ID: 1162929881

View in Genome Browser
Species Human (GRCh38)
Location 19:13952561-13952583
Sequence GGCGGCGGCCCCGGGGGAGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1168
Summary {0: 1, 1: 1, 2: 12, 3: 150, 4: 1004}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162929866_1162929881 19 Left 1162929866 19:13952519-13952541 CCCAGCTCGAAATCGGAGCGGAA 0: 1
1: 0
2: 0
3: 0
4: 12
Right 1162929881 19:13952561-13952583 GGCGGCGGCCCCGGGGGAGCCGG 0: 1
1: 1
2: 12
3: 150
4: 1004
1162929867_1162929881 18 Left 1162929867 19:13952520-13952542 CCAGCTCGAAATCGGAGCGGAAC 0: 1
1: 0
2: 0
3: 1
4: 11
Right 1162929881 19:13952561-13952583 GGCGGCGGCCCCGGGGGAGCCGG 0: 1
1: 1
2: 12
3: 150
4: 1004

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162929881 Original CRISPR GGCGGCGGCCCCGGGGGAGC CGG Exonic
900226125 1:1534396-1534418 GGCTGAGCCCCCGGGGCAGCAGG + Exonic
900283912 1:1890496-1890518 GGCCGGGGCCCCGGGGGCGCGGG - Intronic
900511714 1:3063924-3063946 ACCGGCGGCCCCGGGGTTGCGGG + Intergenic
900652099 1:3734770-3734792 GTCAGCGGCCCCCGGGGAGGTGG - Exonic
900671342 1:3856919-3856941 TGCCGCGGCCCCGGTGGAGAGGG + Exonic
901004000 1:6162941-6162963 AGTGGCGGCCCAGGGAGAGCCGG + Intronic
901066605 1:6497360-6497382 GGCGGGGGCGCCGGGGACGCCGG + Intronic
901086689 1:6615069-6615091 GGCGGCTGCCGCGGGAGGGCGGG + Intronic
901320648 1:8338137-8338159 GGCGCTGGGCCTGGGGGAGCTGG + Intronic
901443495 1:9293195-9293217 GGGGCCGGGCGCGGGGGAGCGGG + Intronic
901443644 1:9293615-9293637 CGCGGCGGCTCCGGGGCGGCGGG - Intronic
901489329 1:9588809-9588831 GGCGGTGACGCCGGGGGCGCGGG - Intergenic
901629029 1:10639254-10639276 GGCGGCGGCGTCGGGCGGGCCGG + Exonic
901660747 1:10796439-10796461 AGCGGCAGCCCCGGGGGTGGGGG + Intronic
901742654 1:11352371-11352393 GGCTGCGGCTCAGGGGGAGCTGG - Intergenic
901811076 1:11766995-11767017 GGAGGGGGCCCCGAGGGAGCGGG + Exonic
902229950 1:15021564-15021586 GGCGGAGGGCCCCGGGAAGCAGG - Intronic
902385564 1:16073618-16073640 GGCGGCGGCGCGAGGCGAGCCGG - Exonic
902400833 1:16155857-16155879 GGCCGCGGCCGCGGCGGCGCAGG - Exonic
902671827 1:17979976-17979998 GGCGGGGCCCCAGAGGGAGCTGG + Intergenic
902804174 1:18850572-18850594 GGCGGAGGCCCCTGGGAATCAGG + Intronic
902823235 1:18956226-18956248 GGCGGCGGCGGCGGCGGGGCAGG - Exonic
902920625 1:19664647-19664669 GGCGGCGGCGCAGGCGGAACTGG - Intergenic
903115633 1:21176588-21176610 GGCGGCGGCGGCGGCGGAGGCGG - Intronic
903233996 1:21937642-21937664 GGCGGCGCGCGCGGGGAAGCGGG - Intergenic
903263427 1:22143137-22143159 GGCGGCGGCGGCGGCGGAGGCGG + Intronic
903573416 1:24322584-24322606 GGCGGCGGCCCGGGCGGCGCGGG + Intronic
903822116 1:26111182-26111204 GGCGGCGGCGGCGGCGGCGCGGG - Intronic
903828651 1:26161970-26161992 GGCGGCGGCTCGGAGGCAGCGGG + Exonic
903855744 1:26336795-26336817 CGGGGCGGGCCCGGGCGAGCCGG - Intronic
903907452 1:26696647-26696669 GGTGGCGGCGGCGGCGGAGCCGG + Exonic
904014572 1:27409820-27409842 GGAGGGGGCCCCGGAGGAGGAGG + Exonic
904215400 1:28914781-28914803 GGCGGCGGCGGCGCGGGAGCCGG + Intronic
904620608 1:31772905-31772927 GGCGGCGGGCCCGGGGTCCCTGG - Intergenic
904701697 1:32361906-32361928 GGCGGCGGCGCCCGGCGACCCGG - Intronic
904753948 1:32757891-32757913 GGCCCCGGCCCCGGGGGATTTGG + Intronic
905183147 1:36178715-36178737 GGCCGAGGCCCGGGCGGAGCGGG + Exonic
905734346 1:40315615-40315637 CCCGGCGGTCCCGGGGGACCCGG + Exonic
906281773 1:44559529-44559551 GGCGGCGGCACCGCAGGATCAGG + Intronic
906460371 1:46031584-46031606 GGGTGAGGCCCCTGGGGAGCTGG + Exonic
906480938 1:46198447-46198469 GGCGGCGGAAGCGGGGGGGCGGG - Intronic
906637017 1:47416503-47416525 GGCGGCGGCCCCTGCAGCGCGGG + Exonic
906653817 1:47533585-47533607 GGGGGCGGCGCCGGAGGATCGGG + Intergenic
907038353 1:51236434-51236456 GGCGGCGGCCACGGAGCTGCTGG - Exonic
907108936 1:51908996-51909018 GGCTGGGGCCCAGGAGGAGCAGG - Exonic
907278084 1:53327941-53327963 GGCGGCGGCGCGGGGAGCGCGGG - Exonic
908131745 1:61081990-61082012 CGCGGTGGCCCGGGGGGTGCGGG + Exonic
908473854 1:64470288-64470310 GACGGCGGCCCCCGGGGAAGAGG - Intergenic
908501206 1:64745194-64745216 GGCGGCGGCGAGGGGGGCGCGGG + Exonic
908534649 1:65066751-65066773 GGCGGCGGTGCCGGAGGAGGAGG - Intergenic
908534754 1:65067144-65067166 GGCGGCGGCGCGGGGCGGGCCGG - Intergenic
908780632 1:67686270-67686292 GGCGGCGACCCCCAGGGACCCGG + Intronic
910277558 1:85465064-85465086 GGCGGCGGCGGCGGCGGAGGCGG + Exonic
910448992 1:87328526-87328548 GGCGGCGGCGGCGGCGGCGCTGG - Exonic
911664730 1:100539679-100539701 GGCGGCGGCGGCGGCGCAGCCGG - Exonic
912391736 1:109307502-109307524 GCCCGCTGCCCCCGGGGAGCGGG - Intergenic
912401469 1:109397456-109397478 GGCTGCGGCCCGGGGGACGCGGG + Intronic
912576365 1:110675326-110675348 CGCCGCGGCCCCGCGGGCGCCGG + Intergenic
912682666 1:111739101-111739123 CGCCCCGGCCCCCGGGGAGCCGG - Intronic
912915680 1:113812208-113812230 GGTGGCGGCGCAGGAGGAGCCGG - Exonic
913565557 1:120069418-120069440 GGCGGCGGCGGCGGAGGAGGAGG - Exonic
913565558 1:120069421-120069443 GGCGGCGGCGGCGGCGGAGGAGG - Exonic
913632573 1:120724135-120724157 GGCGGCGGCGGCGGCGGAGGAGG + Intergenic
913632574 1:120724138-120724160 GGCGGCGGCGGCGGAGGAGGAGG + Intergenic
913671117 1:121097876-121097898 GGCGGCGGCAGGGAGGGAGCGGG + Intergenic
914022884 1:143885297-143885319 GGCGGCGGCAGGGAGGGAGCGGG + Intergenic
914197334 1:145454425-145454447 GGCGGCGGGGCCGGCGGGGCGGG - Intergenic
914619323 1:149390815-149390837 GGCGGCGGCGGCGGCGGAGGAGG + Intergenic
914619324 1:149390818-149390840 GGCGGCGGCGGCGGAGGAGGCGG + Intergenic
914661371 1:149793241-149793263 GGCGGCGGCAGGGAGGGAGCGGG + Intronic
914889759 1:151612259-151612281 GGCGGCGGCGGCGGGGGGTCTGG + Exonic
914940679 1:152020341-152020363 TGAGGCGGCCCCGTGGGGGCAGG + Intergenic
915213328 1:154325565-154325587 GGCCGAGGCCCCGGGGGAGCGGG + Intronic
915322423 1:155063101-155063123 GGCGGCGGCGGAGGGGGAGGAGG - Intergenic
915325326 1:155078926-155078948 GGCGGCGGCTCCGGGGATGGCGG + Exonic
915552248 1:156642039-156642061 GGGGGCGGCCCCGGGGAGGGCGG + Exonic
915835416 1:159171866-159171888 GGGGGCGGCGCCTGGGGAGGTGG + Intronic
915980379 1:160416454-160416476 GGCGGCAGCTCCAGAGGAGCTGG - Intronic
916074241 1:161191144-161191166 GGCGGCGCCCCTGGGCGGGCAGG - Exonic
916694398 1:167221321-167221343 GGCGGCGGGGCCGGGGCAGAGGG + Intronic
916890257 1:169106614-169106636 GGCGGCGGCGGCGGCGGGGCGGG - Exonic
917789104 1:178488164-178488186 GGCTGAGGCCCTGGGGGAGGTGG - Intergenic
917966678 1:180183230-180183252 GAGGGCTGCCCCGGGGGAGCTGG - Intronic
919809397 1:201399330-201399352 GGCGGCGGCCGGCGGGGCGCGGG - Exonic
919916858 1:202144356-202144378 GGCGGCGACCCCGGCTCAGCAGG + Intronic
919916965 1:202144761-202144783 GGCGGCGGCGGCGGAGGAGGAGG - Intergenic
919916966 1:202144764-202144786 GGCGGCGGCGGCGGCGGAGGAGG - Intergenic
920109258 1:203575504-203575526 GGCGGGGGTTCGGGGGGAGCAGG + Intergenic
920309964 1:205043233-205043255 GGCGGCGGCCGCGGCGGCGGTGG - Exonic
920394208 1:205631944-205631966 GGCGGCGGCCGCGGAGGGCCTGG - Exonic
921023764 1:211259432-211259454 GGCGGCGGCGGCGGAGGAGGAGG - Exonic
921029791 1:211327045-211327067 GGCGGCTGGGCCGGGGGAGGCGG + Intronic
921039537 1:211416667-211416689 AGCGGCGGCGCCGGGGGCCCCGG + Intergenic
921944975 1:220880028-220880050 GGGGGCGGCCCCGGAGGGCCTGG + Exonic
922314847 1:224434047-224434069 GGCGGCGGCGGCGGTGGAGGAGG - Exonic
922427704 1:225514801-225514823 GGAGGGGGCCCTGGGGGAGGAGG + Exonic
923191752 1:231626825-231626847 GGAGGCAGCCCAGGCGGAGCGGG + Exonic
924436559 1:244048611-244048633 GGGGGCGGGCGCGGGGGAGGGGG - Intergenic
924561045 1:245156463-245156485 GGAGGCGGGTCCCGGGGAGCCGG - Exonic
1062774717 10:135528-135550 GGCGGCGGCGGTGGAGGAGCCGG + Intronic
1062953578 10:1524694-1524716 GGTGGCTGCCCGGGGGGAGGTGG + Intronic
1064209083 10:13348120-13348142 GGCGGCGGCGGCGGGGGCCCGGG + Exonic
1064230747 10:13528345-13528367 GGCGGAGGCACCGGGGGACCGGG + Intronic
1064354507 10:14604636-14604658 CGCGGCGGCCCCGGATGACCGGG + Intronic
1065099760 10:22321381-22321403 GGCGGCGGCCGAGGAGGAGGAGG + Exonic
1065099767 10:22321402-22321424 GGAGGAGGCCCCGGAGGAGGAGG + Exonic
1065099955 10:22322059-22322081 GGAGGGGCGCCCGGGGGAGCGGG - Intronic
1065100358 10:22325554-22325576 TGCGGCGACGCCGGGGGGGCGGG - Intronic
1065589778 10:27252566-27252588 GGCGGCGGCGGCGGGGGCGGCGG - Intergenic
1066464213 10:35639472-35639494 GGCGGCGGCGGCGGGGGACCCGG - Exonic
1066464220 10:35639487-35639509 GGCGGCGGGCCGGGGGGCGGCGG - Exonic
1067060799 10:43077032-43077054 GCCGGCTGCGCCGGAGGAGCGGG - Exonic
1067091314 10:43266956-43266978 GGGGGCGGCCGCGGGTGGGCGGG - Intergenic
1067561693 10:47309005-47309027 GCCGGCAGCCCCAGGGAAGCCGG + Intronic
1067769840 10:49115364-49115386 GGCGGCCGCGCCGGGGAGGCCGG - Intronic
1068690158 10:59906303-59906325 GGCGGTGGCGGCGGGGGAGGCGG - Exonic
1069615085 10:69801807-69801829 GCCGTCGGCCCCGCGGGAGGTGG + Intergenic
1070032617 10:72692200-72692222 GGCGGCGGCGGCGGGGGCGCCGG + Exonic
1070257604 10:74825429-74825451 GCGGGCGGCGCGGGGGGAGCGGG + Intergenic
1070328206 10:75401349-75401371 GGCGGCGGCGGCGGCGGAGGCGG - Exonic
1070398907 10:76035825-76035847 GGCGGGGGCGGCGGGGGAGAAGG - Intronic
1070610157 10:77927069-77927091 GGCTGTGGCCACGGGGGAGCGGG - Intergenic
1070768628 10:79070077-79070099 GGCGGTGGCCCCGGGGGAGTGGG + Intronic
1070895748 10:79982039-79982061 GGCGGCGGCCCTGGACGTGCGGG + Intronic
1071086971 10:81875756-81875778 GGCGGCACCCCCGGCGGAGGGGG - Exonic
1071546762 10:86535554-86535576 GGCTGCGGCCCAGCGGGACCTGG + Intergenic
1071847601 10:89535944-89535966 GGCAGAGTCCCCGGCGGAGCTGG - Intronic
1072562228 10:96586887-96586909 GGCGGCGGCGGCGGAGGAGGCGG - Exonic
1072591628 10:96832733-96832755 GGCGGCGGCGCCGGGGCGCCGGG - Intronic
1073051648 10:100671077-100671099 GGGGGAGGCGGCGGGGGAGCGGG + Intergenic
1073069219 10:100782762-100782784 GGCGGCGGCCCCTGATGGGCAGG + Intronic
1073196266 10:101694613-101694635 GGCGGCGGCCGGGGAGGAGGAGG - Exonic
1073196267 10:101694616-101694638 GGCGGCGGCGGCCGGGGAGGAGG - Exonic
1074773493 10:116748908-116748930 GGTGGCAGCCCTGTGGGAGCTGG + Intergenic
1074829988 10:117241325-117241347 TGCGGGGACCCCGGGGCAGCCGG + Intronic
1074861060 10:117510940-117510962 TGCGACAGCCCCGTGGGAGCAGG - Intergenic
1074865748 10:117543517-117543539 GGCGGCGGCACCGGGTGCACTGG - Exonic
