG - Intergenic
1147968868 17:44208987-44209009 TTTAGTAGAGATGGGCAGGCTGG - Intronic
1148010646 17:44477987-44478009 TTTAGTAGAGATGGGGTGGGGGG + Intronic
1148217375 17:45840409-45840431 TGGAGTGGGGGTGGGGAGGGTGG + Intergenic
1148744947 17:49912894-49912916 TTGAGCAGGGATGGGGAAGCAGG + Intergenic
1149077358 17:52611807-52611829 TTTAGAAGGGATGGGGAAGTGGG + Intergenic
1149431466 17:56597682-56597704 GTGGGCAGGGGTGGGGAGGAGGG - Intergenic
1149600783 17:57891769-57891791 TTGAGTAGGGACCAGAAGGAAGG - Intronic
1149786556 17:59440463-59440485 TTTTGTAGAGATGGGGAGGGGGG - Intergenic
1149993517 17:61395680-61395702 CTTAGCAGGGATGGGGAGGGCGG + Intergenic
1150124906 17:62629242-62629264 GTGGGAAGGGGTGGGGAGGATGG + Intronic
1150202279 17:63369924-63369946 TTGTGTAGGGAAGGTAAGGATGG - Intronic
1150381248 17:64721774-64721796 TTGCCTAGGGCTGGGGAGGAAGG + Intergenic
1150466467 17:65397124-65397146 AGGAGTAGGTATGTGGAGGAAGG + Intergenic
1150775253 17:68076329-68076351 TTGCCTAGGGCTGGGGAGGAAGG - Intergenic
1151117023 17:71748185-71748207 TTGCCAGGGGATGGGGAGGAGGG - Intergenic
1151246965 17:72802640-72802662 TTGAGTGGGGAAGGGAAGGGAGG + Intronic
1151516435 17:74599146-74599168 ATGTGCAGAGATGGGGAGGAAGG + Intergenic
1151556538 17:74849691-74849713 TTGGGTGGGGATGGGGAGTTGGG - Intronic
1151933726 17:77248688-77248710 TGGAGGAGGGATGAGGTGGAGGG - Intergenic
1152410421 17:80120239-80120261 GTGAGGAGGGGAGGGGAGGAGGG - Intergenic
1153314732 18:3710794-3710816 TGGAGTTGGGAGGTGGAGGAAGG + Intronic
1154447311 18:14445471-14445493 ATAAGTATGGATGGGGAGGCTGG - Intergenic
1155552692 18:26982620-26982642 TTTAGAAGGGATGGGGATGAGGG + Intronic
1156223153 18:35074757-35074779 TAGTGGAGGGGTGGGGAGGAGGG - Intronic
1156468489 18:37362704-37362726 TTGACACAGGATGGGGAGGAAGG - Intronic
1156519247 18:37707761-37707783 TAGAGGTGGGATGAGGAGGAAGG - Intergenic
1156554110 18:38048035-38048057 TGGAGTAGAGGTGTGGAGGAAGG - Intergenic
1156654172 18:39263901-39263923 TTGAATAGGAGTGGAGAGGAAGG - Intergenic
1157865876 18:51184197-51184219 TTGAGTAGGGAGTGGGAGGTGGG - Intronic
1158059102 18:53316984-53317006 TTGAATAGGGATGGTGAGAGAGG + Intronic
1158592147 18:58786832-58786854 TTTGGGAGGAATGGGGAGGATGG - Intergenic
1158742343 18:60157332-60157354 CTGAGAAGGGAAGGGGAGAAAGG + Intergenic
1159149804 18:64506042-64506064 TGGAGCAGGGATGGGGGGCAGGG - Intergenic
1160676170 19:392500-392522 GTGAGTGGGGCTGGGGAGGAGGG + Intergenic
1160703293 19:518203-518225 TTGAGTAGGGGCTGGGAAGAGGG + Intronic
1160703361 19:518368-518390 TTGAGTAGGGGCTGGGAAGAGGG + Intronic
1160916841 19:1500808-1500830 TGGAGCAGAGAAGGGGAGGAGGG + Intergenic
1160962373 19:1728704-1728726 TTGAGTGGGGAGGGAGAGGGAGG + Intergenic
1160965291 19:1744674-1744696 GGAAGAAGGGATGGGGAGGAGGG - Intergenic
1160965689 19:1746077-1746099 ATGGGGAAGGATGGGGAGGAGGG + Intergenic
1160965720 19:1746158-1746180 ATGGGGAAGGATGGGGAGGAGGG + Intergenic
1160965759 19:1746272-1746294 TGGAGGAGGAGTGGGGAGGAAGG + Intergenic
1161570452 19:5027719-5027741 TTGAGTAGAGATGGGGTTCATGG + Intronic
1162174753 19:8822800-8822822 TTGAAGAAGGATGGGAAGGATGG - Intronic
1162297229 19:9821684-9821706 CTGAGTAGGGATGGCAGGGAAGG - Intronic
1162513185 19:11132087-11132109 GTGGGTAGGGGTCGGGAGGATGG - Exonic
1162792770 19:13071671-13071693 TTAAGTGGGGATGGGGTGGAGGG + Intronic
1162869625 19:13575722-13575744 TTTGGTAGAGATGGGGGGGAGGG - Intronic
1162927098 19:13936170-13936192 TTGAGTAGGGATGGGGAGGAGGG - Intronic
1163444940 19:17340733-17340755 GTGAGTAGGGCAGGGCAGGAGGG - Intronic
1163632563 19:18424856-18424878 CTGAGCAGGGAGGGGGAGAATGG + Intronic
1164400314 19:27897558-27897580 TTAAGTGGTGGTGGGGAGGAGGG - Intergenic
1164592167 19:29513051-29513073 TAGAGGAAGGATGAGGAGGAAGG + Intergenic
1164592497 19:29514194-29514216 AGGAGGAGGGATGAGGAGGAAGG + Intergenic
1164868756 19:31626059-31626081 TAGAGTGGAGATGGGGAGGAAGG - Intergenic
1165164052 19:33838978-33839000 TTGAGGGAGGATGGGGAAGAAGG + Intergenic
1165255697 19:34576337-34576359 ATGACTGGGGATGGGGAGCAAGG + Intergenic
1165906203 19:39196361-39196383 CAGAGTGGGGAGGGGGAGGAGGG + Intergenic
1165989155 19:39796499-39796521 TGGCTTAGGGATGGGGAGGATGG + Intergenic
1166014463 19:39969916-39969938 TTTAGAAGGGATCGGGAGGCCGG + Intergenic
1166337502 19:42117219-42117241 TTGGGGAAGGATGGGGACGAGGG - Intronic
1166390888 19:42408168-42408190 TTGGGCAGGAGTGGGGAGGAGGG + Intronic
1166653862 19:44595872-44595894 TTGAGTGGGGCTTAGGAGGAAGG + Intergenic
1166743914 19:45130881-45130903 CAGAGGAGGGATGGGGAGGGAGG - Intronic
1167139051 19:47636976-47636998 TTGACTAAGGAGGGGAAGGAGGG - Intronic
1167302630 19:48687599-48687621 TTTAGTAGAGATGGGGTGGTGGG + Intergenic
1167304214 19:48697498-48697520 TTTTGTAGGGATGGTGGGGAGGG - Intronic
