ID: 1162930562

View in Genome Browser
Species Human (GRCh38)
Location 19:13955573-13955595
Sequence ACTCCTGGAACCCCCCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 178}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162930555_1162930562 1 Left 1162930555 19:13955549-13955571 CCCTGGCTTTAGCCTTGACCCTT 0: 1
1: 0
2: 2
3: 43
4: 335
Right 1162930562 19:13955573-13955595 ACTCCTGGAACCCCCCCAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 178
1162930553_1162930562 9 Left 1162930553 19:13955541-13955563 CCAGGCCACCCTGGCTTTAGCCT 0: 1
1: 0
2: 1
3: 30
4: 312
Right 1162930562 19:13955573-13955595 ACTCCTGGAACCCCCCCAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 178
1162930556_1162930562 0 Left 1162930556 19:13955550-13955572 CCTGGCTTTAGCCTTGACCCTTG 0: 1
1: 0
2: 0
3: 18
4: 446
Right 1162930562 19:13955573-13955595 ACTCCTGGAACCCCCCCAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 178
1162930554_1162930562 4 Left 1162930554 19:13955546-13955568 CCACCCTGGCTTTAGCCTTGACC 0: 1
1: 0
2: 1
3: 18
4: 179
Right 1162930562 19:13955573-13955595 ACTCCTGGAACCCCCCCAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 178
1162930550_1162930562 28 Left 1162930550 19:13955522-13955544 CCAGTTAGCTTTATTAGGACCAG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1162930562 19:13955573-13955595 ACTCCTGGAACCCCCCCAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162930562 Original CRISPR ACTCCTGGAACCCCCCCAGG AGG Intronic
900997774 1:6131709-6131731 ACTCCAGGAAGTCCTCCAGGAGG + Exonic
902780231 1:18700245-18700267 CCTCCAGGAAGCCCCCCAGGAGG - Intronic
903053691 1:20620293-20620315 GCTCCAGGAGCCCTCCCAGGAGG + Intergenic
905912416 1:41663273-41663295 ACTCCAGGAACAGCCTCAGGAGG + Intronic
907161253 1:52371484-52371506 ATTGCTTGAACCCACCCAGGAGG - Intergenic
907850361 1:58249796-58249818 ACCCCTGGGAACCCCCCAAGCGG - Intronic
908818295 1:68056918-68056940 GCCTCTGGAACCCCACCAGGAGG + Intergenic
911327896 1:96490666-96490688 GCTCCTGTAATCCCCTCAGGAGG + Intergenic
914912988 1:151801792-151801814 GCTCCTGGAGCCGCACCAGGGGG + Exonic
914913142 1:151802473-151802495 CCTGCTGGAGCCCCCACAGGCGG + Exonic
914998122 1:152562475-152562497 GCTCATGGAACCTCACCAGGAGG + Intronic
915137610 1:153744421-153744443 AGTCCTGGACCCTCCCCTGGAGG - Intronic
915840077 1:159206202-159206224 AGTCCTAGAACCACCCCATGAGG - Exonic
915943895 1:160136080-160136102 TCTCCTGTAACCCCCACAGCTGG - Intronic
917794236 1:178521356-178521378 ACTCCTGGCACAACCTCAGGAGG - Intronic
921572313 1:216794334-216794356 ACTCCCGGATTCCCCCCAAGCGG - Intronic
922536499 1:226384977-226384999 ACTGCTAGAACCCCACCAGCCGG + Intronic
922883046 1:228997064-228997086 ACTCCTGGAGCCCCTCAGGGCGG + Intergenic
924144307 1:241058210-241058232 ACTGGTGGAACGCCCCCAGATGG - Intronic
1065328729 10:24572027-24572049 ACTTCTGGTACCCCCTGAGGTGG + Intergenic
1069959289 10:72070209-72070231 AGTCCTGGAAACCCCTCCGGAGG + Intronic
1072663682 10:97379228-97379250 AGTCCTGGAACCTCCACAGAAGG - Intronic
1074533717 10:114313831-114313853 ACTCTAGGAACCCCTCCAAGTGG + Intronic
1075210512 10:120486897-120486919 ACACCTGGGACCCCTGCAGGAGG - Intronic