1075207022 10:120457003-120457025 GGAGGCGGCTCCTGGGGAGAGGG + Exonic
1075430326 10:122374874-122374896 GGCGGCGGCTGCGGGGCTGCCGG + Intronic
1075629320 10:123991693-123991715 GGCGGCGGCGGCGGAGGAGGCGG + Intergenic
1075871313 10:125774115-125774137 GGGGGCGGGCCCGGGGGCGAAGG + Exonic
1076638917 10:131901028-131901050 GGCGGCGGCGGCGGCGGCGCCGG + Exonic
1076638920 10:131901037-131901059 GGCGGCGGCGCCGGCGGTGGTGG + Exonic
1076706902 10:132307351-132307373 GGCGGCGCCGCAGGAGGAGCAGG - Intronic
1076717741 10:132374925-132374947 TGCAGGGGCCCCGGGGCAGCGGG + Intronic
1076722095 10:132397180-132397202 GGCGGCGGCGGCGGCGGGGCGGG + Exonic
1076947995 10:133665010-133665032 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
1076948985 10:133668320-133668342 AACGGAGGCCCCGGGGGAGCTGG + Intronic
1076949969 10:133671619-133671641 AACGGAGGCCCCGGGGGAGCTGG + Exonic
1076950953 10:133674918-133674940 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
1076951943 10:133678228-133678250 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
1076952932 10:133681538-133681560 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
1076953916 10:133684837-133684859 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
1076954900 10:133741189-133741211 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
1076955889 10:133744499-133744521 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
1076956879 10:133747809-133747831 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
1076957866 10:133751118-133751140 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
1076958851 10:133754417-133754439 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
1076959840 10:133757727-133757749 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
1076960824 10:133761026-133761048 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
1077008522 11:369989-370011 GGGGGCGGCGCGGGGGGCGCGGG + Intronic
1077080037 11:721104-721126 GGCGCCGGGCCCTGGGGAGGAGG - Exonic
1077201362 11:1309200-1309222 GGAGGCAGCCCCGGGGGAGGGGG - Intronic
1077204851 11:1337232-1337254 GGCCGCGGCTCCGGGGGATCGGG - Intergenic
1077297335 11:1832344-1832366 AGCGGTGGCCAGGGGGGAGCCGG + Intronic
1077495304 11:2884329-2884351 GGCGGCGGCCCCGGGGGGCTTGG - Intronic
1078631893 11:13010521-13010543 GGCGGCGGCGCTGGAGGAGCTGG + Intergenic
1079122460 11:17695746-17695768 GGCCGCGGCCGTGGGGGTGCTGG + Intergenic
1079126237 11:17720328-17720350 CGCCGCGGCCCGGGGGCAGCGGG - Exonic
1080458439 11:32434939-32434961 GGCGGCGGCGGCGGGGGTGGCGG + Exonic
1081720504 11:45285480-45285502 GGCCGCGGTCCCGCAGGAGCTGG - Intronic
1081793335 11:45804259-45804281 GGCATGGGCCCCGGGGGTGCCGG - Intronic
1082023352 11:47553031-47553053 GGCGGCGGCTGCGGAGGCGCAGG - Intronic
1082025160 11:47566020-47566042 GGCGGTGGGCGAGGGGGAGCGGG - Intronic
1083033509 11:59615546-59615568 GGCGGCGGCCGCGGAGATGCGGG - Exonic
1083315927 11:61815163-61815185 GGCGGGGGCCGGGGCGGAGCCGG + Intronic
1083540477 11:63508652-63508674 GGAGGTGGCCCAGGGGGTGCTGG + Intronic
1083728867 11:64642712-64642734 GGCGGCGGCGGCGGTGGAGGCGG + Intronic
1083753719 11:64778139-64778161 GGCGGCGGCTGCTGGGGAGGCGG + Exonic
1083940126 11:65891234-65891256 CGCGGCGGCCCCAGCGGCGCCGG + Exonic
1083970344 11:66070508-66070530 GGCGGTGGTCCCGGAGGCGCCGG + Exonic
1084086356 11:66857075-66857097 GGCGGCGGCGACAGGCGAGCGGG - Intronic
1084500004 11:69529807-69529829 GGAGGAGGCCTCGGGGGAGGGGG + Intergenic
1087014621 11:93543235-93543257 GGCGGCGGCGGCGGCGGGGCGGG - Intronic
1088314973 11:108498288-108498310 CGCGGGGGCCCCGGAGGTGCTGG - Exonic
1089543719 11:119206457-119206479 GGCAGCGGCTCCGGGGGCTCGGG + Exonic
1089800572 11:121024016-121024038 GGAGGGGGCGCCGGAGGAGCGGG - Intergenic
1089993430 11:122882902-122882924 GGCGGCGGCGGCGGCGGCGCGGG + Exonic
1090186979 11:124745558-124745580 GGCGGCGGCCGCGTTGGCGCCGG - Exonic
1090403772 11:126465405-126465427 TGCTGCAGCCCCGGGGGTGCTGG + Intronic
1090817792 11:130314454-130314476 GGCGGCGGCCCGGGGGGAGGGGG + Exonic
1090832412 11:130428475-130428497 GGCGGCGGCGCGGGAGGAGCGGG - Exonic
1091219109 11:133920065-133920087 GGCGGCGAGCTCAGGGGAGCCGG + Exonic
1091349521 11:134881796-134881818 CGCGGGGGACCCGGGGAAGCTGG - Intergenic
1091558784 12:1594749-1594771 GGCGCAGACCCCGGGCGAGCAGG + Intronic
1091689027 12:2583265-2583287 CGCCGCGGCCCCAGGGCAGCCGG - Intronic
1091759460 12:3077391-3077413 GGCGGCGGCGGCGGCGGTGCCGG + Exonic
1091823113 12:3491077-3491099 GGGGGCGGGCCCGGGGGCGCTGG + Intronic
1092256191 12:6927947-6927969 GGCGGGGGCCGCGGGCGAGGCGG + Intronic
1092743166 12:11649554-11649576 AGGGGCGGCCGCGGGGGCGCGGG - Intergenic
1093547931 12:20369566-20369588 GGCGGCGGCGGCGGAGGAGGAGG + Exonic
1093958792 12:25250904-25250926 GGCGGCGGCCGCGGCGGCGGAGG - Intronic
1094112205 12:26873828-26873850 GGGGTGGGCCCCGTGGGAGCTGG + Intergenic
1094199229 12:27780135-27780157 GGCCGCCGCCTCGCGGGAGCGGG + Exonic
1095271509 12:40224803-40224825 GGCGGCGGCCGTGGGGCTGCTGG - Intronic
1095752795 12:45729662-45729684 GGCGGCGGCGGCGGCGGCGCAGG - Exonic
1096156970 12:49346360-49346382 GGCGACGGGGTCGGGGGAGCGGG - Intergenic
1096255091 12:50057866-50057888 GGCGGCGGGTCCTGGGGCGCTGG - Exonic
1096309129 12:50505008-50505030 GGCGGCGGCGGCGGCGGTGCTGG + Intronic
1096403188 12:51324107-51324129 GGCGGCGGCCCCCAGGGAGTTGG - Exonic
1096517136 12:52163058-52163080 GGCGAGGGCCCCAGGGGGGCTGG - Intergenic
1096700624 12:53380493-53380515 GCCGCCCGCCCCGGGGGAGGGGG + Intronic
1096749842 12:53751725-53751747 AGCCGCGGCCCCGGGCGGGCGGG - Intergenic
1096771556 12:53938991-53939013 GGCGGCGGCGGCGGAGGAGGAGG + Exonic
1096771563 12:53939012-53939034 GGCGGCGGCACGGGCGGAGCGGG + Exonic
1096796240 12:54079637-54079659 GGCAGCGGCCCCGGGCGATGGGG - Intergenic
1097144999 12:56933979-56934001 GGCGGCGGCCCAGTGGGTGAGGG - Exonic
1097156128 12:57013552-57013574 GGAGGCGGCCCTAGGGGAGAGGG - Intronic
1097245356 12:57604929-57604951 GGAGGGGGCGCCGGGGGAGCGGG - Intronic
1097264691 12:57738369-57738391 GGCGGCGGCGACAGCGGAGCCGG - Intronic
1097929635 12:65169845-65169867 GGCGGCGGCCGCGGGGATGGGGG + Exonic
1098022339 12:66169576-66169598 CGCGGCGCCCGCTGGGGAGCCGG + Intronic
1098255434 12:68611082-68611104 GGCGGCGGCCGCGCGGGGCCGGG + Intronic
1101772096 12:107761051-107761073 GGCAGCGGCCCCCGGGGTGAGGG - Exonic
1102197200 12:111034078-111034100 GGCGGCGGCCCCGGGGCTGGGGG + Exonic
1102457134 12:113077846-113077868 GGCGGCGGCAGCGGGGGCGCGGG - Exonic
1102518474 12:113465296-113465318 GGCCGCGGCCCGCGGCGAGCCGG + Intronic
1102678074 12:114672062-114672084 GGCGGCGGCCGCGGGGCCCCTGG - Exonic
1102853922 12:116277387-116277409 GGCGGCGGCGGCTGAGGAGCAGG - Intergenic
1102853936 12:116277451-116277473 GGCGGGGGCCGAGGGGGAGTCGG - Intergenic
1103077196 12:117993574-117993596 GGTGGCTGCCTCTGGGGAGCAGG - Intergenic
1103800326 12:123533653-123533675 GGCGGCGGCGCGGGGTGTGCGGG + Exonic
1103856348 12:123973173-123973195 CGGGGAAGCCCCGGGGGAGCGGG - Exonic
1103912950 12:124362224-124362246 GGCGGTGGGGCTGGGGGAGCTGG + Exonic
1103958573 12:124593368-124593390 GGCCCAGGCCCCGGGGGTGCAGG - Intergenic
1104215221 12:126727332-126727354 GGCTGTGCCCACGGGGGAGCAGG + Intergenic
1104739926 12:131164779-131164801 CGCGGCGGGGCTGGGGGAGCTGG - Intergenic
1104792553 12:131493186-131493208 CGCGGCGGGGCTGGGGGAGCTGG + Intergenic
1104891867 12:132144075-132144097 GACGGCGGCCCCGGCGGCGGCGG - Exonic
1104913528 12:132251933-132251955 GGGGGCAGGCCTGGGGGAGCTGG - Intronic
1104926184 12:132315091-132315113 GGAGGTGGCCCAGGGGGAGGTGG + Intronic
1104947599 12:132423557-132423579 AGCAGCGGCCCCGGGAGGGCGGG + Intergenic
1104983409 12:132583665-132583687 CGCGGCGGCCCGGGGGGCGTGGG - Exonic
1105024883 12:132841353-132841375 GGCTGCGGCCCCCGGGGCTCTGG + Exonic
1106227090 13:27793790-27793812 GGCGGCGGCGGCGGGGGTGCCGG + Exonic
1106248727 13:27968560-27968582 GGCGGCGGGCCCAGGAGGGCCGG + Exonic
1106340218 13:28820172-28820194 AGCCGCGGCCGCGGCGGAGCCGG + Intergenic
1106478034 13:30114812-30114834 GGCGGCGGCGGCGGGGGTGGCGG + Intergenic
1107058394 13:36130894-36130916 GCGGGCGGCCCCGGGGCTGCTGG - Intronic
1108484473 13:50910192-50910214 GGCGGCGCGCCCGGGGTCGCGGG - Intronic
1108688979 13:52846010-52846032 GGCGGCCTCCTCCGGGGAGCCGG + Exonic
1110705924 13:78602151-78602173 GGTGGCGGCCCGGGGGGCGGCGG - Exonic
1110705937 13:78602175-78602197 GGCGGCGGCCCCGGGGGAGGCGG - Exonic
1111199968 13:84922616-84922638 GGCGGGGGGGCCGGGGGGGCCGG - Intergenic
1111975961 13:94967799-94967821 GGCGCCGGCGCCGGGGCGGCCGG + Intergenic
1111998472 13:95188457-95188479 GTGGTCGGCCCCGTGGGAGCAGG - Exonic
1112091899 13:96091114-96091136 GGCCGCGGCGCCGGAGGAGGAGG + Exonic
1112216322 13:97434322-97434344 CGCGGCGGCCCCCTGGGCGCCGG - Exonic
1112402109 13:99086447-99086469 GGCGGCGGCGCCGGGAGCGGCGG - Intronic
1112506989 13:99981399-99981421 GGCGGGGGCGCCGGGGCGGCAGG - Intergenic
1112507103 13:99981809-99981831 GGCGGCGGCGCGGGAGGAGGAGG - Exonic
1113437903 13:110307404-110307426 GGCGCCGGCCCCGGGGGCTCGGG - Exonic
1113480288 13:110615560-110615582 GGCGACGGCGCGGGGGCAGCTGG + Intronic
1113494455 13:110715738-110715760 GGCGGCGGCTCTCGGGGTGCGGG + Exonic
1113600154 13:111562918-111562940 GGCTGCAGCCCTGGGGGAGGAGG + Intergenic
1113895085 13:113759234-113759256 GGCTGTGGCCCCGGGAGAGCCGG + Exonic
1113911358 13:113842950-113842972 GGGGGAGGCCCCGGGGCAGGTGG - Intronic
1113962313 13:114132733-114132755 GGCGGAGACCCGGGGGGCGCAGG + Intergenic
1114120694 14:19668476-19668498 GGCGGCGGCCGCAGCGGTGCTGG + Intergenic
1115028333 14:28767235-28767257 GGCGGCGGCGGCGCGGGAGCGGG - Exonic
1115320821 14:32077378-32077400 GGCAGCGGCCCCGGCGGTGGCGG - Exonic
1115398584 14:32934899-32934921 CGGGGCGGCCGCGGGGGTGCCGG + Intergenic
1115399156 14:32938859-32938881 GGCGGCGGCGGCGGAGGAGGAGG - Intronic
1115474572 14:33800615-33800637 GGCGGCGGCGCGGGGGGCGGCGG + Exonic
1116426606 14:44798932-44798954 GGAGGCGGCGGCGGGGGAGCGGG - Intergenic
1116862171 14:50003463-50003485 GGCGGGGCCCCCGGGGGCGCGGG + Intronic
1116928607 14:50668043-50668065 GGCGGCGGCGCCGGCGGAGGTGG - Exonic
1117157074 14:52951392-52951414 GGCGGCGGGCCCTGAGGAGGGGG + Intronic
1117790108 14:59331371-59331393 GGAGGAGGCCCTGGGGGAGGAGG - Exonic
1117842164 14:59870841-59870863 GGCAGCGGCCGCGGCGGGGCCGG - Exonic