1167440632 19:49506765-49506787 TTGTGTAAGGGTGGAGAGGAGGG + Intergenic
1167516374 19:49925420-49925442 TTTAGTAGAGATGGGGGGGAGGG - Intronic
1167706945 19:51086710-51086732 TCGAGTAGGGATGGTGGGGCAGG + Intergenic
1167798165 19:51724221-51724243 TAGAGGAGGGAGGGAGAGGAGGG - Intergenic
1168100509 19:54138573-54138595 GTGAGGAGGGATGCGGAGGGCGG - Intronic
1168497579 19:56866672-56866694 TGGAGTGGGGAAGGGGAGGGAGG - Intergenic
1202711759 1_KI270714v1_random:22961-22983 GTGAGTAGGGTGGGGGAGGATGG - Intergenic
925920336 2:8633649-8633671 TTAAGTAAGGAGGGGGACGAAGG - Intergenic
926029710 2:9575551-9575573 TTGGGGGGGGTTGGGGAGGAGGG - Intergenic
926086147 2:10021585-10021607 TAAAGCTGGGATGGGGAGGAGGG - Intergenic
926246012 2:11122901-11122923 TGGGGTGGGGGTGGGGAGGAGGG - Intergenic
926445055 2:12931342-12931364 TAGAAGAGGGATGGGGAAGATGG + Intergenic
927079388 2:19612693-19612715 TTTAGTAGAGATGGGGTGGCCGG + Intergenic
927602409 2:24455496-24455518 TTTAGTAGAGATGGGGGGGGGGG + Intergenic
928147887 2:28796811-28796833 TTGAATAGGGGTGGTGAGAATGG + Intronic
928576597 2:32661805-32661827 TTGAATAGGAATGGTGAGGGAGG + Intronic
928698397 2:33873473-33873495 TTGCCTAGGGCTGGGGAGGATGG - Intergenic
929329634 2:40665641-40665663 TAGAGTAGGGATGGAGAAGAGGG - Intergenic
929618801 2:43334248-43334270 TGGAGTATGGATGAGGGGGATGG + Intronic
929739286 2:44586432-44586454 TTGCCTAGGGAAGGGTAGGAAGG - Intronic
930356764 2:50330507-50330529 AGGAGTAGGTATTGGGAGGAAGG - Intronic
931454192 2:62394527-62394549 TTGACTAGGAATGGGGAGAGAGG - Intergenic
932217425 2:69975999-69976021 TGGGGTGGGGAAGGGGAGGACGG - Intergenic
932247489 2:70207732-70207754 TTTAGTAGAGATGGGGGGGGGGG + Intronic
933236503 2:79870469-79870491 GGGAGTGGGGAAGGGGAGGAAGG + Intronic
933391303 2:81671596-81671618 TAAAGAGGGGATGGGGAGGATGG - Intergenic
934113237 2:88761680-88761702 TGGAGTGGGGAGGGGGAGGGGGG - Intergenic
934733479 2:96674179-96674201 TTGCCTAGGGCTGGGGAGGTGGG - Intergenic
935293269 2:101627564-101627586 TTGGGGAGGGATGGGCAGGGAGG - Intergenic
935689332 2:105716156-105716178 TTGAGTTGGGATGGGGCGGTGGG - Intergenic
935874385 2:107490118-107490140 GTGAGTGGGGAAGGGGAGGAAGG + Intergenic
936041400 2:109152728-109152750 TTGAGTAGGCATGGGCAGAGGGG + Intronic
936094551 2:109521903-109521925 TTCTGCAGGGATGGGGAGGGAGG + Intergenic
937859887 2:126699265-126699287 CTGACTAGGGATGGGGATGCTGG - Intergenic
938187695 2:129246707-129246729 TACAGGAGGGGTGGGGAGGAGGG - Intergenic
938482769 2:131675389-131675411 ATAAGTATGGATGGGGAGGCTGG + Intergenic
940071562 2:149693978-149694000 TTCTGTAGGGATGGAGAGAAAGG + Intergenic
940267970 2:151860133-151860155 GTGAGCAGGGCTGTGGAGGATGG - Intronic
940470565 2:154093864-154093886 TTGATGGGGGATGGGAAGGAGGG - Intronic
940610852 2:155989808-155989830 GGGAGAAAGGATGGGGAGGAAGG - Intergenic
940671081 2:156668693-156668715 TTGAGTAGGGGTGGTGAGAAGGG + Intergenic
942939334 2:181598182-181598204 CTGTGTAGGGATGGGGAGTTGGG - Intronic
943184702 2:184592815-184592837 TTAAGTAAAGATGGGGAGGAGGG - Intergenic
943211034 2:184966422-184966444 TTGAGTGCGGAGGGGGAAGAGGG - Intergenic
943618298 2:190118821-190118843 TTGAATAGGAATGGTGAGAAAGG - Intronic
944474776 2:200092484-200092506 GTGGGTGGGGATAGGGAGGATGG + Intergenic
944649861 2:201819130-201819152 TAGAGGTGGGATGGGGTGGAGGG + Intronic
944753388 2:202734109-202734131 TTGAGTAGGGCTGGGAAAGTTGG + Intronic
945761225 2:213917812-213917834 TAGAGTAGGGATGGTGAAGAAGG + Intronic
945906298 2:215597315-215597337 TTTTGTAGGGGTGTGGAGGAAGG - Intergenic
946307769 2:218865861-218865883 ATGAGGAGAGATGGTGAGGAAGG + Intronic
946322632 2:218962540-218962562 GTGGGGAGAGATGGGGAGGAAGG - Intergenic
946322931 2:218963976-218963998 CTGAGAAGGCAAGGGGAGGAGGG + Intergenic
946458067 2:219845259-219845281 TTGAGGCAGGATGAGGAGGAGGG + Intergenic
946943878 2:224799173-224799195 TTGCCTAGGGATGTGGAGGAAGG - Intronic
947330582 2:229025393-229025415 GGGAGTGTGGATGGGGAGGAAGG - Exonic
947370035 2:229436093-229436115 TTGAGTGGGGAGGAGGATGAGGG - Intronic
948001558 2:234572197-234572219 TTGAGTAGGGGTAGAGAGAAAGG + Intergenic
948217219 2:236240629-236240651 TTGAGTGGGCAGGGGGAGGAGGG + Intronic
948379261 2:237541527-237541549 ATGAGAAGGGAAGTGGAGGAGGG - Intronic
948577623 2:238964906-238964928 TTGAGATGGGGTGGGGAGGTAGG - Intergenic
948869193 2:240789841-240789863 TGGAGGAGGGAGGGGGAGGAGGG - Intronic
1169184840 20:3605745-3605767 TTGGAGAGTGATGGGGAGGAAGG + Intronic
1169244486 20:4015226-4015248 CTGAGGAGGGACGCGGAGGAGGG - Intronic
1169300856 20:4440891-4440913 TGGAATAGGGATGGGTAGGCTGG + Intergenic
1169329079 20:4702559-4702581 TTGAGGAAGGCTGAGGAGGAAGG + Intergenic
1169922899 20:10754444-10754466 TTGCGTAGAGAGAGGGAGGAGGG + Intergenic