1076905470 10:133358627-133358649 CCTCCTGGACTCCCCCCAAGGGG - Intergenic
1077012351 11:384926-384948 AGGCCTGGAACCCCCACAGCCGG + Intergenic
1077012365 11:384964-384986 AGGCCTGGAACCCCCACAGCCGG + Intergenic
1077012379 11:385002-385024 AGGCCTGGAACCCCCACAGCCGG + Intergenic
1077012393 11:385040-385062 AGGCCTGGAACCCCCACAGCCGG + Intergenic
1077012407 11:385078-385100 AGGCCTGGAACCCCCACAGCCGG + Intergenic
1077012421 11:385116-385138 AGGCCTGGAACCCCCACAGCCGG + Intergenic
1077012435 11:385154-385176 AGGCCTGGAACCCCCACAGCCGG + Intergenic
1077012449 11:385192-385214 AGGCCTGGAACCCCCACAGCCGG + Intergenic
1077012463 11:385230-385252 AGGCCTGGAACCCCCACAGCCGG + Intergenic
1077012477 11:385268-385290 AGGCCTGGAACCCCCACAGCCGG + Intergenic
1077012491 11:385306-385328 AGGCCTGGAACCCCCACAGCCGG + Intergenic
1077012505 11:385344-385366 AGGCCTGGAACCCCCACAGCCGG + Intergenic
1077012519 11:385382-385404 AGGCCTGGAACCCCCACAGCCGG + Intergenic
1077012533 11:385420-385442 AGGCCTGGAACCCCCACAGCCGG + Intergenic
1077012547 11:385458-385480 AGGCCTGGAACCCCCACAGCCGG + Intergenic
1077012561 11:385496-385518 AGGCCTGGAACCCCCACAGCCGG + Intergenic
1077012575 11:385534-385556 AGGCCTGGAACCCCCACAGCCGG + Intergenic
1077012589 11:385572-385594 AGGCCTGGAACCCCCACAGCCGG + Intergenic
1077012603 11:385610-385632 AGGCCTGGAACCCCCACAGCCGG + Intergenic
1077012617 11:385648-385670 AGGCCTGGAACCCCCACAGCCGG + Intergenic
1077606613 11:3616755-3616777 ACTCCTGGATGCCATCCAGGAGG + Intergenic
1078068656 11:8094317-8094339 ACTCTGGGCACCCCCTCAGGTGG + Intronic
1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG + Exonic
1081569511 11:44280869-44280891 TCTGCTGGAACTCCCCCTGGGGG + Intronic
1091602368 12:1925582-1925604 AGACCTGGAAACCACCCAGGAGG + Intergenic
1092029646 12:5273726-5273748 ACCCCTGCCACCCTCCCAGGGGG - Intergenic
1098046420 12:66405531-66405553 GATCCTGGCACCACCCCAGGTGG - Intronic
1100864692 12:98844392-98844414 TCCCCTGGAACCCCACCAGAAGG + Intronic
1101402454 12:104400390-104400412 AATCCTGAAACCCCCACATGTGG + Intergenic
1102620380 12:114189941-114189963 ACTCATGGAATCACCCAAGGTGG + Intergenic
1103132658 12:118482582-118482604 ACTCCAGGGACCCCCCCAACTGG - Intergenic
1103348617 12:120267199-120267221 ACGCCTGTAATCCCACCAGGAGG - Intergenic
1106079154 13:26486132-26486154 ACTCCAGGAACCCCCACTGCTGG + Intergenic
1106129328 13:26926520-26926542 ACCCATAGAACCCTCCCAGGAGG + Intergenic
1119467853 14:74873465-74873487 GCTCCTGAACCCCCCCTAGGAGG - Intergenic
1120020727 14:79526868-79526890 ACTCCTGCTACCCTCCCAGGAGG - Intronic
1122201506 14:100125463-100125485 ACTGCTGAAACCTCCCCAGCAGG - Intronic
1122279403 14:100612291-100612313 ACTCCTGGAAGCCCCAGAGAAGG - Intergenic
1122486335 14:102084157-102084179 ACAGCTTGAACCCCCCCGGGAGG - Intronic
1122955151 14:105066996-105067018 ACTCCTGGACCCCTCACCGGGGG - Intergenic
1125631725 15:41152581-41152603 AGACCACGAACCCCCCCAGGAGG + Intergenic
1128334191 15:66775618-66775640 CCCCCTGGAACCCTCCCAGCAGG + Intronic
1128529941 15:68437970-68437992 AGTCCTGGAAACCCCCTGGGTGG - Intergenic
1128804766 15:70522430-70522452 CCTCCTGGGATCCCCACAGGTGG - Intergenic
1129242478 15:74259715-74259737 CCTCCTGCCACCCTCCCAGGAGG + Intronic