1117875886 14:60249610-60249632 GGCGGCGGCAGCCGGGGAGGGGG - Intronic
1118019462 14:61695865-61695887 GGCGGGGTCGCCGGGGGAGAAGG - Intronic
1118339105 14:64879840-64879862 GGCGGCGGCGCAGGGGGAGGAGG + Exonic
1118992424 14:70809027-70809049 GGCGGTGGGCCCCGGGGAGCTGG - Exonic
1119003896 14:70907503-70907525 GGCGGCGGCAGTGGGGGCGCTGG + Exonic
1119219371 14:72893602-72893624 GGCCGCGGGCTCGGGGGCGCGGG + Intronic
1119383239 14:74241435-74241457 GGCGTCGGCACCGGTTGAGCAGG + Intronic
1119649912 14:76376247-76376269 GGCGGCCGCGGCGGGGGAGAGGG - Intronic
1119729187 14:76940285-76940307 GGAGCCGGCCCTGGGGGAGATGG - Intergenic
1121415912 14:93779217-93779239 GGCGGGGGCAGCGGGGGAGGGGG + Exonic
1122066104 14:99175330-99175352 GGTGCCGGGCTCGGGGGAGCTGG + Exonic
1122081817 14:99272055-99272077 GCCGCGGGCCCGGGGGGAGCGGG + Intergenic
1122629122 14:103099335-103099357 GCCGAGGGCCCTGGGGGAGCAGG + Intergenic
1122688942 14:103522593-103522615 GGCCGCGTCCCGGGGGGCGCCGG - Intronic
1122975288 14:105168432-105168454 GGCGGCGGGGCCGGGCGGGCGGG - Exonic
1122975333 14:105168544-105168566 GGCGGCGGCGGCGGCGGCGCGGG + Exonic
1123025060 14:105420315-105420337 GGGGGCGGCCGCGGGGGTGGCGG + Intronic
1202848623 14_GL000225v1_random:1761-1783 AACGGAGGCCCCGGGAGAGCTGG + Intergenic
1202849843 14_GL000225v1_random:9554-9576 AACTGAGGCCCCGGGGGAGCTGG + Intergenic
1202853801 14_GL000225v1_random:37529-37551 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
1202854895 14_GL000225v1_random:43971-43993 AACGGAGGCCGCGGGGGAGCTGG + Intergenic
1202856354 14_GL000225v1_random:53993-54015 AACGAAGGCCCCGGGGGAGCTGG + Intergenic
1202859360 14_GL000225v1_random:72038-72060 AACGGAGGCCCCGGGGGAGCTGG - Intergenic
1202864113 14_GL000225v1_random:104385-104407 AACGGAGGCCCCAGGGGAGCTGG - Intergenic
1123682256 15:22771192-22771214 GGCTGCAGCCCCGGGGGTGTGGG - Intergenic
1123684356 15:22786692-22786714 GGCGGCGGCGGCCGGGGAGGGGG + Exonic
1124334007 15:28843705-28843727 GGCGGCAGCCCCGGGGGTGTGGG - Intergenic
1124407468 15:29404938-29404960 GGCCGGGGCCCAGGGTGAGCTGG - Intronic
1124500676 15:30224730-30224752 TGCGGTGGCCCCGGGTGAGCAGG - Intergenic
1124648120 15:31454181-31454203 GGCGCCGGGCCCGGGGAGGCCGG - Intergenic
1124742894 15:32313937-32313959 TGCGGTGGCCCCGGGTGAGCAGG + Intergenic
1124957224 15:34367313-34367335 CGCGGCGGGCGCGGAGGAGCAGG - Intergenic
1125301028 15:38253081-38253103 AGCGGCGGCCGGGGGGGCGCGGG - Exonic
1125677855 15:41512066-41512088 GGCGCCGGCGCCGGGGGCGAGGG - Intronic
1126034961 15:44537206-44537228 GGCGGCGGCGGCGGGGGACTCGG + Exonic
1126736660 15:51737674-51737696 GGCGGCGGCGGCGGAGGAGGAGG - Exonic
1126736661 15:51737677-51737699 GGCGGCGGCGGCGGCGGAGGAGG - Exonic
1126767009 15:52019458-52019480 GGCGGCGGCGACGGCGGAGCCGG + Intronic
1127144115 15:56007297-56007319 GGCGGCGGCGGCGGGGGAGGCGG + Intergenic
1127144123 15:56007315-56007337 GGCGGCGGCGGCGGGGGAGGCGG + Intergenic
1127144131 15:56007333-56007355 GGCGGCGGCGGCGGGGGAGGCGG + Intergenic
1127144139 15:56007351-56007373 GGCGGCGGCGGCGGGGGAGGCGG + Intergenic
1127144147 15:56007369-56007391 GGCGGCGGCGGCGGGGGAGGCGG + Intergenic
1127753481 15:62068132-62068154 GGCGGCAGCCGCGGGGCCGCCGG - Exonic
1128067777 15:64775364-64775386 GGCGCCGGCCCCGCGGGAAGTGG + Exonic
1128119297 15:65133720-65133742 GGCGGCGGCTGCGGGGGCGGTGG + Exonic
1128582401 15:68818955-68818977 GGGGGCGGCCGCGGGAGAGGAGG - Intronic
1128841471 15:70854234-70854256 GGCGGCGGCGGCGGCGGCGCGGG - Intronic
1128987148 15:72230283-72230305 TGCGGCGGCCCGGGGGCAGCTGG - Intronic
1129108493 15:73324224-73324246 TGCGCCGGCCCCGGGTCAGCAGG + Exonic
1129269505 15:74411971-74411993 GGTGGTGGAACCGGGGGAGCAGG - Exonic
1129299246 15:74615936-74615958 GGCGGCGGCCGGGGGTGAGTCGG + Intronic
1129424504 15:75454294-75454316 GGCGGGGCCTCCGGGAGAGCCGG + Intronic
1129780036 15:78264238-78264260 GGGGGCGGCCTCGGGGCGGCGGG + Exonic
1129893788 15:79089492-79089514 GGCGGCGGCGCAGGGGGCGGGGG + Intronic
1129893948 15:79090163-79090185 GGCCGCGGCCCTGGGGGCTCAGG - Intronic
1130076529 15:80695078-80695100 GGCGGCGGCGGCGGGCGTGCGGG + Intronic
1130076531 15:80695084-80695106 GGCGGCGGGCGTGCGGGAGCGGG + Intronic
1130348055 15:83067072-83067094 GGCGGCGGCCCCGCGGGGCCCGG + Exonic
1131144346 15:90001681-90001703 GGCGGGGGCGCGGGGGGCGCGGG + Intronic
1131144432 15:90002022-90002044 GGCGGCGGCGGCGGCGGCGCGGG + Intronic
1131180176 15:90233997-90234019 GGGGGCGGGCCCGGGGGTGGTGG - Exonic
1131257558 15:90872040-90872062 GGCGGCAGCCCCGGTGGCGGCGG - Intronic
1131369497 15:91867803-91867825 GGCGGAGGCCCCGGGTGTTCTGG + Intronic
1131517385 15:93088523-93088545 GGCGGGGGCCCGGGCGGCGCGGG + Intronic
1131829094 15:96343047-96343069 GGGGGCCGCTCCGGGGGAGATGG - Intergenic
1132055678 15:98648991-98649013 GGCGGCGGCGCTGAGGGAGGAGG + Exonic
1132365001 15:101251107-101251129 GGAGGCGGTGCCCGGGGAGCAGG + Intronic
1132517798 16:373962-373984 GGTGTGGGCTCCGGGGGAGCAGG - Intronic
1132560204 16:590070-590092 CGCGGCGGCCCTGGTGGTGCGGG + Intronic
1132583125 16:694329-694351 GGGGGTGGCCCCGGGGCAGTTGG + Exonic
1132656570 16:1044052-1044074 GCCGGCGGCGGCGGGGGCGCCGG + Intergenic
1132847993 16:2009487-2009509 GGGCGCGGCCCGGGGGCAGCGGG - Intronic
1132885609 16:2180810-2180832 GGCGCAGGCCCCGGGGCAGCCGG + Exonic
1133013001 16:2925261-2925283 GGCGGGGGCCTCGCGGGACCTGG + Intronic
1133051604 16:3120277-3120299 GGCGGCGGCGGCGGGGGCTCTGG + Exonic
1133058313 16:3158521-3158543 GGCTGCGGCCCGCGGGGAGGTGG - Intergenic
1133156573 16:3880478-3880500 GGCGGCGGCGGCGGCGGAACGGG - Exonic
1133188454 16:4116361-4116383 GGCAGCGGCCGCGGGGGACACGG - Intergenic
1133223111 16:4327726-4327748 GGCGGGGGCTTCGGGGGACCGGG - Intronic
1133272031 16:4614977-4614999 GCCGGGCGCCCCGGGGGAGCGGG + Intronic
1133802127 16:9092368-9092390 GGCGGCGGCCTCGGGGATCCCGG + Intronic
1134061637 16:11202843-11202865 GGCTGGGGCCCCGTGGGAGTGGG + Intergenic
1134070117 16:11255604-11255626 GGCGGCGCTCCCGGCGGACCCGG + Intronic
1134428900 16:14182227-14182249 GGCAGCTGCCCCGTGGGAGAGGG + Intronic
1134656108 16:15949608-15949630 GGCGGCGGCGGCGGCGGCGCAGG - Exonic
1134781022 16:16895703-16895725 GGCGGCGGGGCCGGGGGAGGGGG - Intergenic
1135517664 16:23149146-23149168 GGCGGCGGCGCGGGGGGCCCCGG - Exonic
1135607368 16:23836125-23836147 GGTGCCGGCCCCGGGGCCGCGGG - Exonic
1135745801 16:25015274-25015296 GGCGGCGGCCCGCGGGGCTCGGG + Exonic
1135821775 16:25692064-25692086 CGCGGCGGAGCCGGGGAAGCGGG + Exonic
1135821873 16:25692326-25692348 GGCGGCGGCGGCGGGGGCGGCGG + Exonic
1136110897 16:28063212-28063234 GGCGGCGGCGGCGGGGGCGGCGG + Exonic
1136365045 16:29806070-29806092 GGCGGCGGCGGTGGGGGAGGGGG - Intergenic
1136514750 16:30761480-30761502 GGTGGCGCCTGCGGGGGAGCCGG + Intronic
1137426567 16:48385367-48385389 GGCGGCGGCCAGGGGGGAGCCGG - Intronic
1137617263 16:49855506-49855528 GGCGGCGGCGGCGGCGGAGGGGG - Intronic
1137731465 16:50693571-50693593 GGCTGCGGCTCCGGGTGCGCGGG - Intergenic
1137785469 16:51134429-51134451 GGCGGCGGCCATTGGAGAGCGGG + Intergenic
1137787441 16:51150742-51150764 GGCGCCGGCCCCAGGGCACCCGG - Intronic
1138328075 16:56191774-56191796 GGCGGCGGCGGCGGAGGAGGAGG - Intronic
1138478291 16:57284720-57284742 GGGGGCGGCCCCGGCGGCGGGGG - Intergenic
1139420178 16:66844941-66844963 AGCGGGGACCTCGGGGGAGCGGG + Intronic
1139534465 16:67562856-67562878 GGCGGCGGCCGCGCCGCAGCAGG - Intronic
1139778204 16:69330318-69330340 CGTGGCGGCCCCGGTGGAGCGGG - Exonic
1139890682 16:70251647-70251669 GGCGGCGGCCCGGCCGGAGCAGG - Exonic
1139894891 16:70280603-70280625 TGCAGATGCCCCGGGGGAGCAGG + Intronic
1140223255 16:73058712-73058734 GGCGGCGGCGGCGGCGGAGCTGG + Intronic
1140223270 16:73058763-73058785 GGCGGCCGCAGCCGGGGAGCCGG + Intronic
1140354881 16:74297057-74297079 CGCGGCGGCCGCGGACGAGCTGG + Intronic
1140519140 16:75566724-75566746 GACCGCGGCCCCGGGGACGCCGG + Intronic
1140723090 16:77788617-77788639 GGCTGCGGCGCTGGGGGAGTGGG - Exonic
1140927582 16:79599196-79599218 GGCGGCGGCGGCGGCGGAGGCGG - Exonic
1141214534 16:82011285-82011307 GGTGGCGGTCCCGGGGGTGGGGG - Intronic
1141517486 16:84555543-84555565 GGAGGCGGGCTCGGGGGAGGAGG + Intergenic
1141531236 16:84648463-84648485 GGCGGCGGCCGCGGGGAGGCGGG - Intergenic
1141619457 16:85229108-85229130 GGTGGCGGCATCGTGGGAGCAGG + Intergenic
1141692712 16:85605652-85605674 GGTGGCCCCCCCGGGGGTGCAGG - Intergenic
1141694141 16:85612009-85612031 GGCGGCCGCCCAGGGGGTGCTGG + Intronic
1141749106 16:85946468-85946490 GGTGGTGGCCCAGAGGGAGCAGG - Intergenic
1141831167 16:86510615-86510637 GGCGGCGGCGGCGGGGGAGGCGG + Exonic
1141839963 16:86567983-86568005 GGCGGCGTCCCCGGCGCTGCCGG + Exonic
1142053279 16:87974661-87974683 GGCTGAGGCCCCTTGGGAGCAGG + Intronic
1142099800 16:88265159-88265181 GGCGGCGGCCAGGGCAGAGCGGG - Intergenic
1142155711 16:88532098-88532120 GGCGGCTGCGGCCGGGGAGCCGG - Exonic
1142156469 16:88534725-88534747 GGCGGCGGCTCCTGGGGCTCCGG - Exonic
1142173557 16:88634868-88634890 GGCGGCGGCCGCTGGGGAGAAGG + Intergenic
1142191860 16:88721782-88721804 GGCCGAGGCCGCGGGGGAGGGGG - Intronic
1142236344 16:88924347-88924369 GTCGGCGGCCCCAGGGAGGCAGG - Intronic
1142291668 16:89196070-89196092 GGGGGCGGCCCCGCAGGAGTGGG + Exonic
1142336097 16:89490351-89490373 GGCGGCGGCGGCGGCGGCGCGGG + Exonic
1142344381 16:89544797-89544819 GGGGGCGGCCCAGGTGGAGTGGG - Intronic
1142375577 16:89705275-89705297 GGCAGTGGCCCCAGGGGACCAGG - Intergenic
1142518757 17:490340-490362 GGTGGCGGTCCCGGGGCTGCCGG - Intergenic
1142611008 17:1109228-1109250 GGCGGCGGCGGCGGCGGAGCGGG - Intronic
1143007459 17:3846166-3846188 GGCGGAGGCCCCGGCGGGGCCGG - Exonic
1143107863 17:4538403-4538425 GGCTGAGGCCCCGGGAGAGGCGG + Exonic
1143223675 17:5282459-5282481 GGCGGCCGGCCTCGGGGAGCGGG - Exonic
1143471206 17:7177249-7177271 GGCTGAGGCCCAGGGAGAGCAGG + Exonic
1143483400 17:7239469-7239491 GCCGGCGGCGCGGGGGGAGGGGG - Exonic
1143485387 17:7251347-7251369 GGGGGCTGCCCCCGGGGGGCTGG - Exonic
1143527259 17:7479686-7479708 GGCGGCGGCGGCGGCGGCGCTGG - Intronic
1143539758 17:7561996-7562018 GGCGGCGGCGGCGGTGGCGCTGG + Exonic
1143590631 17:7884602-7884624 GACGGCGGCCCCGAGGGTGGGGG + Intronic
1143847258 17:9781893-9781915 GGCTGCGGTCCTGGGGGACCAGG - Intronic
1144561697 17:16325823-16325845 GGCGGCGGAACCAGAGGAGCTGG - Exonic