1171854635 20:30333353-30333375 TTGAGCAGGGGTGGGGAGGTGGG - Intergenic
1172151943 20:32796896-32796918 TAGAGGAGGCAAGGGGAGGAAGG - Intronic
1172686799 20:36761825-36761847 TTTAGTAGGGATGGGGGAGATGG - Intronic
1173067977 20:39732608-39732630 TTGAATAGGAATGGTGAGAAAGG - Intergenic
1173319491 20:41974664-41974686 TTGAGGAGGTGTGGGGAGGAGGG + Intergenic
1173320594 20:41983819-41983841 GAGAGTAGGGATGGGCAGGGTGG + Intergenic
1173579044 20:44133061-44133083 TGGAGCAGGGATGGGGACGGTGG - Intronic
1173998162 20:47355843-47355865 TGGAGTAGGGATGGGGACTGGGG - Intronic
1174102353 20:48137394-48137416 GGAAGGAGGGATGGGGAGGAAGG - Intergenic
1174230946 20:49045243-49045265 TAGGTTATGGATGGGGAGGAGGG + Intergenic
1174387873 20:50197896-50197918 TGGAGTAGGGGAGGGGAGGATGG + Intergenic
1174387965 20:50198140-50198162 TGGAGTGGGGGAGGGGAGGATGG + Intergenic
1174387999 20:50198239-50198261 TGGAGTGGGGGAGGGGAGGATGG + Intergenic
1174543400 20:51307032-51307054 CTGCGCAGGGCTGGGGAGGAGGG - Intergenic
1174694907 20:52547350-52547372 TTGAATAGGAATGGTGAGGGAGG - Intergenic
1174965240 20:55206169-55206191 TTGAATAGGAATGGTGAGAATGG + Intergenic
1175801787 20:61805202-61805224 TTGGGTAGGGATGGGGGGCTGGG - Intronic
1175872110 20:62213550-62213572 GAGAGCAGGGATGGGGGGGAAGG + Intergenic
1175872147 20:62213637-62213659 GAGAGCAGGGATGGGGGGGAAGG + Intergenic
1175872184 20:62213724-62213746 GAGAGCAGGGATGGGGGGGAAGG + Intergenic
1175873960 20:62220726-62220748 AGGAGAAGGGATGGGGAGGAGGG + Intergenic
1176298441 21:5086773-5086795 TTAAGTAGGGATGCCAAGGATGG - Intergenic
1176865727 21:14053734-14053756 TTGAATAGGAGTGGTGAGGAAGG + Intergenic
1177130041 21:17244563-17244585 TTGAGTAGGAATGGTGAGAGAGG - Intergenic
1177663018 21:24112486-24112508 TTCTTTAGGGAAGGGGAGGATGG - Intergenic
1177841324 21:26236914-26236936 ATGAGTAGCGAGGGAGAGGATGG - Intergenic
1178172964 21:30062386-30062408 TTGGGTGGGGAGGGGGTGGAGGG - Intergenic
1178307682 21:31504039-31504061 TTGGGCAGGGATTGGCAGGAGGG - Intronic
1178770706 21:35501186-35501208 TACAGTAGGTATGGGGAGCAGGG - Intronic
1179376328 21:40852849-40852871 GTGGGGAGGGACGGGGAGGATGG + Intergenic
1180098688 21:45574316-45574338 TGGAGTCCGGAGGGGGAGGAGGG - Intergenic
1180121980 21:45758777-45758799 TTGATTAGAGATGGTGAGAAGGG + Intronic
1180613472 22:17112444-17112466 GTGCCTAGGGATGGGGAGGTTGG - Exonic
1181169796 22:21001654-21001676 TGCAGTCGGGAAGGGGAGGACGG - Intronic
1181688745 22:24546532-24546554 TTGACAAGGGATGGGGAACAGGG - Intronic
1181887320 22:26031616-26031638 TTGAGTGGGGCTGGGGAAGTGGG + Intergenic
1182424955 22:30266915-30266937 GTGGGTGGGGATGGGGAGGGGGG + Intergenic
1183077038 22:35433777-35433799 CTGAGGAGGGATGGGGAGGGTGG - Intergenic
1183532732 22:38371424-38371446 TTGAGTAGGGGGAGGGGGGAGGG - Intronic
1183735774 22:39644035-39644057 TGGAGGAGGGATGGGGAGGTGGG + Intronic
1183828921 22:40407864-40407886 TTGAGCTGGGAGAGGGAGGAGGG + Intronic
1183834893 22:40444091-40444113 TTCAGTAGGGAAGGTGGGGATGG - Intronic
1184168823 22:42746671-42746693 TTTAGTAGAGATGGTGAGGCAGG + Intergenic
1184600222 22:45539088-45539110 AGGAGAAGGGAGGGGGAGGATGG - Intronic
1184965071 22:47965635-47965657 GTGAATAGGGAAGGGGAAGAGGG + Intergenic
1185110176 22:48896325-48896347 CAGAGTGGGGATGGGGCGGAGGG + Intergenic
1185339783 22:50286117-50286139 GTGAGCAGGGCTGGGGTGGACGG + Intronic
949207163 3:1453985-1454007 TGGATGAGGGGTGGGGAGGATGG + Intergenic
949800791 3:7902088-7902110 TTGAGTAGGAGTGGGGAGAGAGG + Intergenic
950151229 3:10688971-10688993 TGGTGTGGGGGTGGGGAGGAGGG + Intronic
950187040 3:10951697-10951719 GGGAGTAGGGATGGGGAGGAGGG - Intergenic
950501049 3:13364053-13364075 TTGAGTTGGGATGTGGGGGCAGG + Intronic
950711968 3:14819462-14819484 CTGAGCAGGGAGGGTGAGGAAGG + Exonic
950777288 3:15361678-15361700 ATTAGTAGGTATGGGGAGGAAGG + Intergenic
951118517 3:18894694-18894716 TTGAAAAGGCATGGAGAGGATGG + Intergenic
951214619 3:20012139-20012161 TTGAGTAGTGATGGTGATGGTGG + Exonic
951222536 3:20083915-20083937 TTTTGTTGGGATAGGGAGGATGG + Intronic
951722857 3:25720197-25720219 AGGAGTAGGGATGGGGAGAAAGG + Intronic
951854891 3:27185386-27185408 TTGGGTAGGAATGTGGAAGATGG + Intronic
952281236 3:31925342-31925364 GTGGGAAGGGATGTGGAGGATGG - Intronic
952686048 3:36149413-36149435 TGGAGTGGGGAAGGAGAGGAAGG + Intergenic
953767678 3:45756283-45756305 GTGAGTGGGGATTGAGAGGAGGG + Exonic
953839128 3:46374661-46374683 TTGGGAAGACATGGGGAGGAAGG + Exonic
954136105 3:48582905-48582927 TTGAGGAGGGGTGAGGAGCAGGG + Intronic
954282574 3:49593054-49593076 GGGATTAGGGATGGGGTGGAAGG - Intronic
956163269 3:66377042-66377064 CTGAGTAGGTATGGGGAGGGGGG + Intronic
956520074 3:70094383-70094405 TTTAGTGGGGATGGGGAAGTGGG - Intergenic
957084453 3:75667706-75667728 GAAAGTAGGGAGGGGGAGGAAGG + Intergenic
957159973 3:76598258-76598280 GTGCTTAGGGATGGGAAGGAAGG + Intronic
957362380 3:79175975-79175997 TTGAGTATGAAAGTGGAGGAAGG - Intronic
957729059 3:84108409-84108431 TTTAGTGGGGAGAGGGAGGAAGG + Intergenic
957893206 3:86386681-86386703 TTGTGTGGGGGTCGGGAGGAAGG + Intergenic
958272212 3:91515799-91515821 TGGAGGTGGGAAGGGGAGGATGG - Intergenic
959749584 3:109817689-109817711 TGGGGTTGGGATGGGGAGTAAGG + Intergenic
959888784 3:111531294-111531316 TTGTTTAGGCATTGGGAGGATGG + Intronic
960128380 3:114025771-114025793 TTTGGTAGAGATGGGGAAGAAGG - Intronic
961706513 3:128790881-128790903 TTGAGGTGGGAAGGGGAGGCTGG - Intronic
962258230 3:133886550-133886572 CTGAGCAGGGATGGGGAGCTGGG + Intronic
962578399 3:136775325-136775347 TTTAGTAGAGATGGGGGGGGGGG + Intergenic
962883896 3:139605209-139605231 ATGAATAAGGATGAGGAGGAAGG - Intronic
963307832 3:143673561-143673583 TGGAGTAGGGAAGGGTGGGAGGG + Intronic
963461595 3:145620905-145620927 TTGCCTAGGGATGGAGAGGAGGG + Intergenic
964104877 3:153028218-153028240 TTGAGTGGGGAAAGGGAGGTGGG + Intergenic
964268593 3:154930081-154930103 TTTAGTAGAGATGGGGTGGGAGG + Intergenic
965395795 3:168159353-168159375 TTGAGGAGAGGTGGGGAGCACGG + Intergenic
965745256 3:171918254-171918276 TTGACTAGGGAAGGGCAAGAGGG + Intronic
965823153 3:172705174-172705196 TTTTGTAGAGATGGGGAGGGTGG + Intronic
965939775 3:174165236-174165258 TTGAATAGGAATGGTGAGAATGG + Intronic
966062641 3:175778164-175778186 ATTACTAGGGATGTGGAGGAAGG + Intronic
966297463 3:178440821-178440843 TGGAGAAGGGATGGGGATGCAGG - Intronic
966924297 3:184634464-184634486 TGGAGAAGGGATGGGCAGGAAGG - Intronic
967293003 3:187939961-187939983 TTTAGTAGAGCTGGGGAGGTGGG + Intergenic
968555672 4:1245419-1245441 CTGTGTTGGGAAGGGGAGGAAGG - Intronic
969099890 4:4760859-4760881 TTGAGGGGTGATGGGGTGGAGGG - Intergenic
969294003 4:6258622-6258644 TTTAGTAGAGATGTGGAGGGAGG + Intergenic
970412837 4:15826193-15826215 TTGAGAAGTGATGCGGAGGTAGG - Intronic
970428488 4:15966522-15966544 ATCAGTGGGGATGGAGAGGAAGG + Intronic
970566972 4:17341003-17341025 TAGTGTAGGGTTGGGGAGGGGGG - Intergenic
971043109 4:22777001-22777023 ATGAGAAGGGTTGGGGGGGATGG + Intergenic
971434286 4:26603888-26603910 TTGAAGATGGATGGTGAGGATGG - Intronic
972718534 4:41673353-41673375 CTGGGTAGGGGTGGAGAGGAAGG + Intronic
973629828 4:52810176-52810198 TTAAGTTGGGATGGGGATCAAGG + Intergenic
974590738 4:63944687-63944709 GAGAGTAGGGAGTGGGAGGAGGG - Intergenic
975561351 4:75710988-75711010 TTGAATAGGAATGGTGAGAAAGG - Intronic
975926773 4:79464776-79464798 GTGTGTAGGGATGGGAAAGATGG + Intergenic
975992471 4:80271518-80271540 TTGAGAAGGCACGGGGTGGACGG - Intronic
976379338 4:84381633-84381655 TTGTGGAGTGATGGGAAGGAAGG - Intergenic
976682534 4:87773174-87773196 TTGAATAGGAATGGGGAGAGAGG - Intergenic
976928916 4:90538191-90538213 GTGAGTAGGGATGGGGCTGGGGG + Intronic
978139454 4:105301166-105301188 TTGAGTAGGAATGGTGAGAGAGG - Intergenic
978764436 4:112389936-112389958 AGGAGTAGTGATGGGGTGGAGGG - Intronic
978982747 4:114969459-114969481 TTGAGTGTGGAGGGAGAGGATGG - Intronic
979621673 4:122805218-122805240 TGGAGCCAGGATGGGGAGGATGG - Intergenic
980099002 4:128522691-128522713 CTGAGTGGGGAATGGGAGGAAGG - Intergenic
980540052 4:134181473-134181495 TTGAGTAGGAGTGGTGAGAAAGG - Intergenic
980981430 4:139657589-139657611 AGGAGAAGGGAGGGGGAGGAAGG + Intergenic
981063472 4:140454144-140454166 TTGAATAGGAGTGGTGAGGATGG + Intronic
981663969 4:147200434-147200456 GAAAGTAGTGATGGGGAGGAGGG + Intergenic
981758840 4:148171472-148171494 TTGGACAGCGATGGGGAGGATGG + Intronic
981859466 4:149337616-149337638 TTGAATAGGGATGGTGAGAGAGG + Intergenic
982130528 4:152224976-152224998 CTGAGAAGGGAAGGGGAGGGAGG - Intergenic
982190212 4:152846201-152846223 TAGAGTAGGGAGGGAGAGAAGGG + Intronic
982313542 4:154009463-154009485 TTGTGTGGCGATTGGGAGGAGGG + Intergenic
985380792 4:189392633-189392655 TTGGGTGGGGGTGGGGGGGAAGG - Intergenic
985475001 5:73953-73975 TTAGGAAGGGATGGGGAGGCTGG - Intergenic
985479252 5:97459-97481 TTGCCTGGGGCTGGGGAGGACGG - Intergenic
985872501 5:2568628-2568650 GTGTGAAGGGATGGGAAGGAGGG + Intergenic
986356301 5:6930593-6930615 TTGAATAGGGGTGGTGAGGGAGG + Intergenic
986736838 5:10674348-10674370 CGGAGCAGGGATGGGCAGGAGGG - Intergenic
987982119 5:25099273-25099295 TTGAGGAGGGACAGGAAGGAAGG - Intergenic
988210171 5:28193433-28193455 TTTAGTAGGTATGGGGAATAAGG + Intergenic
988737557 5:34037956-34037978 TGGAGAAGGGAGGGGAAGGAGGG + Intronic
990230549 5:53708692-53708714 TTGAATAGGAGTGGGGAGAAAGG + Intergenic
990984468 5:61628336-61628358 TTGAATAGGAATGGTGAGAAAGG - Intergenic
991144396 5:63283828-63283850 TTGAGTGGGGACGGGGAGGGTGG + Intergenic