1144565014 17:16352999-16353021 TGCGGCGGGCCGGGGGGCGCGGG - Intronic
1144656949 17:17042808-17042830 GGCGGCGGCGGCGGCGGCGCAGG - Exonic
1144863525 17:18320510-18320532 GGCGGCAGCACCTGTGGAGCTGG + Intronic
1146022655 17:29292960-29292982 GGCGGCGGAGCCGGGTGACCCGG - Intronic
1146176264 17:30668099-30668121 GGCGGCGGCCCCAGGGAGGGAGG + Intergenic
1146339606 17:32007670-32007692 GGCGGCGGCGGCGGCGGGGCCGG - Intergenic
1146349719 17:32084209-32084231 GGCGGCGGCCCCAGGGAGGGAGG + Intergenic
1146403675 17:32519470-32519492 GGCGGCGGCGGCGGGGGCGGAGG + Intronic
1146889679 17:36498331-36498353 TGGGGCTGCCCCTGGGGAGCTGG + Exonic
1146894943 17:36534494-36534516 GGGGGCGGCCTGGGGGGAGAGGG - Intronic
1147028394 17:37609303-37609325 GGCGGCGGGGCCGCGGGAGCTGG - Exonic
1147341372 17:39754824-39754846 GTCGGCAGCCCCGGCGGAGACGG - Intergenic
1147393347 17:40122867-40122889 CGGGGCGGCCCCCGGGCAGCAGG + Intronic
1147400596 17:40178125-40178147 GGCGGGGGTCGCGGAGGAGCCGG + Intronic
1147454972 17:40531370-40531392 GGCGGGGGACCAGGGGGACCAGG + Intergenic
1147754765 17:42761122-42761144 GGCGGCGGCCACGTGGGGGGCGG - Intronic
1147931508 17:43984162-43984184 GGCGCCAGCCCCGGGGATGCGGG + Intronic
1147970971 17:44219074-44219096 GGCGGGGGCGCCGGCGGGGCTGG - Intronic
1147976920 17:44253176-44253198 GGCTGCAGCCCCTGGGGTGCTGG + Exonic
1148060021 17:44829996-44830018 GGCGGGGTCCCAGGGGGAGGCGG - Intronic
1148079438 17:44959789-44959811 GGTGGCGCGCCCGGGGGAGGGGG - Exonic
1148183044 17:45620513-45620535 GGCCGCGGGGCCCGGGGAGCGGG + Intergenic
1148265809 17:46225178-46225200 GGCCGCGGGGCCCGGGGAGCGGG - Intronic
1148437177 17:47693997-47694019 GGCGGCGGCGGAGGAGGAGCGGG + Intergenic
1148733424 17:49851370-49851392 GGTGGCGCCCCCGCGGGAGCCGG + Intergenic
1149712568 17:58756312-58756334 GGCGGCAGCCCCGGGGCACTCGG + Exonic
1149994705 17:61400353-61400375 GGCGGCGGCCGCGGCGGCGGCGG + Exonic
1149995880 17:61405699-61405721 GGCGGCGGCAACGGCGGAGGTGG + Exonic
1150003133 17:61454511-61454533 GACGGCCGCCCCGGGCCAGCCGG + Intronic
1150060581 17:62065365-62065387 GGCGGCGGCGGCGGGGGGGTGGG - Intergenic
1150061545 17:62073005-62073027 GGCGGCGGCCGGGCGGGGGCTGG - Intergenic
1150124565 17:62627891-62627913 GGCGGCGTCCCCAGGGGCGCCGG - Exonic
1150210400 17:63438441-63438463 GGCGGGGGCGTGGGGGGAGCGGG - Intronic
1150249847 17:63699515-63699537 GACCCCGGCCCCTGGGGAGCAGG - Intronic
1150407977 17:64919173-64919195 GGCGGCGGCGGCGGCGGGGCCGG + Intronic
1150484901 17:65536965-65536987 GGAGGGGCCCCCGGCGGAGCTGG - Exonic
1150561918 17:66302319-66302341 GGCGGCGGCCGGGGGAGGGCCGG - Intergenic
1150643689 17:66965493-66965515 GCCGGCACCCCCGGGGGAGGTGG + Intronic
1150791892 17:68205756-68205778 GGCGGCGGCGGCGGCGGGGCCGG - Intergenic
1151642349 17:75405405-75405427 GGAGTGGGCCCCGGGGGAACCGG - Exonic
1151882983 17:76905944-76905966 GGCCGGTGCCCCGGGGGGGCGGG + Intronic
1152066002 17:78112848-78112870 GGAGGTGGCCCCAGGGCAGCGGG + Exonic
1152068583 17:78124427-78124449 GTTGGGGGCCCCAGGGGAGCTGG + Intronic
1152131462 17:78479476-78479498 GGCCGCGGCCCTGGGTAAGCTGG - Exonic
1152447261 17:80353071-80353093 GGCGGAGCCCCTGGGGGAGCAGG + Intronic
1152544173 17:80992370-80992392 GGCAGCGACTCCGGGAGAGCCGG - Intronic
1152562164 17:81083982-81084004 GGGGGCAGCCCCAGGGGCGCAGG - Intronic
1152571620 17:81123652-81123674 GGGAGCTGCCCTGGGGGAGCTGG + Intronic
1152675252 17:81636888-81636910 TGCGGCGGCCGGGCGGGAGCGGG - Intronic
1152697414 17:81804066-81804088 GGGGGCGGCCCCGCGGGGGTGGG - Intergenic
1152697502 17:81804323-81804345 CGCGGCGGGGCCGGGGGCGCGGG + Intronic
1152834401 17:82519937-82519959 GGCGGCGGGGCCGGGGGCGGCGG + Exonic
1152834410 17:82519952-82519974 GGCGGCGGGGCCGGGGGCGGCGG + Exonic
1152965848 18:112509-112531 AACGGAGGCCCCGGGGGAGCTGG - Intergenic
1153515231 18:5895626-5895648 GGCGGAGGACGCGGGGGAGCGGG - Intronic
1153617828 18:6950859-6950881 GGAGGCGGCCCCCGTGCAGCTGG + Exonic
1153794402 18:8609494-8609516 GGCGGCGGCAGCGGCGGAGGAGG + Exonic
1153794451 18:8609637-8609659 GGCGGAGGCCGAGGGGGCGCCGG + Exonic
1154500994 18:14998051-14998073 GCCCGCGGCCCCGGGAGAGGCGG - Intergenic
1155519920 18:26657155-26657177 AGCGGCAGCCCCGGAGGAGGCGG + Intronic
1155654340 18:28177067-28177089 GGCGGCGGCGGCGGCGGAGGAGG + Exonic
1155654341 18:28177070-28177092 GGCGGCGGCGGCGGAGGAGGAGG + Exonic
1156275780 18:35581677-35581699 GGGGGCGGGCGCGGCGGAGCGGG + Intronic
1157383939 18:47247085-47247107 GGCGGCGGCGGCGGCGGGGCCGG + Intronic
1157447132 18:47754398-47754420 GGCGGCGGCGCCAGGGCAGGAGG - Intergenic
1157529502 18:48409391-48409413 AGCGGCGGCAGCGGGCGAGCGGG + Intronic
1157610007 18:48950249-48950271 GGCGGCGGCCCGGGCAGGGCTGG - Exonic
1157614001 18:48976162-48976184 GAGGGCGGGCCCGCGGGAGCGGG + Intergenic
1157763463 18:50281458-50281480 GGAGGCGGCCGCGGAGGAGGAGG - Exonic
1157867054 18:51196771-51196793 GGCGGCGGCCGCGGCGGCGGCGG - Exonic
1158404296 18:57147328-57147350 GGCGGCGGCAGCGGCGGTGCGGG + Exonic
1158695200 18:59697395-59697417 GGCGGCGGCCGCGGAGGAGCAGG - Intergenic
1158931060 18:62325358-62325380 GGCGGCGCCGCCGGGCGCGCGGG - Exonic
1159511246 18:69400822-69400844 GGGGGCGGGCCGGGGGGGGCGGG - Intergenic
1159798104 18:72867783-72867805 GGCGGCGGCGCCGGCGGCGGCGG + Exonic
1160453345 18:78979750-78979772 GGCGGCGGCGGGGGGGGCGCGGG + Intergenic
1160458909 18:79022734-79022756 GGCCACGGGCCGGGGGGAGCAGG - Intergenic
1160495003 18:79368100-79368122 CGCCGTGGCCCCGGGTGAGCTGG + Intronic
1160512308 18:79459377-79459399 GGAGGAGGCCGCGGGGGAGACGG + Intronic
1160540361 18:79617422-79617444 GGCGGGGTCCCGGGGGGGGCGGG - Intergenic
1160566164 18:79787993-79788015 GAAGGCCGCCCCGGGAGAGCGGG + Intergenic
1160630946 18:80246548-80246570 GGGGGCGCGCCCGGGGGAGTGGG + Intronic
1160680327 19:409171-409193 GGCGGCGGCGGCGGCGGGGCTGG - Intergenic
1160724975 19:613859-613881 TGCGGCGGCCCCGGGTGAGCAGG - Exonic
1160738814 19:676613-676635 GGCGGCGGCGGCGGGGGCGAGGG + Intronic
1160755167 19:753110-753132 GGCGGCGTCCACGGAGGAGGAGG + Intronic
1160767028 19:813252-813274 GGCGGCGGCCCCGCGCGCGGTGG + Exonic
1160792558 19:929398-929420 CGTGGGGGCCGCGGGGGAGCCGG - Exonic
1160806776 19:995393-995415 GGCAGCGTCCCCAGGGCAGCAGG - Intronic
1160841124 19:1147484-1147506 GGCTGCGGCCATGGGGGTGCAGG - Intronic
1160858676 19:1228541-1228563 GCCGCCGGCCCTGAGGGAGCCGG - Exonic
1160860875 19:1236841-1236863 GGCGGCGGCCTGGGGGGGGGCGG + Intronic
1160860885 19:1236859-1236881 GGCGGCGGCCTCGGGGGGGCGGG + Intronic
1160873173 19:1286089-1286111 GGCGGCGGCGGCGGCGGAGGAGG + Intergenic
1160873174 19:1286092-1286114 GGCGGCGGCGGCGGAGGAGGCGG + Intergenic
1160907265 19:1457210-1457232 GACGGCGGGCCCGAGGGAGGTGG + Exonic
1160909223 19:1467214-1467236 GGCGGGGGCGCCGGGGGCGCCGG + Exonic
1160927887 19:1555803-1555825 GGCGGCGGCCGCGGGGCTGCTGG + Exonic
1160947871 19:1652009-1652031 GGCGGGGGCGCGGGGGGCGCCGG - Intronic
1160967701 19:1753837-1753859 GGCGGCGGCGGTGGGGGCGCCGG + Exonic
1160967706 19:1753846-1753868 GGTGGGGGCGCCGGGGGCGCGGG + Exonic
1160967911 19:1754566-1754588 GGCGGCGGCCCCGGCGGGAGCGG + Exonic
1161022097 19:2015445-2015467 GGCGGCGGGCCCGGGGGCGGCGG - Exonic
1161063791 19:2227922-2227944 GGCGGGGGCAGCGGGGGAGGCGG - Intronic
1161072688 19:2270501-2270523 CGCGGGGGCCGCCGGGGAGCTGG + Intronic
1161153613 19:2721475-2721497 CGCGCCGGCCCCGTGGGCGCGGG - Intronic
1161169969 19:2807755-2807777 GGACGCGGCCTCGGGGGAGGTGG + Exonic
1161215770 19:3094493-3094515 GGCGGCGGCCGAGGCGGGGCGGG + Exonic
1161241055 19:3224422-3224444 GGCGGGGACCCCTGGGAAGCCGG + Intergenic
1161257996 19:3320410-3320432 GGCGGCGGCCGGGCGGGCGCGGG - Intergenic
1161264519 19:3358318-3358340 GGCGTCCTCCCTGGGGGAGCAGG + Intergenic
1161296535 19:3523182-3523204 GGCGGAGGCCCCGTGTGACCTGG - Intronic
1161317846 19:3626595-3626617 GGCGGCGGAGCCGGGAGCGCAGG - Exonic
1161358200 19:3831463-3831485 TGCGGGGGTCCCGGGGGAGGCGG + Exonic
1161374706 19:3933506-3933528 GGAGGCGGCCCCTGGGGATGGGG - Exonic
1161374716 19:3933521-3933543 GGAGGCCGCCCCGGGGGAGGCGG - Exonic
1161384798 19:3985246-3985268 GGCGGCGGGGCCGGAGGACCCGG - Intronic
1161422599 19:4184160-4184182 GGCGGCCGCCCCAGGGGGCCGGG - Intronic
1161577931 19:5065051-5065073 GGCGGGGTCCCTGGGGGTGCTGG + Intronic
1161628018 19:5338330-5338352 GGCGGTGGCCCCCAGGGGGCTGG + Intronic
1161628760 19:5340876-5340898 GGCGGCGGCGGCGGCGGCGCTGG - Intergenic
1161793687 19:6374877-6374899 TGCGCCGGCCCCGGGGAATCCGG - Exonic
1161802638 19:6424556-6424578 GGCGGCGGTCCCGGCGGCGGCGG - Exonic
1161802672 19:6424631-6424653 GCCGGCGGGGGCGGGGGAGCCGG - Exonic
1161805849 19:6442487-6442509 GGAGGAGTCCCCTGGGGAGCTGG - Intronic
1162007557 19:7789691-7789713 TGGGGCGGCGCCGGGGGAGGGGG + Intergenic
1162128245 19:8510882-8510904 CGCGGGGGCCGCGGGGGCGCCGG + Exonic
1162140201 19:8580804-8580826 AGAGGGGGCCCCGGGGGGGCGGG - Exonic
1162321023 19:9970628-9970650 GCCGGGGGGCCCGGGGGCGCCGG + Exonic
1162470941 19:10871711-10871733 GGCGGCGGCGGCGGTGGGGCCGG + Exonic
1162535839 19:11262474-11262496 GGCGGCGGCGGCGGCGGGGCCGG - Intronic
1162578650 19:11514191-11514213 AGTGGAGGCCCCGAGGGAGCCGG + Exonic
1162584682 19:11551726-11551748 CGCGCCGGCCCAGGGGGAGCAGG - Intronic
1162752682 19:12838504-12838526 GGCGGCGGCGGCGGCGGCGCGGG - Intronic
1162802314 19:13118353-13118375 GGCCGAGGCCCCGGCGCAGCGGG + Exonic
1162861136 19:13506418-13506440 GGCGGCTGCCCGGGCCGAGCCGG + Intronic
1162929881 19:13952561-13952583 GGCGGCGGCCCCGGGGGAGCCGG + Exonic
1162934160 19:13972873-13972895 GGCGGCGGCGGCGGGGGAGGCGG - Exonic
1162940439 19:14006039-14006061 GGCGGCGGGGCCGGGGCAGTAGG - Intronic
1163023472 19:14496036-14496058 GGCGGCGGCGGCGGCGGAGCAGG - Exonic
1163103120 19:15109340-15109362 GGCTGTGGCCCCGGGGGCTCAGG - Exonic
1163154489 19:15432523-15432545 GGCGGCGGCGGCGGGGGTGGGGG + Intronic
1163154555 19:15432712-15432734 GGCGGCCGCCCCGCGTGCGCCGG - Intronic
1163442452 19:17328763-17328785 GGCGGCGGCAGCGGGGGCGGGGG - Exonic
1163464009 19:17455681-17455703 GGGCGCGACCCCGGGGGAGGGGG - Exonic
1163547411 19:17948328-17948350 GGCGGCGGCCTCGGGGAAGCCGG + Intergenic
1163551173 19:17967162-17967184 GGCGGCGGGGCCGGGGGCGGCGG - Intronic
1163584416 19:18156140-18156162 GGCGGGGGCCCCGTGGGCGAGGG - Exonic
1163606935 19:18280862-18280884 GCGGGCGGCGCCGGGGGCGCGGG - Exonic
1163695304 19:18760762-18760784 GAGGGGGGTCCCGGGGGAGCAGG - Intronic