991194534 5:63917165-63917187 GAGAGTAGGAAGGGGGAGGATGG - Intergenic
992013548 5:72554611-72554633 CTGAGTGGGGAGGGGCAGGAAGG - Intergenic
992080710 5:73232977-73232999 CTAAGCGGGGATGGGGAGGAGGG - Intergenic
992158806 5:73980808-73980830 TCCAGTAGGGTTGGGTAGGATGG - Intergenic
992370399 5:76137825-76137847 TGGAGTGGGAGTGGGGAGGAGGG + Intronic
992896879 5:81253259-81253281 TTGGGTGGGGGTCGGGAGGAGGG + Intronic
993007455 5:82443840-82443862 TGGAGTAGGGTTGGGGAAGCAGG + Intergenic
993156864 5:84236457-84236479 TTGGGTTTGGATAGGGAGGAAGG - Intronic
994424827 5:99572076-99572098 TTGAATAGGCATGGTGAGGGTGG - Intergenic
995556096 5:113330657-113330679 TTGTGTAGGGGAGGGGAAGAGGG - Intronic
996521644 5:124433835-124433857 AGGAGTAGGGATAGGGAGGTTGG + Intergenic
996872267 5:128204390-128204412 TTGCTTAGGGCTGGGAAGGATGG - Intergenic
996885406 5:128347956-128347978 TTTAGTAGAGACGGGGAGGGGGG + Intronic
997099152 5:130948883-130948905 TTGAATAGGAATGGTGAGAATGG - Intergenic
997151172 5:131496978-131497000 TAGGGTGGGGGTGGGGAGGAGGG + Intronic
997351491 5:133234388-133234410 CAGAGGAGGGATGGGCAGGAGGG + Intronic
997803388 5:136889217-136889239 TTTAGTGGGGGTGGGGGGGATGG - Intergenic
998136317 5:139676348-139676370 GGGAGGAGGGCTGGGGAGGAGGG - Intronic
998314005 5:141163074-141163096 TTCAGTAAGGATGGGTAGGATGG + Intergenic
998705562 5:144755630-144755652 TGGACAAGGGAAGGGGAGGAGGG + Intergenic
999236631 5:150101861-150101883 TAAAGTAGGGATGGGATGGATGG - Intronic
999791609 5:154945126-154945148 TGGGGTGGGGATGGGGAGCAAGG + Intronic
1000093359 5:157949377-157949399 TTGGGTAGAGATGGGGGTGAGGG + Intergenic
1000265243 5:159630051-159630073 TTGGGGTGGGATGGGGTGGAAGG - Intergenic
1000848042 5:166305623-166305645 CTGAGAAAGGGTGGGGAGGATGG - Intergenic
1001129251 5:169050008-169050030 TAGAGGAGAAATGGGGAGGAGGG - Intronic
1001446693 5:171790725-171790747 ACCAGTGGGGATGGGGAGGAGGG + Intronic
1001732844 5:173973009-173973031 TTGATGAGGGGTGGGGAGGGAGG + Intergenic
1001763352 5:174225392-174225414 TGGAGTGGGGGTGGGGAGGGTGG - Intronic
1001988105 5:176093105-176093127 TTGAGGTGGGCTTGGGAGGAGGG - Intronic
1001989313 5:176103137-176103159 TTGAGGTGGGTTTGGGAGGAGGG - Intronic
1002109393 5:176898103-176898125 GTGTGTGGGAATGGGGAGGAGGG - Intronic
1002200647 5:177525926-177525948 TTGAGGTGGGATGGAGAGGTTGG - Intronic
1002227557 5:177735001-177735023 TTGAGGTGGGTTTGGGAGGAGGG + Intronic
1002228763 5:177745035-177745057 TTGAGGTGGGCTTGGGAGGAGGG + Intronic
1002266583 5:178038748-178038770 TTGAGGTGGGCTTGGGAGGAGGG - Intronic
1002309915 5:178308163-178308185 TTGTTAAGGGAAGGGGAGGAGGG + Intronic
1002946520 6:1766552-1766574 TTGTGTATGGCTCGGGAGGAGGG + Intronic
1003141588 6:3476097-3476119 TTGAGTAGTGAGGGGAGGGAAGG + Intergenic
1003283039 6:4710728-4710750 GTGAGTAGGGGAGGGGAGAAGGG - Intronic
1003860864 6:10320493-10320515 GGGAGTGGGGTTGGGGAGGATGG - Intergenic
1003870152 6:10396099-10396121 CTGAGGTGGGGTGGGGAGGATGG - Intronic
1004667502 6:17761940-17761962 ATGCGAGGGGATGGGGAGGAAGG + Intronic
1004714224 6:18201650-18201672 TTTAGGAGGTATGGGGAGAACGG + Intronic
1004839721 6:19569242-19569264 TTGAGAAGGAATGGGGAGGGAGG - Intergenic
1004860558 6:19800788-19800810 TTGAGTATAGAGTGGGAGGAGGG + Intergenic
1005092959 6:22078468-22078490 ATGCATAGGGATGGGCAGGAAGG + Intergenic
1005574940 6:27181881-27181903 TTGAGTAGGCATATGGATGAAGG - Intergenic
1005580332 6:27228195-27228217 TTTAGTAGAGATGGGGGGGGGGG - Intergenic
1005770098 6:29060658-29060680 TTGAGTAGGCGTGGTGAGAAAGG + Intergenic
1006190138 6:32202403-32202425 TTGTATAGGCATGGGGAGGGAGG + Exonic
1006379012 6:33687146-33687168 GTGTGTTGGGATGGGGATGAGGG + Intronic
1006505415 6:34485903-34485925 GGGAGTGGAGATGGGGAGGATGG + Intronic
1006510634 6:34519318-34519340 TTGAGGAGGAAGGAGGAGGATGG - Intronic
1006674486 6:35752411-35752433 GTGCGTAGGGCTGGAGAGGATGG - Intergenic
1006830639 6:36965898-36965920 TTGATTGGGGCTGGGGAGGTTGG - Intergenic
1006935057 6:37711530-37711552 TTGAGAAGGAATGGTGATGAGGG - Intergenic
1007225829 6:40313460-40313482 ATGGGGTGGGATGGGGAGGACGG - Intergenic
1007325856 6:41059036-41059058 TTGCCTAGGGAAGAGGAGGAGGG + Intronic
1007587999 6:43003913-43003935 TTTAGTAGAGACGGGGTGGATGG + Intronic
1007655224 6:43447611-43447633 ATGAGGAGCGATGGTGAGGAGGG - Intronic
1007977142 6:46113353-46113375 TAGAGTAGGGTTCGGGAAGAAGG + Intergenic
1008084194 6:47226801-47226823 TTGTGGAGGGATGGGGAAGGTGG + Intergenic
1008211306 6:48728774-48728796 CGGAGAAGGGATGGGGAGGATGG - Intergenic
1008949283 6:57137759-57137781 TTGCCTAGGGATGAGGAAGATGG - Intronic
1008971587 6:57375104-57375126 TTGAATAGGGGTGGTGAGAAAGG + Intronic
1009170963 6:60398200-60398222 TGGAGGTGGGAAGGGGAGGATGG + Intergenic
1009323564 6:62321418-62321440 TTGCCTGGGGATTGGGAGGAAGG + Intergenic
1009483705 6:64193641-64193663 TTGGGTGGGGGTAGGGAGGAGGG - Intronic
1009552730 6:65119966-65119988 TTTAGTAGAGACGGGGAGGGGGG - Intronic
1009556922 6:65182057-65182079 TTGGGTAGGGGTAGGGGGGAGGG + Intronic
1009960572 6:70515840-70515862 ATGTGTAGGGGTGGGGAAGAGGG + Intronic
1010721924 6:79292380-79292402 GAGACTAGGGATGGGGTGGAGGG + Intergenic
1011010335 6:82696290-82696312 AGGAGTAGGGATGGGCAGAATGG - Intergenic
1011538190 6:88401067-88401089 TGGAGTTGACATGGGGAGGAGGG - Intergenic
1011559576 6:88600959-88600981 TGGAGAAAGTATGGGGAGGAGGG - Intergenic
1011637225 6:89385724-89385746 TTTGGTAGGGGTGTGGAGGAGGG - Intronic
1011756484 6:90503458-90503480 TTGAGGAGAGATGTGAAGGAAGG - Intergenic
1012218854 6:96623473-96623495 TCGAGTAGGGGTGGGAAGGAAGG - Intergenic
1012400670 6:98840705-98840727 TTGAGTAGTGCTGGGGAGCCAGG + Intergenic
1012509100 6:99982275-99982297 CTGAGTAGGGTTGGGGAAGGTGG - Intronic
1012526602 6:100185205-100185227 TGGAGAAGTGATGGGGAAGATGG - Intergenic
1013056594 6:106589193-106589215 AGGAGGAGGGAGGGGGAGGAGGG + Intronic
1013198232 6:107864868-107864890 GTGAGTAGGGATGGGTAGGTGGG + Intergenic
1013287069 6:108690879-108690901 TGGAGGAGGAGTGGGGAGGATGG + Intergenic
1013601832 6:111712413-111712435 TTGACTGGGGCTGGGGAGGAGGG - Intronic
1013716220 6:112966546-112966568 TTGAGTAGGAATGGTGAGAGAGG - Intergenic
1013786969 6:113792848-113792870 TTCTGTAGGGAGGGTGAGGAAGG - Intergenic
1013787554 6:113798755-113798777 TGGAGTAGGGATCGGGATGGGGG - Intergenic
1014079818 6:117272978-117273000 TAGGGAAGGGATGGGCAGGAAGG - Exonic
1014178760 6:118360291-118360313 TTGAGTAGAAATGGTGAGAAGGG - Intergenic
1015614580 6:135061939-135061961 TTGCTTAGGGATGGGGAGGTTGG + Intronic
1015696389 6:135984890-135984912 TTGAGTAGAGCTGGGCAGGTGGG - Intronic
1016617681 6:146071676-146071698 CTTATTAGGGATGGGAAGGAAGG + Intronic
1017245182 6:152216881-152216903 TTTAGTAGAGATGGAGAGGGGGG - Intronic
1017540235 6:155394229-155394251 GGGAGTGGGGAGGGGGAGGAAGG - Intergenic
1017614975 6:156236788-156236810 TTGAATAGGGGTGGTGAGAAAGG + Intergenic
1018545198 6:164928233-164928255 TTGAGATGGGAAGGAGAGGAGGG - Intergenic
1018582011 6:165315768-165315790 TTGGCTAGGGATGGGGGAGATGG + Intergenic
1019750133 7:2724084-2724106 TTTAGTAGAGATGGGGAGTGGGG + Intronic
1020080156 7:5282609-5282631 AAGAGGAGGAATGGGGAGGAGGG + Intronic
1020080201 7:5282750-5282772 GAGAGGAGGAATGGGGAGGAGGG + Intronic
1020849899 7:13339741-13339763 TGGAGTAGGGATTGGGAAGGAGG + Intergenic
1021514252 7:21465589-21465611 TGGATTGGGGATGGGAAGGATGG + Intronic
1021710228 7:23408965-23408987 GAGAGTGGGGATGGGGGGGATGG + Intronic
1022227968 7:28382945-28382967 TTGAGTAGGAATAGGGAACAAGG + Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022637379 7:32149870-32149892 TGGAGTGGGGGTGGGCAGGAAGG - Intronic
1023222702 7:37935773-37935795 TTGGGTAGGGGTGGGGAGGTGGG + Intronic
1023516167 7:41004027-41004049 ATGCCTAGGGATGGGGAGGGTGG - Intergenic
1023621589 7:42078583-42078605 TTGAGTAGGGAGGGAGTGGGGGG + Intronic
1023928366 7:44687924-44687946 TTGCTTAGGGCTTGGGAGGATGG - Intronic
1024027889 7:45429632-45429654 TTGTGTGGGGATAGGGAGTATGG + Intergenic
1024051066 7:45623796-45623818 TCGAAGAGGGAAGGGGAGGAGGG + Intronic
1024257575 7:47550020-47550042 CTGAGTGGGGATGGGTGGGAGGG - Intronic
1024509754 7:50194400-50194422 CTGAGTAGGCATTGGAAGGATGG - Intergenic
1025198757 7:56949598-56949620 AAGAGGAGGAATGGGGAGGAGGG - Intergenic
1025673189 7:63627335-63627357 AAGAGGAGGAATGGGGAGGAGGG + Intergenic
1026338127 7:69412214-69412236 TTTTGTAGAGATAGGGAGGAGGG - Intergenic
1026592193 7:71706591-71706613 TTGTTTAGGGACGGGGAGGGAGG + Intronic
1026812074 7:73476139-73476161 TTGCTCAGGGCTGGGGAGGATGG + Intronic
1027234117 7:76287576-76287598 GTGGGTAGGGATGGGGTAGAGGG + Intergenic
1027613559 7:80392818-80392840 TGGGGTGGGGATGAGGAGGATGG + Intronic
1027717931 7:81697280-81697302 TTGGATAGGGATGTTGAGGATGG + Intergenic
1027969955 7:85066504-85066526 TTGGGAAGGGGTGGGGCGGAGGG + Intronic
1028684281 7:93575079-93575101 TTGAGTAGGGAGGGAGAGGGGGG + Intergenic
1028723659 7:94062149-94062171 GTGAGTGGGGATGGTGAGGAGGG + Intergenic
1028733997 7:94186085-94186107 TTGAATAGGAATGGTGAGGGAGG + Intergenic
1028743528 7:94302946-94302968 ATGAGTAGGGTGGGGGAGTAGGG - Intergenic
1028809568 7:95068776-95068798 TTGAGTGGAGATGGTGAAGAGGG + Intronic
1029181293 7:98703912-98703934 TTGAGTTCCGATGGGGAGCAGGG - Intergenic
1029804944 7:102986287-102986309 GTGTGTGGGGATGGGGAGGTTGG + Intronic
1029813697 7:103073907-103073929 TTGAGTGGGGATGGGGATGTTGG - Intronic
1030125151 7:106146241-106146263 TTGAGAAGGGATAGGCAGGAGGG - Intergenic
1030638259 7:111974576-111974598 AGGAAAAGGGATGGGGAGGAGGG + Intronic