1163791023 19:19306150-19306172 GCTGTGGGCCCCGGGGGAGCTGG + Intronic
1163793305 19:19320892-19320914 GGCGGCGGCCCAGGCTGCGCAGG + Exonic
1164698459 19:30264356-30264378 GGCGGGGGCCTGGGGGGATCAGG - Intronic
1164756597 19:30694553-30694575 GGAGGCAGCCGCTGGGGAGCTGG - Intronic
1164835085 19:31350773-31350795 GGCGGCGGCTGAGCGGGAGCCGG + Intergenic
1164904875 19:31959240-31959262 GGAGGCTGCCCAGGAGGAGCCGG + Intergenic
1165047730 19:33119018-33119040 GGTGGCGGCTCCTGGGGTGCTGG - Exonic
1165330350 19:35138509-35138531 GGCGGCTGCCCCCTGGGAACTGG - Intronic
1165489583 19:36115491-36115513 GGCGGCGGCGGCTGCGGAGCGGG + Exonic
1165493916 19:36141045-36141067 GGCGGCGGCGGCGGGGGAGGCGG + Exonic
1165995478 19:39840628-39840650 GGCGGCGGCGGCGGTGGAGGAGG - Exonic
1166106372 19:40600097-40600119 GGCGGCGGCCCCGGGGGCCAGGG + Exonic
1166358640 19:42242422-42242444 GGAGGCGGCCCTGGGGGCTCGGG - Exonic
1166386867 19:42387307-42387329 GGCTGGGGACCCGCGGGAGCAGG - Intronic
1166682619 19:44778130-44778152 GGAGGCGGCCCCGGGGGTCCCGG + Exonic
1166822261 19:45587762-45587784 AGAGGAGGGCCCGGGGGAGCGGG + Intronic
1166888060 19:45973458-45973480 GGCGGCGGCGGCGGGGGCGGCGG + Exonic
1166957009 19:46471413-46471435 AGCAGCGGCGCCGGGGTAGCCGG - Exonic
1167019089 19:46861080-46861102 GGCGGCGGCTCCGGCGGCGGGGG - Intergenic
1167080855 19:47275240-47275262 GGCGGCGGCTCAGCGGCAGCTGG - Exonic
1167268256 19:48493894-48493916 GGCGGCGGCGCCGGGCGCGGCGG - Exonic
1167269331 19:48498796-48498818 GGCGGCGGGGGGGGGGGAGCGGG + Exonic
1167286928 19:48603621-48603643 AGTGCCGGCCCCGGGGTAGCAGG + Exonic
1167300237 19:48673645-48673667 GGCGGGGACCCCCGGGGTGCGGG + Intergenic
1167300413 19:48674388-48674410 GGGGGCGGCCACGGGGGCCCGGG + Intergenic
1167369653 19:49072830-49072852 GGCGGCGGCGGCGGCGGGGCAGG - Exonic
1167578342 19:50328367-50328389 GGCGGCGGCCTGGACGGAGCGGG - Exonic
1167638523 19:50668227-50668249 GGGGGCGGCCCGGAGGGAGGGGG - Exonic
1167638636 19:50668535-50668557 GGCGGCGGCTGCGGGGAGGCCGG + Exonic
1167648725 19:50718812-50718834 GGCGGGGGGCACCGGGGAGCAGG + Intronic
1167797545 19:51719640-51719662 GGCGGCGGCGCGGGGGCCGCTGG - Exonic
1168076291 19:53982442-53982464 CCCGGCGGCCCCGGGGGCCCGGG + Exonic
1168076338 19:53982580-53982602 GGCGGCGCGGCCGGGGGCGCCGG + Exonic
1168104016 19:54155747-54155769 GGCGGGGGCGCCGGGCCAGCTGG + Exonic
1168247009 19:55117501-55117523 GGCGGCTGGCCCGGGGGCGGCGG - Exonic
1168297848 19:55386335-55386357 GGCGGCGGCTGCGGGGAAACGGG - Exonic
1168315220 19:55482051-55482073 GGCGGAGACCACGGTGGAGCTGG + Exonic
1168327959 19:55547548-55547570 GGCGCTGGCCTCTGGGGAGCTGG + Intergenic
1168339082 19:55613637-55613659 GGCAGCGGCGCCGGGGGTGGCGG + Exonic
1168339515 19:55615136-55615158 GGCGGCGGCCGCGGCGGCGGTGG + Exonic
1168343809 19:55641052-55641074 GCCGGCGGCGCCGGGGACGCGGG - Intronic
1168497985 19:56870077-56870099 GGCGGCAGCCCTGGGGTACCCGG - Intergenic
1168536074 19:57172016-57172038 GGCGGGGGCCGCGAGGGGGCGGG + Intergenic
925008548 2:465133-465155 GGCAGCGGCCACAGGGCAGCAGG + Intergenic
925069716 2:956567-956589 GGCCGGGGCCCTGGGGGAGCGGG - Intronic
925609793 2:5693151-5693173 GGCGGCGGCGGCGGGAGCGCGGG + Exonic
926141055 2:10368681-10368703 GGTGGCCGCCCTTGGGGAGCTGG + Intronic
926144464 2:10388207-10388229 GCCGACGGCCCCGGGGAGGCAGG - Intronic
927168761 2:20350937-20350959 CGCGGCGGCAGCGCGGGAGCAGG - Intronic
927472214 2:23385238-23385260 GGCGGCGGCGGCGCGGGGGCTGG - Exonic
927472321 2:23385566-23385588 GGCGGCGGCGGCGGAGGAGGAGG + Exonic
927720385 2:25378389-25378411 TGCAGGGGCCCCGGGGGAGCGGG + Intronic
927811759 2:26184413-26184435 GGCGGCGGCCCAGCGAGCGCGGG + Exonic
928983215 2:37156907-37156929 GGCGGCGGCGGCGGCGGCGCAGG - Exonic
929218132 2:39437183-39437205 GGCGGCGGGCCGCGGGGGGCGGG - Exonic
929537415 2:42792428-42792450 GGGGGCGGCCATGGGGGTGCTGG + Intronic
929604178 2:43224535-43224557 TGCGGCGGCCCCGGCGGGGAGGG + Exonic
929778338 2:44942222-44942244 GGCGGCGGCGGCGCGGGAGGCGG + Exonic
929778351 2:44942270-44942292 GGCGGCGGTGCTGGCGGAGCAGG + Exonic
930096440 2:47570286-47570308 GGCGGCGGCTACGGCGGGGCGGG + Exonic
930358218 2:50346867-50346889 GGCGGCGGCGGCGGCGGCGCAGG - Intronic
931253510 2:60552426-60552448 GGCGGCGGCGGCGGCGGCGCGGG + Intronic
931762840 2:65432227-65432249 GGCGGAGGCTCCGGGGGCTCGGG + Intronic
932567227 2:72917695-72917717 GGCGGCTGCTGCGGCGGAGCGGG - Exonic
932593730 2:73081585-73081607 GGCCGGAGCCCAGGGGGAGCAGG + Intronic
932612459 2:73210005-73210027 TGCAGCGGCCCCGGGAGAGCTGG - Intronic
932621870 2:73269457-73269479 GGCGGCGGCCGCGGCGGCGGCGG + Exonic
932779128 2:74549127-74549149 GGCGTCGGCCACGAGAGAGCGGG + Intronic
932823357 2:74920017-74920039 GGCGGCCGTCCCCCGGGAGCGGG + Intergenic
933684720 2:85133718-85133740 GGCGGCGGCAGCGGGGGAGGCGG + Exonic
933834278 2:86232705-86232727 GGTGGGGGGCCCGAGGGAGCAGG + Exonic
934098199 2:88627019-88627041 GCCGGCAGCCGCGGGAGAGCAGG - Exonic
934296812 2:91749012-91749034 GGCGGCGGCGGCGAGGGTGCGGG - Intergenic
934560222 2:95309350-95309372 GGTGGAGGCCCCAGGGCAGCAGG - Intronic
935592447 2:104855302-104855324 GGCGGCGGCGGCGGGGGCGGAGG + Intergenic
935592738 2:104856231-104856253 GGCGGCGGCGGCGGCGGCGCGGG + Exonic
935592784 2:104856393-104856415 GGCGGCGGCGGCGGCGGCGCGGG + Exonic
936122688 2:109760413-109760435 GGCGGCGGCGGCGGCGGCGCAGG + Intergenic
936126708 2:109794597-109794619 GGCGGCGGCGGCGGGGGGGGCGG + Intronic
936222005 2:110611060-110611082 GGCGGCGGCGGCGGCGGCGCAGG - Intergenic
936390778 2:112071303-112071325 GGTGGCGGCGGCGGGGGGGCGGG - Intronic
937083751 2:119157851-119157873 GGCGGCGGGGCCGGGGTAGGTGG - Exonic
937093875 2:119223703-119223725 GATTGCGGCCCCGGGGGAGGTGG + Intergenic
937183143 2:120013462-120013484 GGCGGAGGGCCCGGGGCAGCCGG + Intronic
937317030 2:120938166-120938188 GGAGGAGGCCCTGGGGGAGTCGG - Intronic
937368857 2:121284540-121284562 GGCGGCGGGCTCGGAGGGGCAGG - Intronic
937942120 2:127294111-127294133 CGCGGCGGGCCTGTGGGAGCGGG - Exonic
938296464 2:130182318-130182340 GGCGGCGCCCCCGGGGCTGGAGG + Exonic
938397854 2:130963965-130963987 TGCGGCGGCCGCGGGGCTGCCGG - Intronic
938460287 2:131492319-131492341 GGCGGCGCCCCCGGGGCTGGAGG - Exonic
938500166 2:131828240-131828262 GCCCGCGGCCCCGGGAGAGGTGG - Intergenic
940420945 2:153478615-153478637 GGCGGCGGCGCTGGAGGAACAGG + Exonic
941462991 2:165793738-165793760 TGGGGCGGCCCCTGAGGAGCTGG - Intronic
941808724 2:169734444-169734466 TGCGGCGGGCGCGGGGGAGGGGG + Intronic
941911696 2:170770840-170770862 GGAGGCGGGTCCGGGGGGGCGGG - Intergenic
942045866 2:172099141-172099163 GGCGCCGGCGCCGGAGGGGCAGG + Intergenic
942278079 2:174336894-174336916 GGCGGCTGCCACGGCGGCGCTGG - Exonic
942314194 2:174682930-174682952 GGCGGCGGCGCCGGAGGGGAGGG - Intergenic
942446145 2:176080249-176080271 GGCGGCGGCGGCGGGGGCGCCGG - Exonic
942450916 2:176107623-176107645 GGGGGCGGCCCCGGCGGGGGCGG + Exonic
942454802 2:176130332-176130354 GGCGGCGGCCCCGGGCGGGCGGG - Exonic
942458174 2:176151922-176151944 GGCGGAGGCGCCGGGGGAGCTGG - Exonic
942460563 2:176165420-176165442 GCCGGCGGGCCCGGGGAAGCGGG + Intronic
942890499 2:180981018-180981040 GGCGGCGGCGGTGGGGGAGGGGG + Intronic
944221682 2:197310288-197310310 GGCCGCGGGCCCGGCGGGGCTGG - Intronic
944221806 2:197310734-197310756 GGCGGCGGCGGAGGAGGAGCAGG - Exonic
944715906 2:202376178-202376200 GGCGGCGGCGGCGGCGGCGCCGG - Intergenic
945189027 2:207166927-207166949 GGCGGCGGCGCCCGCGGGGCGGG - Intronic
945648937 2:212537139-212537161 GGCGGCGGCGGCGGCGGAGCGGG + Intronic
945649133 2:212538051-212538073 GACCGCGGCCCCGGCGGTGCGGG + Intronic
946404369 2:219484594-219484616 GGCGGGGACCCCGCTGGAGCTGG + Exonic
946421950 2:219570359-219570381 GGCGGCGGTCCGGGAGCAGCGGG + Exonic
946692405 2:222319476-222319498 GGCGGCGGCTGCGGTGGGGCGGG + Intergenic
946692442 2:222319573-222319595 GGAGGCGGTCCTGGGGCAGCGGG + Intergenic
947353640 2:229271340-229271362 GGCGGCGGCGGCGGGGGAGGAGG - Intergenic
948116007 2:235494581-235494603 CGCCGCAGCCCCCGGGGAGCCGG - Exonic
948479237 2:238239907-238239929 TGCCGCGTCCCCGGCGGAGCGGG - Exonic
948492143 2:238320562-238320584 GGCGGCGGCGGCGGCGGGGCCGG + Exonic
948645370 2:239400853-239400875 GGCGGCGGCGGCGGCGGCGCGGG + Exonic
948801580 2:240435729-240435751 GGCGGCGGCGCGGGGCGCGCGGG - Exonic
948893139 2:240916565-240916587 GGCCGCGGCCCAGCTGGAGCCGG - Intergenic
949014387 2:241701551-241701573 GGCTGAGGCCCCGGGGGCTCGGG + Intergenic
1168769788 20:408005-408027 GGGGGCGGGGCCGGGGGGGCCGG - Intronic
1168811888 20:710024-710046 GGCCTCGGCCCCGGGGGACGCGG - Intergenic
1168855027 20:1002229-1002251 GGCGGCGGCACGGCGGGCGCGGG + Exonic
1168878210 20:1185422-1185444 GGTGGCGGCCGCTGGGGAGGCGG + Intronic
1169266848 20:4172265-4172287 GGCGGCGTCCCCGTCGCAGCTGG + Intronic
1169278460 20:4248806-4248828 GGCGGCGTGCCGGGGGGCGCGGG - Exonic
1169557606 20:6767620-6767642 GGCCGCGGCCGGGAGGGAGCCGG + Intergenic
1170150417 20:13221462-13221484 GGCGGCGGCGGCGGCGGAGACGG - Intergenic
1170150451 20:13221558-13221580 GGCGGCGGCGGCGGCGGCGCCGG + Intergenic
1170150498 20:13221705-13221727 GGCGGTGACGCCGGGGGAGGAGG - Intergenic
1170578685 20:17682263-17682285 GGCGGCGATCCCGGCGGAGGGGG - Exonic
1170890038 20:20368694-20368716 GGCGGCGGCGCGAGCGGAGCTGG + Exonic
1170991188 20:21303253-21303275 GGCGCCGCCGCCGGGGAAGCTGG - Intergenic
1171346351 20:24469312-24469334 GGCGCGGGCCCCGGGGGAGGAGG - Exonic
1172037338 20:32019236-32019258 GGCGGCGGCGGCGGCGGCGCGGG + Exonic
1172284619 20:33732059-33732081 GGCGGCGGGGCCGGCGGAGGCGG + Intronic
1172359610 20:34303004-34303026 CGCGGCGGCCCCGGCGTCGCGGG + Intronic
1172446815 20:34997502-34997524 GGCGGAGGGCGCGGCGGAGCTGG + Exonic
1172446819 20:34997511-34997533 CGCGGCGGAGCTGGGGGAGCAGG + Exonic
1172698075 20:36835844-36835866 GGCGGCGGCGGCGGGGAGGCGGG - Intronic
1173704257 20:45098510-45098532 GGCCGCGGCGTCGGAGGAGCAGG - Exonic
1173930133 20:46811325-46811347 GGCGGGGGCCCGGGGGGTGGGGG - Intergenic
1174042427 20:47709350-47709372 GGCGACTGCCCCTGGGCAGCAGG + Intronic
1174317458 20:49713748-49713770 GGCGGCGGCCCAGGAGGCGGCGG - Exonic
1174386661 20:50191517-50191539 GGCGGCGGCGGCGGGGGCGGTGG - Exonic
1174467765 20:50731007-50731029 GGCGCGAGCCCCGGCGGAGCCGG + Intergenic
1174494707 20:50931241-50931263 GGCGGCGGCCGGGGGGGGGGGGG + Intergenic
1174607013 20:51768404-51768426 GGCGGCGGCCCAGGCGGCGCGGG - Exonic
1174607049 20:51768480-51768502 GGCGGCGGCAGCGGGCGGGCCGG + Exonic
1174611659 20:51802279-51802301 GGCGCCCGCGGCGGGGGAGCTGG - Exonic
1174656388 20:52175847-52175869 GGGGGCGGCAGCGGGGGTGCGGG - Intronic
1175016333 20:55795193-55795215 GGCAGGGGCGCGGGGGGAGCAGG - Intergenic
1175429098 20:58890239-58890261 GGCGGCGGCCTCGGGGCATCGGG - Intronic
1175429104 20:58890254-58890276 GGCGGCGGCCGCGGCGGCGGCGG - Intronic
1175429280 20:58890998-58891020 GGAGGAGGCCTCGGGGGCGCCGG + Intronic
1175847112 20:62065016-62065038 GGCGGCGGGCGCGGGGGCGGCGG + Exonic
1175847242 20:62065382-62065404 GGCGGCGGGCACCGGGGCGCAGG + Exonic
1175856450 20:62123091-62123113 GGGGGCGGCACCGCGGGGGCCGG - Intronic
1175892139 20:62320639-62320661 GGCGGGGGCCCAGGGGGCTCCGG + Exonic
1175997245 20:62817328-62817350 GGCGGCGGCGCCGGCCGACCCGG - Intronic
1176016854 20:62938264-62938286 GGCGGCGGGCCCGGGCGGCCGGG + Intronic
1176062317 20:63177826-63177848 GGCGGCGGCGCGGGAGGCGCAGG + Intergenic
1176077360 20:63254511-63254533 GGCTGCGGCGCGTGGGGAGCGGG - Exonic
1176125061 20:63471590-63471612 GGCGTCGGCGCCGAGGGGGCAGG + Intronic
1176184550 20:63771225-63771247 GCCGGCGGCCCCCGGGGCTCAGG + Intronic
1176234889 20:64049567-64049589 GGCGGCGGGCACTGGGGAGCCGG + Exonic
1176286803 21:5022833-5022855 GGCGGAGGCGCCGGGGCGGCCGG + Intronic
1176576575 21:8443306-8443328 GGCGGCGGCGGCGGGGGTGTGGG + Intergenic
1178680462 21:34669422-34669444 TCCGGCGGCCCCTGGGGACCCGG - Exonic
1178992690 21:37367854-37367876 GGCCGCGGCCTCCCGGGAGCCGG + Intronic
1179150843 21:38806585-38806607 GGCGCCGGGCCCGGAGGATCTGG + Intronic
1179175492 21:39005077-39005099 GGCGGGGGGCCCGGGGGGGCAGG + Intergenic
1179511825 21:41878821-41878843 GGCGGGGGCCGCGGGGCCGCGGG + Exonic
1179794875 21:43776752-43776774 GGTCCCGGCCCCGCGGGAGCAGG + Intergenic
1179870378 21:44240642-44240664 GGCGGAGGCGCCGGGGCGGCCGG - Intronic
1180110333 21:45644307-45644329 GGCGGCCGTCCAGGGGGAGGAGG - Intronic
1180174687 21:46081886-46081908 GCCGGCGGCTCCCAGGGAGCAGG + Intergenic
1180174970 21:46082963-46082985 GGAGGGGGCCCCTGGAGAGCTGG + Intergenic
1180177807 21:46098645-46098667 GGCGGCGGGGCGGGGGGAGGAGG + Intronic
1180414140 22:12693504-12693526 AACGGAGGCCCCAGGGGAGCTGG - Intergenic
1180875845 22:19174992-19175014 GGCAGCTGCCCTGGGGCAGCAGG - Intergenic
1180908375 22:19431594-19431616 CGCGGCGGCCCTGAGGGCGCGGG - Exonic
1180960685 22:19761042-19761064 GGCGGCGGGCCCGGGGCGCCGGG - Exonic
1180980504 22:19876110-19876132 GGAGGCGGCCACGGTGAAGCAGG + Intronic
1181162046 22:20965147-20965169 GGCCGCGGGCGCGGGGGGGCGGG - Exonic
1181934617 22:26429600-26429622 GGCGGCGGCGGCGGCGGCGCCGG - Intronic
1182903772 22:33920210-33920232 GGCAGCGGCCCCGGAGGAAGAGG - Exonic
1183050688 22:35258006-35258028 GGCCGCGGCCACGGGAGGGCTGG + Intronic
1183149768 22:36028473-36028495 GGCCGAGGCCCAGGGGGAGGTGG - Intergenic
1183232794 22:36593369-36593391 GGCGGCGGCCATGAGGGAGTCGG + Intronic
1183386742 22:37519385-37519407 GGCGGCGGCTCCGCCGGCGCAGG + Exonic
1183466714 22:37983817-37983839 GGCGGCTGGCCCGGGGGAGGCGG - Exonic
1183524747 22:38316728-38316750 GGCGCCGGGGCCGGGAGAGCAGG + Intronic
1183667242 22:39253123-39253145 GGCGCCGGCCCCAGCCGAGCAGG + Intergenic
1183720173 22:39557873-39557895 GGCGGCGGGCCCGGGGGCCCGGG - Intergenic
1184207522 22:43014732-43014754 GGGGGCGGCGCTGTGGGAGCGGG - Intronic
1184265321 22:43343181-43343203 GGCGGCTGGCCGGGGGCAGCGGG - Exonic
1184664192 22:45978734-45978756 GGCGGCGGCACTGAGGGAGCTGG + Intergenic
1184712884 22:46263323-46263345 GGCGCCGGCCCAGGAGAAGCTGG + Exonic
1184766959 22:46577150-46577172 GGAGGCGGCCCCGCGGGTCCCGG - Intronic
1185108735 22:48888988-48889010 GGCGTCGGCCCCACGGGAGCCGG + Intergenic
1185272790 22:49936400-49936422 GTGGGCGGGCCTGGGGGAGCTGG - Intergenic
1185296703 22:50058289-50058311 GGCGGCGGCCCCGGGGCGTGGGG + Intergenic
1185296720 22:50058322-50058344 GGCGGGGGGCGCGGGGGCGCGGG + Intergenic
1185413430 22:50697574-50697596 GGCGGCGGTGCGGGGGGCGCAGG - Intergenic
1203254625 22_KI270733v1_random:132364-132386 GGCGGCGGCGGCGGGGGTGTGGG + Intergenic
1203262681 22_KI270733v1_random:177443-177465 GGCGGCGGCGGCGGGGGTGTGGG + Intergenic
949540197 3:5026623-5026645 GCAGGCGGTCCCCGGGGAGCTGG + Intergenic
950168026 3:10816206-10816228 CGCCGCCGCCCCGGGCGAGCTGG - Exonic
950215279 3:11154467-11154489 GGGGGCGGCGGCGGGGGCGCCGG - Intronic
950264071 3:11561816-11561838 AGAGGCTGCCCCGGGGGAGAGGG + Intronic
950487805 3:13283112-13283134 GGGGGCGGCGCCGGCGGAGGCGG - Intergenic
950509829 3:13419694-13419716 GGAGGGGGCGCCGGGGCAGCTGG - Intronic
951078571 3:18425346-18425368 GGCGGCGGCGGCGGCGGAGGAGG + Intronic
951078572 3:18425349-18425371 GGCGGCGGCGGCGGAGGAGGAGG + Intronic
951208326 3:19947271-19947293 GGCGGCGGCGGCGGCGGAGGAGG + Exonic
953705152 3:45225527-45225549 GGCGGCGGCGCTGGGGGCGGCGG + Exonic
953909287 3:46883522-46883544 GGCGGCTGCCCCGAGGGACGCGG + Exonic
954281816 3:49585543-49585565 GGCGGCGGACCGGGTGGAGGAGG - Intronic
954402831 3:50328020-50328042 GGCGGCGGCTCAGAGGCAGCAGG - Exonic
954539698 3:51385299-51385321 GGCGGCGGCAGCGGAGGAGGAGG + Exonic
954613481 3:51958143-51958165 GGCGGCGGCCCTGGGGAAGCAGG + Exonic
954686005 3:52370642-52370664 GCCGGCGGCCCCCAGGGACCAGG + Intronic
959462504 3:106644107-106644129 GGGAGCGGGCGCGGGGGAGCAGG - Intergenic
959539410 3:107523284-107523306 GGCGGCGGCTCCGGACGCGCGGG - Intronic
959849711 3:111071957-111071979 GGCGCCGGGGCCGGGGGAGCCGG + Exonic
960896710 3:122514227-122514249 GCCGGCGGCCCGGAGGGAGGTGG - Intronic
961202475 3:125055797-125055819 GCCGGCGGCCCCCGGGACGCGGG - Exonic
961665888 3:128492915-128492937 GGCGGCGCCCCCGGGCGGACGGG + Exonic
961698839 3:128726204-128726226 GGCGGCGGCAGCGGCGGAGTTGG + Exonic
961827163 3:129605276-129605298 GGCGGCGGCGGCGGGGGCGGGGG - Intronic
962277953 3:134030033-134030055 GGCGGCGGCGGCGGCGGGGCGGG - Exonic
962750999 3:138434815-138434837 GCTGGGGGCCCCGGGGGCGCAGG - Exonic
963038381 3:141051397-141051419 GGCGGCGGCGGCGGAGGAGGGGG + Exonic
963133214 3:141876942-141876964 GGCCTCGGTCCCGGGGGCGCCGG + Intronic
963827505 3:149970930-149970952 GGCGGCGGCGCGGGGGGAGGCGG + Exonic
966787837 3:183636450-183636472 TGCGGCCGTCCCCGGGGAGCCGG + Intronic
966868557 3:184276012-184276034 GGGGGCGGCCGCGGCCGAGCGGG + Intronic
966874675 3:184315178-184315200 GGCGGCGGCCGTCGAGGAGCCGG - Intronic
967055174 3:185824557-185824579 GGCTGCGGCCCCGAGGGCGAGGG + Intronic
967087620 3:186108964-186108986 TGCAGCGGCCCCGGCGGCGCAGG + Exonic
967263579 3:187670153-187670175 GGCTGCTGCCGCGGGGAAGCAGG - Exonic
968044975 3:195618897-195618919 AGTGGCAGCCCCGAGGGAGCTGG + Intergenic
968060759 3:195724949-195724971 AGTGGCAGCCCCGAGGGAGCTGG + Exonic
968178172 3:196568990-196569012 GGCGCCGGCCCCGGGGGCTGGGG + Exonic
968479196 4:826276-826298 GGAGGCGGACCCGGGGGCGGGGG + Intergenic
968674710 4:1871338-1871360 GGCGGCGGCCCCGGCTGCGGCGG + Intergenic
968689794 4:1984565-1984587 GGCAGCGGCCCCAGGGGACACGG - Intronic
968702111 4:2062132-2062154 GGCCACGGCCCAGAGGGAGCAGG - Intronic
968728762 4:2260124-2260146 GCCTCAGGCCCCGGGGGAGCGGG + Intronic
968874057 4:3255973-3255995 GGCGGCGGCGGCGGCGGGGCCGG + Exonic
968879854 4:3293224-3293246 GGCGGCGACCCCGAGGGGACGGG - Intronic
968889719 4:3362041-3362063 GGCTGCGGCCCCGAGGGGGATGG + Intronic
968965115 4:3765823-3765845 GGCCGCGGGCCCTGGGGAGCTGG - Intergenic
969257448 4:6011838-6011860 GGCGGCGCTGCAGGGGGAGCTGG - Intergenic
970202899 4:13627541-13627563 GGCGGCGGCGCCGGAGGAGGCGG + Exonic
970333017 4:15003730-15003752 GGCGGCGGCGGCGGGGGCGGGGG + Exonic
970823944 4:20252003-20252025 GGCGGCGGCGGCGGCGGAGGCGG + Intergenic
971457810 4:26860798-26860820 GGCGGCGGCGGCGCGGGAGCTGG + Intronic
973279220 4:48341716-48341738 GGCGGCGGCGGCGGCGGGGCCGG + Exonic
973613679 4:52659304-52659326 GGCGGCGGCGCGGGGAGGGCGGG + Exonic
973759062 4:54100573-54100595 GGCGCCGGCAGCGGGGGCGCAGG + Exonic
975778968 4:77819626-77819648 GGCGGCGGCGACGGGGCGGCTGG + Intergenic
976167907 4:82274874-82274896 GGTGGCAGCCCCCAGGGAGCCGG + Intergenic
976297253 4:83484877-83484899 CGCGGCGGCGTCGGGGGAGCGGG + Intronic
977230999 4:94451769-94451791 GGCGGCGGCGCCGGGCGCTCGGG - Intergenic
977536527 4:98261285-98261307 GGCGGCGGAGGCGCGGGAGCCGG - Intergenic
977810065 4:101347529-101347551 GGCGGCGGCGGCGGCGGAGGGGG - Intronic
977908244 4:102501513-102501535 GGCTGCGGCCTCGGCGGCGCTGG - Exonic
978072574 4:104491423-104491445 GGCGGCGGCGGCGGCGGAGGCGG - Exonic
978515039 4:109560401-109560423 GGCAGCGGCCACGGGCGCGCTGG - Exonic
979565729 4:122152417-122152439 GGCGGCGGCCCCGGGCGGCGGGG + Exonic
980990492 4:139735062-139735084 GGCGGGGGCCGCGGAGGGGCGGG - Intronic
981034217 4:140153146-140153168 TGCGGCGGCTCCGGGGGCCCCGG - Exonic
981366665 4:143912141-143912163 GGCGGCGGCGCCGGCGGAGGTGG - Intergenic
983920146 4:173335278-173335300 GGGGGCGGGGCCGGGGGAGAAGG - Intergenic
984639056 4:182143638-182143660 GGAGGCGGCCCTGGGGGAGGGGG - Intergenic
984668071 4:182449103-182449125 GGCGGCGGCCTGGGGCGGGCTGG + Intronic
984734932 4:183099626-183099648 GGCGCCGGCCGCGGGGGCGCGGG + Intronic
984973436 4:185209961-185209983 AGCGGCGGCGCCGGGGGCCCCGG + Intronic
985173203 4:187174189-187174211 GCAGGCAGCCCCGGAGGAGCAGG - Intergenic
985451452 4:190065818-190065840 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
985452441 4:190069110-190069132 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
985453426 4:190072407-190072429 AACGGAGGCCCCGGGGGAGCTGG + Exonic
985454416 4:190075700-190075722 AACGGAGGCCCCGGGGGAGCTGG + Exonic
985455404 4:190078993-190079015 AACGGAGGCCCCGGGGGAGCTGG + Exonic
985456389 4:190082287-190082309 AACGGAGGCCCCGGGGGAGCTGG + Exonic
985457376 4:190085587-190085609 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
985458363 4:190088880-190088902 AACGGAGGCCCCGGGGGAGCTGG + Exonic
985459352 4:190092180-190092202 AACGGAGGCCCCGGGGGAGCTGG + Exonic
985463604 4:190174949-190174971 AACGGAGGCCCCGGGGGAGCTGG + Exonic
985652009 5:1111765-1111787 GGCGGCGGGGCCGGGGGTACAGG - Intronic
985943175 5:3155278-3155300 GGTGGCCACCCAGGGGGAGCAGG - Intergenic
986321154 5:6633498-6633520 GGCGGCGGCGCGGGGGCAGGAGG - Exonic
986321288 5:6633989-6634011 GGGGGACGCCCCGGGGGATCTGG - Intronic