1030686992 7:112497133-112497155 GACAGTAGGGATAGGGAGGAAGG - Intergenic
1031046087 7:116889547-116889569 TTTGGTAGAGATGGGGAGGGGGG - Intronic
1031247688 7:119337675-119337697 GTGAGGAGGGAGAGGGAGGAGGG - Intergenic
1032378173 7:131445509-131445531 TTGTGTAGGAATGGAGAAGAAGG - Intronic
1032480591 7:132243662-132243684 TGGGGTGGGGGTGGGGAGGAGGG - Intronic
1032537644 7:132678103-132678125 ATGAGTGGGGAGGTGGAGGAAGG - Intronic
1032594312 7:133224414-133224436 TGGAGTAGGGGTGGGGTGTAGGG - Intergenic
1033487107 7:141801725-141801747 AGGAGTAGGAAAGGGGAGGAGGG + Intergenic
1033986089 7:147227272-147227294 TTGAATAGGGCTGGTGTGGAGGG + Intronic
1034492517 7:151401407-151401429 ATGAGGAGGGAAGGAGAGGAGGG - Intronic
1034528137 7:151679030-151679052 TTGAGGTGGGGTGGGGAGGAAGG + Intronic
1034970759 7:155417904-155417926 GGGAGCAGGGCTGGGGAGGACGG - Intergenic
1036085004 8:5604054-5604076 TTGCAGAGGGATGGGGAGGGCGG - Intergenic
1036754871 8:11465432-11465454 TTGAAGACTGATGGGGAGGATGG + Intronic
1037563294 8:20094377-20094399 GTGAGTTGGGATGGGCAGGTGGG + Intergenic
1037635804 8:20700338-20700360 ATGAGTAGAGATGGGGAGAGTGG + Intergenic
1037708140 8:21333086-21333108 TTGAGTAGGGGTGGGGATGGTGG - Intergenic
1038366109 8:26936975-26936997 TTGAATAGGGGTGGTGAGGGAGG + Intergenic
1038484249 8:27922270-27922292 TTGAGCACCGCTGGGGAGGAAGG + Intronic
1041886925 8:62820473-62820495 TAGAGTAGGCTTGGGGAGGGAGG + Intronic
1041981602 8:63867858-63867880 GTGGGTAGGGATTGGGAGGAAGG - Intergenic
1042902818 8:73746301-73746323 TAGAGTAGGGCAGGGGAGGGCGG - Intronic
1044152206 8:88795298-88795320 GGGATTAGGGATGGTGAGGATGG + Intergenic
1044328423 8:90888050-90888072 TCTGGTTGGGATGGGGAGGAAGG - Intronic
1044745277 8:95365032-95365054 TTGAGCAGGGAGGAGGAGGCAGG + Intergenic
1044983240 8:97736369-97736391 AGGAGAAGGGAGGGGGAGGAGGG + Intergenic
1045253846 8:100502983-100503005 TGTGGTGGGGATGGGGAGGATGG + Intergenic
1045631864 8:104133763-104133785 TAGATTAGGTATGGGGATGAAGG + Intronic
1045648146 8:104319205-104319227 TTGAGTAGAGATCGTGAAGAAGG - Intergenic
1046714658 8:117554391-117554413 TTGGGAAGGGATGGGCAGAATGG - Intergenic
1046775439 8:118159061-118159083 TGGAGTGGGGATGGGGAAAAGGG - Intergenic
1047137463 8:122096546-122096568 CTCAGTTGGGATGGGGAGGCTGG - Intergenic
1047348803 8:124053954-124053976 ATGAGTCAGGATAGGGAGGACGG - Intronic
1047455345 8:125003872-125003894 TTGTGTGGGGATGGGGTGGTGGG + Intronic
1047953604 8:129956249-129956271 TTGAGAAGGGGTGGGGATAATGG - Intronic
1048010152 8:130448857-130448879 TTGAGTGGGGGTGGGCAGGAGGG + Intergenic
1048073014 8:131040898-131040920 TTGCGCCGGGATGGGGAGCAGGG + Exonic
1048210272 8:132449246-132449268 TGGAGAAGGGATGCGGAGGCAGG - Intronic
1048282375 8:133114797-133114819 TTGGGAAGGGATGGGCTGGAAGG + Intronic
1048722609 8:137343997-137344019 TTGCCTAGGGATGGGAGGGAAGG - Intergenic
1048889345 8:138933938-138933960 AAAAGCAGGGATGGGGAGGAGGG - Intergenic
1048889632 8:138936053-138936075 CTGAGGAAGGATGTGGAGGAGGG + Intergenic
1049415322 8:142492347-142492369 GTGAGGAGGGATGGGGAACAGGG + Intronic
1049457972 8:142703682-142703704 TTCAGTATTGATGGGGAGGGAGG + Exonic
1049532366 8:143160740-143160762 TTGGGGAGGGGCGGGGAGGAGGG - Intergenic
1050226429 9:3462496-3462518 TTGAGTAAAAATGGGGAGGGAGG - Intronic
1050552375 9:6758860-6758882 TGGAGTGGGGACGTGGAGGAGGG + Intronic
1051336903 9:16073876-16073898 TAGAGAAGGGATTGGGAAGAGGG + Intergenic
1051408516 9:16764911-16764933 GGGAGGAGGGATGGGGAAGAAGG + Intronic
1051871765 9:21746134-21746156 TAGATTAGTGCTGGGGAGGATGG - Intergenic
1052208550 9:25872627-25872649 GGCAGTGGGGATGGGGAGGAAGG - Intergenic
1052870141 9:33497746-33497768 TTTAGTAGAGATGGGCAGGCTGG - Intergenic
1053221873 9:36319232-36319254 TGGACTGGGGATGGAGAGGAGGG + Intergenic
1053266653 9:36720046-36720068 GTGATTACGGATGGGGAGGTGGG + Intergenic
1053792456 9:41696633-41696655 TTGAGCAGGGGTGGGGAGGTGGG - Intergenic
1054152716 9:61618187-61618209 TTGAGCAGGGGTGGGGAGGTGGG + Intergenic
1054180866 9:61908653-61908675 TTGAGCAGGGGTGGGGAGGTGGG - Intergenic
1054472495 9:65549335-65549357 TTGAGCAGGGGTGGGGAGGTGGG + Intergenic
1054656725 9:67672489-67672511 TTGAGCAGGGGTGGGGAGGTGGG + Intergenic
1055048666 9:71957725-71957747 TTTATGAGGAATGGGGAGGAAGG - Intronic
1055773951 9:79747811-79747833 TATCCTAGGGATGGGGAGGAAGG - Intergenic
1056164496 9:83928136-83928158 TTGAGAAGGAATGAGGAAGATGG + Intergenic
1056578434 9:87872875-87872897 ATGAGAAGGGATGGGCACGAGGG + Intergenic
1056788126 9:89606881-89606903 TGTAGGAGGGAGGGGGAGGAGGG - Intergenic
1057695809 9:97322261-97322283 TTGTCCAGGGCTGGGGAGGAGGG - Intronic
1057718834 9:97516584-97516606 TTGAGTGAGGATAGGAAGGAGGG + Intronic
1057862331 9:98650980-98651002 TTGAGTAGTGATGGTGATGGTGG + Intronic