986330493 5:6713584-6713606 GGCGGCGGGGCCGAGGGGGCGGG - Intergenic
986392875 5:7301724-7301746 GGCTGCAGCCCCGGGGGTGTGGG - Intergenic
986813663 5:11385168-11385190 GGCGGCGGCGGCGGCGGCGCGGG + Exonic
986858961 5:11904290-11904312 GGCGGCGGCACAGGTGGCGCGGG - Intergenic
988609541 5:32711864-32711886 GGCGGCGGCGGCGGTGGCGCGGG + Exonic
989011537 5:36877201-36877223 GGCGGCGGCGGCGGCGGCGCCGG + Intronic
990410166 5:55534381-55534403 AGCGGCGGGCACGCGGGAGCCGG + Intronic
991054431 5:62306281-62306303 GGCGGAGGCCCCGGGCCTGCAGG - Intronic
992067399 5:73120499-73120521 CGCGGCGGCCCGGGGAGGGCAGG - Exonic
992104419 5:73437671-73437693 TGCCGGGGCCCCGGGCGAGCGGG + Intergenic
992105481 5:73447073-73447095 CGCGGCGGCCACGAGGGATCGGG + Exonic
992105722 5:73448034-73448056 GGCGGCGGCGGCGGCGGCGCGGG - Exonic
992105751 5:73448082-73448104 GGGGCCGGGCCCGGGGGCGCCGG + Exonic
993900974 5:93584312-93584334 GGCGGCGGCGGCGGAGGAGGAGG - Exonic
993900975 5:93584315-93584337 GGCGGCGGCGGCGGCGGAGGAGG - Exonic
994353891 5:98774093-98774115 GGCGGCGGCAGCGGCGGCGCTGG - Exonic
996398563 5:123036305-123036327 GGGGGAGACCCTGGGGGAGCTGG - Intronic
996978488 5:129461455-129461477 GGGGGCGGCTGCGGGGGAGGCGG - Exonic
997305047 5:132830568-132830590 CGCGGCGGGGGCGGGGGAGCGGG - Intronic
997732786 5:136193013-136193035 GGCGGCGGCGCCGGAGGACGCGG - Intergenic
999462612 5:151770643-151770665 GGCCTCGGCCTCTGGGGAGCCGG - Exonic
1001065055 5:168529538-168529560 GGGGGCGGCCGCGGGGGCGGCGG + Exonic
1001561260 5:172670343-172670365 CGCGGCGCCCCCTGGGGACCTGG + Intronic
1001688741 5:173616405-173616427 GGCGGCGGCGGCGGGGGAACTGG - Exonic
1001920714 5:175597180-175597202 GTCCCAGGCCCCGGGGGAGCAGG - Intergenic
1002082162 5:176743576-176743598 GGGGCCAGCCCCGGGGGTGCGGG - Intergenic
1002211129 5:177600074-177600096 AGCGGCGGACCCGGCGGACCGGG + Intergenic
1002261027 5:177994231-177994253 GGTGGCGGCGCCGGGAGTGCGGG + Exonic
1002591095 5:180292047-180292069 GGCGGCGGCAGCGGCGGAGAAGG - Exonic
1002597263 5:180332236-180332258 GGCGGGGGGGCGGGGGGAGCAGG + Intronic
1002887826 6:1312043-1312065 TGCGGCGGCTCCGCGGGGGCGGG - Intergenic
1002897998 6:1390176-1390198 GGCGGCGGCGGCGCGGGCGCCGG + Exonic
1002898812 6:1393923-1393945 GGGAGCCGCCCCGGGAGAGCAGG + Intronic
1002927245 6:1611568-1611590 GGCGGCGGCGGCGGCGGCGCGGG + Exonic
1002927249 6:1611577-1611599 GGCGGCGGCGCGGGGGCCGCGGG + Exonic
1003097997 6:3157309-3157331 CGCGGCGGCCCCGGGCTGGCCGG - Intronic
1003234275 6:4281945-4281967 GGGGACTGCCGCGGGGGAGCAGG - Intergenic
1003425753 6:5997234-5997256 TGCGGGGGCCCCGGGGGGGGGGG - Intergenic
1003840388 6:10113407-10113429 AGCGGGGGCGCCGGGAGAGCCGG + Intronic
1003872250 6:10412527-10412549 GGGGGAGGCCGCGGGGGAGGGGG + Intronic
1003995634 6:11537609-11537631 GGCGGCGGGTCGCGGGGAGCGGG + Intergenic
1004044477 6:12011849-12011871 GGGGGCGTCCCCGCGGGGGCTGG - Intronic
1004216909 6:13711687-13711709 GGCGGCGGGCCCGGGAGGCCGGG + Intergenic
1004504726 6:16238650-16238672 GGCGGCGGCGACGGCGGGGCGGG - Exonic
1004561869 6:16760229-16760251 GGCGGCGGCCGCCGCGGAGGAGG - Intronic
1004615141 6:17281790-17281812 GGCGGCTGACCCCGGGGATCGGG + Intronic
1004690437 6:17987996-17988018 GGGGGGGGCCCCGCGGGCGCCGG - Intergenic
1004924048 6:20402357-20402379 GGCGGCGGCGGCGGCGAAGCCGG - Exonic
1005288995 6:24359998-24360020 GGCGCCGGCCGCGCGGGGGCGGG + Intergenic
1005825151 6:29627916-29627938 GGCGAGGGCCCCGGAGAAGCAGG + Intronic
1005847565 6:29793115-29793137 GGAGGCGGCCCGGGGGGCGGAGG + Intergenic
1006137216 6:31902313-31902335 GGGGGCGGGCCCGAGTGAGCGGG - Intronic
1006154819 6:32008350-32008372 GGCTGCAGCCCCGGGGGATGGGG + Intergenic
1006161131 6:32041085-32041107 GGCTGCAGCCCCGGGGGATGGGG + Exonic
1006342877 6:33456169-33456191 GGTGGAGGACCTGGGGGAGCAGG + Exonic
1006535657 6:34696803-34696825 GGCGGCGGAGGCGGCGGAGCTGG - Exonic
1006938171 6:37732921-37732943 AGCGGCGGGGCGGGGGGAGCGGG - Intergenic
1007625338 6:43243495-43243517 GGCGGCGGCAGCGGCAGAGCGGG - Intergenic
1007643580 6:43363473-43363495 GGCAGAGGCCCCGGGGGCCCTGG + Intronic
1008092749 6:47309368-47309390 GGCGGCGGCGCCGGAGCAGAAGG - Intronic
1008630511 6:53359438-53359460 GGTGACCGCCGCGGGGGAGCGGG - Intergenic
1008649029 6:53544813-53544835 GGCGGCGGCCCCTGGCGCCCAGG + Exonic
1009355680 6:62740749-62740771 GGCGGGGCGCCCGTGGGAGCAGG - Intergenic
1009437566 6:63635829-63635851 TGCGGCGGCGGCGCGGGAGCTGG - Exonic
1009540802 6:64955735-64955757 TGCAACGTCCCCGGGGGAGCGGG + Intronic
1010032871 6:71288743-71288765 GGCGGCGGTCCCGGGGCCGCCGG + Intergenic
1010032914 6:71288905-71288927 GGCGGCGGGCGCGGGGCTGCGGG - Exonic
1012400000 6:98835075-98835097 GGCGGCGGCGGCGGGGGCGGTGG + Exonic
1012410219 6:98947967-98947989 AGCGGCGGGCCCGGGGAGGCGGG + Intronic
1013048823 6:106512400-106512422 GGCGTCCGCGCCGGGGGAGTCGG - Exonic
1013099480 6:106974867-106974889 GGCGGCGGCGGCGGGGGCGCTGG - Intronic
1013155865 6:107490531-107490553 GGCGGCGGCGGCGGTGGAGGTGG - Exonic
1013619286 6:111872883-111872905 GGCGGCGTGCGCGGGGGCGCCGG + Intronic
1013793619 6:113860201-113860223 GGGCGCGGCCTCCGGGGAGCAGG + Exonic
1013793626 6:113860222-113860244 GGCAGCGGCGCCGGGCGAGGAGG + Exonic
1014019523 6:116571477-116571499 GGCGGCGGCCAGGCGGGCGCAGG - Exonic
1014029109 6:116681106-116681128 GGCGGCGGCGGCGGCGGAGGAGG - Intergenic
1014137534 6:117907170-117907192 GGCGGCGGCGGCGGCAGAGCGGG - Intergenic
1014913358 6:127118764-127118786 GGCGGGGGCCCCTGGAGCGCAGG - Exonic
1015149274 6:130020001-130020023 GGCGGCCGCGCCGGGGCGGCGGG + Intronic
1015965590 6:138693083-138693105 GGCGGCGGCCGCGGCGGCGAGGG + Intergenic
1016010768 6:139135549-139135571 GGCGGCGGCGGCGGGCGCGCCGG + Exonic
1016738551 6:147506824-147506846 GGCGGCGGCCCGCGCGGGGCGGG + Intergenic
1016739075 6:147509166-147509188 GCGGGCGGCCCGGGGGGCGCCGG - Exonic
1016923498 6:149317972-149317994 GGCGGCGGCCGAGGAGGAGGAGG + Intronic
1017671969 6:156777704-156777726 GGCGGCGGCGGCGGCGGCGCGGG + Intergenic
1017671971 6:156777710-156777732 GGCGGCGGCGGCGCGGGCGCGGG + Intergenic
1017672287 6:156778857-156778879 GGCGGCGGCGGCGGCGGAGGAGG + Exonic
1017672288 6:156778860-156778882 GGCGGCGGCGGCGGAGGAGGAGG + Exonic
1017672311 6:156778949-156778971 GGCGGCGGCCGCGGCGGCGGCGG + Exonic
1017672419 6:156779297-156779319 GGCGGCGGCGGCGGGGGCGGCGG + Exonic
1018804487 6:167248402-167248424 GGCGACGGCCCCGGGCGCCCAGG + Intergenic
1019088295 6:169502082-169502104 GGCAGCCGCCCCGGGGCTGCGGG + Intronic
1019166899 6:170103092-170103114 GGCCCTGGCCCCGGGGCAGCAGG - Intergenic
1019175801 6:170158913-170158935 CGCTGCGGCCCCGTGGGGGCAGG + Intergenic
1019279300 7:192236-192258 GGCGGCGGCCCCGGGCGGGAGGG + Intergenic
1019323282 7:425166-425188 AGCGGCCGCCCCTGGGGAGCGGG - Intergenic
1019378134 7:706983-707005 GGCGGCAGCCCTGGTGGAGAGGG - Intronic
1019578000 7:1746742-1746764 GGCGGTGGCCCGGGGGGCGCAGG - Exonic
1019711492 7:2520041-2520063 GGCGGCGGCGCCCGGGGCGCTGG + Exonic
1019732667 7:2636546-2636568 CACGGAGGCCCCCGGGGAGCTGG + Intronic
1019733228 7:2638619-2638641 AGCAGCGGCCACGTGGGAGCCGG - Intronic
1019743775 7:2688424-2688446 GGCGGCGGCTACGGGCGCGCGGG + Intronic
1020055659 7:5116349-5116371 GGCGGCTGCCCCCGTGGAGAGGG + Intergenic
1020275495 7:6622260-6622282 AGCGGCGGTCCCGGGGGCTCCGG + Exonic
1020278311 7:6637521-6637543 GGCGGCGGCGGCGGCGGGGCCGG + Intronic
1020418283 7:7969689-7969711 GGCCGCAGCCCCGGCCGAGCAGG + Exonic
1021451248 7:20785329-20785351 GGCGGCGGCGGCGGGGGCGGCGG - Exonic
1021452951 7:20798565-20798587 GTCGGCGGCCCGGGGCGAGGCGG - Intergenic
1021510592 7:21428336-21428358 CTCAGCGGCCCCGGGGGAGGGGG - Intronic
1021719263 7:23490479-23490501 GCCGGAGGCCCCGGGGGCCCTGG + Intergenic
1022097095 7:27147916-27147938 CGCCGCGGTCCCCGGGGAGCGGG - Intronic
1022101092 7:27169606-27169628 GGCGGCGGCAGCGGCGGAGGCGG - Intronic
1022363437 7:29685304-29685326 GGCGGCGGCCCTGGACGTGCGGG - Intergenic
1022396022 7:29989126-29989148 TGCGGCGGCCGCGGGCGAGTTGG + Intronic
1022427853 7:30285221-30285243 GGCGGCGGCCCTGGACGTGCGGG + Exonic
1022485129 7:30771821-30771843 GGCGGCGGCAGCTGGGGAGGGGG + Intronic
1023405801 7:39833217-39833239 GGCGGCGGCGGCGGCGGCGCTGG + Intergenic
1023638421 7:42236486-42236508 GGCGGCGGCCCCCGCGGCGGAGG + Intronic
1023810325 7:43906519-43906541 GCCGGCAGCCGCGGGGGCGCAGG + Intronic
1023937273 7:44748887-44748909 GGCGGCGGCCCCGGGGCGGCGGG + Intronic
1023955594 7:44884714-44884736 GGAGGCGGCGCCGGGGGCCCAGG - Exonic
1024043818 7:45574456-45574478 GGCGGCGGCGCCGGGGCGGGCGG - Intronic
1024579948 7:50793339-50793361 GGCGGCAGCGCCGGCGGCGCGGG - Intronic
1024639344 7:51316814-51316836 GGCGGGGGCGCCGGGAGCGCAGG + Intronic
1027260551 7:76461872-76461894 GGCTGCGGTCCCAGGGGCGCGGG + Intronic
1027311928 7:76959985-76960007 GGCTGCGGTCCCAGGGGCGCGGG + Intergenic
1028477285 7:91265658-91265680 GGCGGCTTCCCGGGGGGCGCCGG + Exonic
1028774046 7:94658145-94658167 GGGGGCGGCCCCGGGAGAGGCGG - Intronic
1029073335 7:97917529-97917551 GGCTGCAGCCCCGGCTGAGCTGG - Intergenic
1029447309 7:100620974-100620996 GGAGGTGGCCCCGGGGGTCCCGG + Exonic
1029467677 7:100736591-100736613 CCCGGGGGCCCCGGTGGAGCCGG - Exonic
1029737182 7:102471504-102471526 GGCGGCGGCCCAGGGGCTGCTGG - Intronic
1029746511 7:102518043-102518065 GGGGGCGCCCCTGGAGGAGCGGG + Intergenic
1029764448 7:102617022-102617044 GGGGGCGCCCCTGGAGGAGCGGG + Intronic
1029996757 7:105014162-105014184 GGCGGCGGCCGCGGCGGCGGCGG - Exonic
1030033444 7:105388919-105388941 GGCGGCGGCGGCGGCGGCGCAGG - Intronic
1030597990 7:111562317-111562339 GGCCCCGGCCCCGGCGGGGCGGG - Intronic
1030725771 7:112922891-112922913 GGCGGCTGGCCCGGGGGGGGGGG - Intronic
1030820728 7:114087629-114087651 GGCGGCGGCGCCGGCGGCGCGGG + Intronic
1031134834 7:117873337-117873359 GGCGGGGGCCGCGGCGGAGGCGG - Exonic
1031599750 7:123692534-123692556 GGCGGTGGCCCAGGAGGAGGTGG + Exonic
1031629889 7:124033144-124033166 GGCCGCGGTCCCGCGGCAGCGGG + Intergenic
1031982312 7:128135871-128135893 GGCGGCGCCCCAGCGGGAGCGGG + Intergenic
1031986553 7:128167714-128167736 GGCGGCTGGCGCGGGGGCGCGGG + Intergenic
1032013518 7:128361509-128361531 GGGGGCGGCTCAGGGGCAGCGGG - Intronic
1032074498 7:128830176-128830198 CGCGGCGGCACCGGGGGCCCAGG + Intergenic
1032239428 7:130149511-130149533 CCCGGCCGCCCCGGGGGAGCAGG - Intergenic
1033253015 7:139777336-139777358 GGCGGCTGCCCGGGGAGGGCAGG - Intronic