1058038913 9:100283135-100283157 TTTTGTAGAGATGGGGAGGGGGG - Intronic
1058188200 9:101880752-101880774 TGGAGGAGTGATGGGGAGGTAGG + Intergenic
1058305129 9:103431372-103431394 GGGAGTAGAGATGGAGAGGATGG - Intergenic
1058322234 9:103647460-103647482 CTGAGTATGGAAGGGGAGAATGG + Intergenic
1058621625 9:106889227-106889249 TTTAAAAGGGGTGGGGAGGAAGG - Intronic
1058865212 9:109155765-109155787 TCGAGCTGGGGTGGGGAGGAGGG + Intronic
1058991531 9:110258301-110258323 TAGAGTAGGGATGAGGACAACGG - Intergenic
1059316008 9:113426383-113426405 TTGAGTGGAGAATGGGAGGAGGG + Intronic
1059717983 9:116931307-116931329 GTGGGTGGGGATGGGGAGGTTGG + Intronic
1060404089 9:123364552-123364574 GGGAGTGGGGATGGGGAGGGAGG + Intronic
1060449577 9:123724070-123724092 TTGAGAAGGGAAGGGAAGAAGGG - Intronic
1061058802 9:128240024-128240046 TTGTGTAGTGAGGGGGCGGAGGG + Intronic
1061084389 9:128390647-128390669 TCCAGAAGGGAAGGGGAGGAGGG - Exonic
1061086648 9:128403334-128403356 TTGCCTAGGGCTGGGGAGAAGGG + Intergenic
1061164550 9:128914721-128914743 TTCAGATGGGATGGGCAGGAGGG - Intronic
1061483359 9:130908219-130908241 TTGAGAGGGGATGGGGAGGGTGG + Intronic
1061661166 9:132131288-132131310 AGGAGAAGGGATGGGGAGCAGGG + Intergenic
1061920176 9:133778362-133778384 TGAGGTAGGGGTGGGGAGGAGGG + Intronic
1061931245 9:133834234-133834256 GGGAGGAGGGATGGAGAGGAGGG - Intronic
1061954953 9:133956536-133956558 TTGGGTTGGGTTAGGGAGGAGGG + Intronic
1062259649 9:135655101-135655123 TTGGGTAGGGAAGGGGTGGGGGG + Intergenic
1062328266 9:136023104-136023126 GGGAGGAGGGAGGGGGAGGAGGG + Intronic
1062411520 9:136427785-136427807 TTTAGTAGAGATGGGGGGGGGGG + Intergenic
1062612219 9:137380392-137380414 TGGAGGGGGGTTGGGGAGGAGGG - Intronic
1185647957 X:1628518-1628540 TGGAGTAGGGAAGGGTATGAAGG + Intronic
1186082877 X:5952394-5952416 TTGAGTAGGTGTGAGAAGGATGG + Intronic
1186742356 X:12531835-12531857 TTCATTAGGGATCTGGAGGAGGG - Intronic
1186779639 X:12899810-12899832 GTGAAGAGGGAAGGGGAGGAAGG + Intergenic
1187815146 X:23223603-23223625 GTTAGCAGGGATGGGGAGAATGG - Intergenic
1187995765 X:24924790-24924812 TTGGGTAAGGGTGTGGAGGAAGG + Intronic
1188518605 X:31013468-31013490 TAGAGTAAGGATGGGGTGGGAGG - Intergenic
1188857297 X:35211894-35211916 TGGGGTGGGGATGGGGGGGATGG - Intergenic
1188957765 X:36454072-36454094 TTGTGTAGGGATGGGGAGCTGGG - Intergenic
1189188917 X:39079122-39079144 TTGAATAGGAATGGTGAGAAAGG + Intergenic
1189824092 X:44899184-44899206 CTGTGGAGGGAGGGGGAGGAAGG + Intronic
1189936282 X:46072380-46072402 TAGAGTGGGGGTGGGGAGCAAGG - Intergenic
1190739859 X:53281586-53281608 TAGGGAAGGGCTGGGGAGGAGGG - Intronic
1191842842 X:65525183-65525205 GTGGGTAGGAGTGGGGAGGAAGG + Intronic
1191869730 X:65735878-65735900 TAGAAGAGGGATGGGGAGAAGGG + Intronic
1192433139 X:71125965-71125987 TTGACTAGGGGTGGGGAGTGGGG - Intronic
1192478200 X:71461859-71461881 TTGGGTAGAGGTGGGGAGGGAGG + Intronic
1192478343 X:71463445-71463467 CAGAGTAGGGATGGAAAGGAGGG + Intronic
1192478654 X:71466076-71466098 TGGCATTGGGATGGGGAGGAGGG + Intronic
1192488359 X:71550901-71550923 TGGAGGAGGGATGGGGAAAAGGG + Intronic
1193170637 X:78331880-78331902 ATGAGTATGGATGGGGAAGTGGG + Intergenic
1193510386 X:82392198-82392220 TTGAATAGGGATGGTGAGAGAGG - Intergenic
1193963693 X:87956759-87956781 TTGAATAGGGATGGTGAGTGTGG - Intergenic
1194163182 X:90481066-90481088 TTGCTTAGGACTGGGGAGGATGG + Intergenic
1194636192 X:96347403-96347425 TTGAATAGGAATGGGGAGAGAGG + Intergenic
1194693072 X:97010341-97010363 TGGGATAGGGATGGGGGGGATGG + Intronic
1195309827 X:103621390-103621412 TTGGCTAGGGTTGGGGAGGATGG + Intronic
1196739017 X:119007727-119007749 ATGCGTTGGGATTGGGAGGAGGG + Intronic
1197523050 X:127523598-127523620 TTGAATAGGAATGGTGAGGGAGG - Intergenic
1197759588 X:130018296-130018318 TTGCCTAGGGTTGGGGAGGATGG + Intronic
1198118213 X:133565236-133565258 TTGAGGAGGGATGGGGCAGTGGG - Intronic
1198241898 X:134796085-134796107 GTGAGCAGGGTTGGGGAGGATGG - Intronic
1198577902 X:138030588-138030610 TTGAATAGGGGTGGTGAGAATGG - Intergenic
1198933182 X:141880924-141880946 GTGAGCAGGGATGTGGATGATGG - Intronic
1198935156 X:141896597-141896619 GTGAGCAGGGATGGGGATGATGG - Intronic
1198962301 X:142195522-142195544 TTGAGCAGGGATGGGGAGGATGG + Intergenic
1199388204 X:147247971-147247993 TTGAGTGGGGATGGGTGGGAAGG - Intergenic
1199456367 X:148033828-148033850 TTAAGTAGAGAGGAGGAGGATGG + Intergenic
1199579025 X:149343088-149343110 TTTAGTTTGGATGGGGAGCAGGG - Intergenic
1200154956 X:153970423-153970445 GTGGGGAGGGAGGGGGAGGAGGG + Intronic
1200509456 Y:4058791-4058813 TTGCTTAGGACTGGGGAGGATGG + Intergenic
1200601399 Y:5209880-5209902 TTTAGTAGAGATGGGGTGGTTGG - Intronic
1201417595 Y:13762838-13762860 ATGACTAGGGGTGGGAAGGATGG - Intergenic