1033288739 7:140063254-140063276 GGCGGCAGCGCTGGCGGAGCCGG + Exonic
1033361258 7:140640513-140640535 GGCGGCGGCTCCGCGGGCTCTGG + Exonic
1033756853 7:144403439-144403461 GGCAGGGGGCGCGGGGGAGCGGG + Intronic
1034129073 7:148699065-148699087 GGCGGCGGCGGCGGCGGCGCAGG + Intronic
1034222994 7:149460164-149460186 GGCGGCGACTCCGGGGGCCCGGG - Intronic
1034276892 7:149827793-149827815 GCAGGTGGCCCCGGGGGAGCTGG + Intergenic
1034441404 7:151087568-151087590 CGCGGCGGCCAAGCGGGAGCGGG + Intronic
1034475100 7:151277076-151277098 GGCCGGGGTCCCGGGGGAGCAGG - Intronic
1034522618 7:151632308-151632330 GGCGGCGGCCTCGGGCGGGTGGG - Intronic
1034800567 7:154052989-154053011 GGCGGCGGCGGCGGCGGCGCGGG + Intronic
1034911531 7:155002569-155002591 GGCGGCGACCCCAGGGCCGCAGG + Intronic
1035203301 7:157279855-157279877 GGCGGGGGGCCCGGAGCAGCCGG - Intergenic
1035270097 7:157714745-157714767 GGCGCCGTTCCCTGGGGAGCTGG - Intronic
1035270141 7:157714963-157714985 GGCGCCGTTCCCTGGGGAGCTGG - Intronic
1035341621 7:158166299-158166321 CGCGGCGGCCGGGGGGGAGGAGG - Intronic
1035431787 7:158828709-158828731 GGCGGCGGCCCCAGGCGGACAGG + Intronic
1035754929 8:2023874-2023896 GGCCTCGGGCCCGCGGGAGCTGG + Intergenic
1035759505 8:2059064-2059086 GGCAGCAGGCGCGGGGGAGCTGG + Intronic
1035905569 8:3506211-3506233 GGAGACGGCCCTGGGGGAGAGGG + Intronic
1036789495 8:11708653-11708675 GGCGGCGGCCGCCAGGGACCCGG - Exonic
1037262894 8:17027489-17027511 GGCGGCGGCCGGCGGGGGGCTGG + Exonic
1037762391 8:21750557-21750579 CGCGGCAGCCCCGGTGGTGCTGG - Intronic
1038828467 8:31032901-31032923 CGCTGCGGCGCCGGGGGAGCCGG - Exonic
1038828498 8:31032993-31033015 GGGAGCGGCCCCGGGGGCGGCGG - Exonic
1038828552 8:31033184-31033206 AGCGGCGGCGGCGGGGGAGGAGG - Exonic
1038883510 8:31639667-31639689 GGCGGCGGCGCGGGGGGTGGGGG + Intronic
1039454234 8:37697063-37697085 AGCGGGGGCGCCCGGGGAGCTGG - Intronic
1039903109 8:41767100-41767122 GGCTGCGGCCGCGGAGGGGCTGG - Intronic
1039921462 8:41896789-41896811 GGCGGCGGCGGCGGCGAAGCGGG + Intergenic
1041689926 8:60678794-60678816 GGCGGCGGCGGCGGCGGCGCGGG + Exonic
1042785090 8:72537372-72537394 GGCGGCGGCCGCGGGGGCGGAGG - Exonic
1043388253 8:79768314-79768336 GGCGGCGGCGGCGGCGGCGCTGG + Intergenic
1043502953 8:80874316-80874338 GGCGGCGGCGGCGGCGGAGGCGG - Intronic
1044115265 8:88327574-88327596 GGCGGCGGCGGCGGAGGAGGAGG - Intronic
1044115266 8:88327577-88327599 GGCGGCGGCGGCGGCGGAGGAGG - Intronic
1044685696 8:94823570-94823592 GGCGCCTGCACCTGGGGAGCGGG + Intronic
1045222507 8:100213005-100213027 CGCGGAGGCCGCGGGGGTGCAGG - Intronic
1045516291 8:102863621-102863643 GGCGGCGGCGGCGGCGGGGCTGG - Intronic
1045582971 8:103499925-103499947 GGCGGCGGCGCAGGGCGCGCGGG + Intergenic
1046659969 8:116938489-116938511 GGCGGCGGCGGCGGCGGCGCGGG + Exonic
1046770369 8:118111698-118111720 GGCGGCGGCGGCGGCGGCGCTGG + Exonic
1047423851 8:124728289-124728311 GGCGCTGGCCCCGGGTCAGCGGG - Intronic
1048214129 8:132480471-132480493 GGCGGCGGCGACGGGGGCGGCGG - Exonic
1048980890 8:139703081-139703103 GGCGGCGGCGGCGGAGGAGGAGG - Intergenic
1048980891 8:139703084-139703106 GGCGGCGGCGGCGGCGGAGGAGG - Intergenic
1049004615 8:139846813-139846835 GGAGGAGGCCCAGGGTGAGCAGG + Intronic
1049109853 8:140635792-140635814 GGCGGCGGCGGCGGCGGCGCCGG + Intergenic
1049145972 8:141001241-141001263 GGCGGCGGCGGCGGCGGCGCGGG + Intronic
1049419473 8:142510570-142510592 GGCGCGGGCCCCGGAGGAGCTGG + Intronic
1049452554 8:142669932-142669954 GGCGGCTGCTCCGGGTGAGCAGG - Exonic
1049585125 8:143429427-143429449 CGGGGCGGCCCCGGGAGCGCGGG - Exonic
1049585296 8:143430153-143430175 GGCGGCGGCGCGGGGGGCGGCGG - Exonic
1049585400 8:143430495-143430517 GGCGGCGGTCCCGGCGGGGGCGG + Intergenic
1049665539 8:143841107-143841129 GGCGGGGCCTCCGGGGGGGCGGG - Intergenic
1049689784 8:143953443-143953465 GGCGGCGGCGGCGGCGGGGCGGG - Intronic
1049766874 8:144358997-144359019 CGCTGCGGCCCCAGGGGAGGAGG - Exonic
1049788480 8:144462513-144462535 GGCGGCGGCTCTGGGCGAGGCGG - Intronic
1049818264 8:144618644-144618666 GGCGGCAGCCCCGGCAGAGGGGG - Intergenic
1050137315 9:2479926-2479948 GGCGGCGGCAGTGGGGGAGGAGG + Intergenic
1051206372 9:14693309-14693331 GGCGGCGGCGCCGGAGGAGGCGG - Exonic
1052362155 9:27573205-27573227 GGCGGCGGCGGCGGCGGCGCAGG - Intronic
1052494937 9:29213492-29213514 GGCGGCGGCGCCAGGTGAGGAGG + Intergenic
1052888874 9:33677136-33677158 GGCGGCGCCCCCGGTGGCCCCGG - Intergenic
1052903986 9:33817729-33817751 GGCGGCGGCGGCGGCGGCGCCGG - Exonic
1053725157 9:40992021-40992043 GGCGACGGTCCCGTGGGGGCGGG - Intergenic
1053785851 9:41652311-41652333 GGCAGCGGCCCCGGGAGATGGGG - Intergenic
1054159191 9:61661866-61661888 GGCAGCGGCCCCGGGCGATGGGG + Intronic
1054174567 9:61866274-61866296 GGCAGCGGCCCCGGGAGATGGGG - Intergenic
1054449424 9:65395322-65395344 GGCAGCGGCCCCGGGAGACGGGG - Intergenic
1054478965 9:65592871-65592893 GGCAGCGGCCCCGGGCGATGGGG + Intergenic
1054662971 9:67714517-67714539 GGCAGCGGCCCCGGGAGATGGGG + Intergenic
1054762326 9:69014137-69014159 GGCGGCGGCAGCGGCGGAGATGG + Intergenic
1054835550 9:69672169-69672191 GTCCGCGGGCCCGCGGGAGCAGG + Exonic
1055315191 9:75027938-75027960 GGCGGCGGACCCGCCGGAACGGG - Intronic
1056682805 9:88733882-88733904 CGCGGCTGTCCCAGGGGAGCAGG + Intergenic
1057245592 9:93451856-93451878 GGCGGCGGGGCCGGGGGTGGTGG - Exonic
1057488633 9:95506099-95506121 GGCGGCGGGCCCGGGGCCCCCGG + Intronic
1057600048 9:96450123-96450145 GGCGGCGGCGCCGCGGGGGCGGG + Intergenic
1059251509 9:112891041-112891063 CCCGTCGGCCCCGGGGGTGCTGG - Intergenic
1059299785 9:113303055-113303077 GGAGGCGGCTCCGAGGGAGCAGG - Intronic
1059375218 9:113876128-113876150 GGCGGCGGCCCCGCGAGGGGCGG + Intergenic
1059395692 9:114032777-114032799 CGCGGCTGCCAGGGGGGAGCGGG - Intronic
1059455673 9:114398564-114398586 GGGGGCGGCCCGGGGGGGGCGGG + Intergenic
1059483717 9:114611540-114611562 GGCGGCGGCGGCGGCGGCGCGGG + Exonic
1060389869 9:123268467-123268489 GGCGGCGGCGGAGCGGGAGCGGG - Intronic
1060389871 9:123268473-123268495 GGTGGCGGCGGCGGCGGAGCGGG - Intronic
1060558354 9:124521865-124521887 GCTGGGGGCCCCGAGGGAGCTGG + Exonic
1060770173 9:126326812-126326834 GGCGGCGGCGGCGGAGGGGCGGG - Intergenic
1060814068 9:126625699-126625721 GGCGGCGGCGGCGGCGGAGGTGG - Intronic
1061190758 9:129081289-129081311 GGAGGGGGCGCCGGGGGACCGGG + Intronic
1061192966 9:129092983-129093005 GACAGCGGCCCCAGGAGAGCAGG - Intergenic
1061293597 9:129665841-129665863 GCGAGCGGCCCCGGGGGGGCCGG - Exonic
1061321823 9:129835631-129835653 GGCGGCGGCCGGGGGGGTCCCGG - Intronic
1061455323 9:130693282-130693304 TGCGGCCGCCCCGTGGGTGCTGG - Intergenic
1061610036 9:131740017-131740039 GGCGGCGGGCGCGCGGGAGGCGG - Intronic
1061851351 9:133417887-133417909 GGCGCCGGGCCCGGGGAGGCCGG - Exonic
1061975817 9:134067670-134067692 GGAGGCGGCCAAGCGGGAGCGGG + Intronic
1062408672 9:136410455-136410477 GGCCGCGGCACGGGCGGAGCCGG - Exonic
1062411879 9:136429869-136429891 GGGGCCGGCCCCGGAGGAGGGGG + Intronic
1062430330 9:136524014-136524036 GGCGGGGGCGCTGGGGAAGCAGG - Intronic
1062449967 9:136611107-136611129 GGGGGCGGCCGTGGGGGGGCAGG + Intergenic
1062495107 9:136827935-136827957 GGCGGAGGCTCAGGGGGACCTGG + Intronic
1062499543 9:136846337-136846359 GCCCGCGGCCCCGGGAGAGGCGG + Exonic
1062499772 9:136847413-136847435 GGGGGCGGCCCTGGGTGGGCCGG - Exonic
1062501809 9:136855007-136855029 GACGGGGGCCCGGGGGGCGCCGG - Exonic
1062577163 9:137214151-137214173 GTGGGCGGCCCCTGGGGAGTGGG + Intronic
1062584090 9:137241332-137241354 GGCGGCGGCGGCGGGGAAGCAGG - Exonic
1062587394 9:137255443-137255465 TGCGGCGGCGCCGGGGGAACGGG + Exonic
1062696348 9:137878000-137878022 GGCGGCGGGGCCGGCGGGGCGGG + Exonic
1203740208 Un_GL000216v2:171631-171653 AACGGAGGCCCCAGGGGAGCTGG + Intergenic
1203471026 Un_GL000220v1:115508-115530 GGCGGCGGCGGCGGGGGTGTGGG + Intergenic
1203478847 Un_GL000220v1:159480-159502 GGCGGCGGCGGCGGGGGTGTGGG + Intergenic
1185506446 X:634901-634923 GGCGGCGGCCCGGGCGCAGGTGG - Intronic
1185520429 X:734524-734546 GGTGGCGGCCTCGGGGGTCCTGG - Intergenic
1185605439 X:1365797-1365819 GCCGGGTGCCCCGGGTGAGCGGG + Intronic
1185605511 X:1366009-1366031 GCCGGGTGCCCCGGGTGAGCGGG + Intronic
1185605668 X:1366486-1366508 GCCGGGTGCCCCGGGTGAGCGGG + Intronic
1185605725 X:1366655-1366677 GCCGGGTGCCCCGGGTGAGCGGG + Intronic
1185747607 X:2584615-2584637 GGCGGGGGGCGCGGGGGCGCGGG + Intergenic
1186466045 X:9785735-9785757 GGCCGCTGCCCCGGGGCAGAGGG - Intronic
1186493301 X:9992287-9992309 GGTGGCGGCCCAGGGGCAGTGGG + Intergenic
1186496500 X:10015710-10015732 GGCGGCGGCGCGGAAGGAGCTGG - Exonic
1187281579 X:17861375-17861397 GGCGGCGGAGGAGGGGGAGCAGG + Intergenic
1189322883 X:40097116-40097138 GGAGGGGGCCCCGGGAGAGGGGG + Intronic
1190114753 X:47619409-47619431 GGCGGCGGCTCTGGGGGCGCAGG - Exonic
1190136591 X:47804481-47804503 GGAGGGGGCCCCGGAGGAGGAGG - Intergenic
1190225224 X:48539869-48539891 GGCGGCGGCCGCTGAGGAGGAGG + Exonic
1190230015 X:48574836-48574858 GGCGGCGGCCACGTGGGATAAGG - Intronic
1190713061 X:53083061-53083083 GGCGGCGGCGGCGGCGGAGGAGG + Exonic
1192533660 X:71910868-71910890 GTGTGCAGCCCCGGGGGAGCCGG + Intergenic
1192657088 X:73003381-73003403 GGAGGCCACCCCGGGGGAGGCGG + Intergenic
1192665032 X:73079620-73079642 GGAGGCCACCCCGGGGGAGGCGG - Intergenic
1192925005 X:75747094-75747116 GGCGGCGGCCGCGGCGGCGGCGG - Intergenic
1197147245 X:123184362-123184384 GGCGGCGGCAGCGGAGGAGGAGG + Exonic
1198388135 X:136147709-136147731 GGCGGCGGCGGCGGGGCAGAAGG - Intronic
1199445111 X:147912064-147912086 GGCGGCGGCGGCGGCGGAGGCGG + Exonic
1199772594 X:150984035-150984057 GGCGGCGGCGCCGGGCGGGCGGG - Intronic
1199772831 X:150984708-150984730 AGCGGCGGCCCGGGCGGGGCGGG - Intronic
1200001912 X:153066525-153066547 GGCCGCGGCCGGTGGGGAGCTGG + Intergenic
1200005820 X:153083500-153083522 GGCCGCGGCCGGTGGGGAGCTGG - Intergenic
1200047692 X:153411441-153411463 GGCGGCGGCAGCGTGGGAACGGG - Intergenic
1200069367 X:153520083-153520105 GGGGGTGGGCCTGGGGGAGCTGG + Intronic
1201063508 Y:10068965-10068987 GGCGGCGGCCTTCGGGGAGGAGG - Intergenic
1201177156 Y:11316090-11316112 AATGGAGGCCCCGGGGGAGCTGG + Intergenic
1201178285 Y:11322727-11322749 AACGGAGGCCCCGGGGGAGCTGG + Intergenic
1201179869 Y:11333500-11333522 AACGGAGGCCCCGGGGGAGCTGG + Intergenic