1129268974 15:74409644-74409666 AGTCCTGGAACCTCCCCCTGAGG + Exonic
1130023277 15:80248895-80248917 ACTCCTGCAACCCAGCCTGGTGG - Intergenic
1130423357 15:83770979-83771001 ACTGCTTGAACCCACCCAGGAGG + Intronic
1131353624 15:91724110-91724132 ATTCCTGCAACTCCCCCAGCTGG + Intergenic
1131632941 15:94198721-94198743 TCTCCTGGGACCCACCCAGTGGG + Intergenic
1132365738 15:101254923-101254945 ACTCCCGGAGCCCCTCCAGGTGG - Intergenic
1132495415 16:260970-260992 ACGCCTGCAACCCCAGCAGGAGG + Intronic
1132675147 16:1118347-1118369 ACTCCTGGCCCCCCCACAGGTGG - Intergenic
1137285671 16:47014108-47014130 TCTCCTGGCTCCCGCCCAGGGGG - Intergenic
1138214514 16:55191532-55191554 ACTCCTGGAACCCTTACTGGAGG + Intergenic
1140735499 16:77894473-77894495 ACGCCCGGAACCCAGCCAGGAGG + Intronic
1141735025 16:85846647-85846669 ACTCCTGGGTCTCCCCCTGGAGG + Intergenic
1146927145 17:36753016-36753038 ACTCCTGGCAAGACCCCAGGAGG + Intergenic
1147449663 17:40496209-40496231 ACTCCAGCAAGCCCCACAGGTGG - Exonic
1147972940 17:44229562-44229584 ACTTCTGGATCTCCCCCAGCAGG + Intergenic
1147994915 17:44355052-44355074 ACCCCTGGAACCCGCCCCGTCGG - Exonic
1151518318 17:74611725-74611747 ACTCCTGGAATTCCCCCACCTGG - Exonic
1160886817 19:1354001-1354023 ACTCCTGTAATCCCAGCAGGAGG - Intergenic
1162692123 19:12441464-12441486 ATTGCTTGAACCCACCCAGGAGG - Intronic
1162930562 19:13955573-13955595 ACTCCTGGAACCCCCCCAGGAGG + Intronic
1162937118 19:13986844-13986866 ACTCCTGGCATCCACCCTGGGGG + Intronic
1163797646 19:19346580-19346602 CCTCCTGGCACACACCCAGGAGG - Intronic
1165400516 19:35596698-35596720 CCTCCTGGAACATTCCCAGGAGG - Intergenic
1166774929 19:45306706-45306728 ACTGCTGGAACCCAGCCAGTGGG - Exonic
1166791655 19:45402509-45402531 ACGCCCGGACCCCCGCCAGGAGG + Intronic
926312681 2:11686014-11686036 CCGCCTGGAAACCCCCCAGCTGG + Intronic
930032386 2:47066371-47066393 ACCCCTGGTACCTCCCAAGGCGG + Intronic
931441398 2:62293208-62293230 ATGCCAGGAACCCACCCAGGGGG + Intergenic
932117426 2:69065870-69065892 ACTCCTGGAACATTCCCAGATGG - Intronic
935108508 2:100069323-100069345 ATTCCTGGACCCCCCTCTGGAGG - Intronic
935872570 2:107467291-107467313 ACTCCAGCAATCCCCACAGGAGG + Intergenic
936015715 2:108957476-108957498 GCTCATGGAGGCCCCCCAGGGGG + Intronic
936057210 2:109270143-109270165 ACTCCTCCAACACCCCCAGGTGG - Intronic
937198239 2:120179566-120179588 AGTCCTGAAACCAACCCAGGTGG - Intergenic
938283068 2:130081074-130081096 ACACCTGTAATCCACCCAGGTGG + Intronic
938348669 2:130583158-130583180 CCTCCTGAAACCCCCCTGGGTGG + Intronic
938432542 2:131257825-131257847 ACACCTGTAATCCACCCAGGTGG - Intronic
941987417 2:171522748-171522770 CCTCCCCGCACCCCCCCAGGAGG - Intronic
947219744 2:227780881-227780903 ACTCCTGGATCCCCACCTGCTGG + Intergenic
947267403 2:228298941-228298963 ACCCATGGAACCACCTCAGGAGG + Intergenic
948048055 2:234958576-234958598 ACTGCTGGATCACCCCCAGAAGG + Intronic
948911683 2:241008160-241008182 ATTCCTGCCACGCCCCCAGGTGG - Intronic
1170157225 20:13279818-13279840 ACTTCCTCAACCCCCCCAGGGGG + Exonic
1171488931 20:25503189-25503211 CCTCCTGTAACCCCAGCAGGTGG + Intronic
1171488942 20:25503246-25503268 CCTCCTGTAACCCCAGCAGGTGG + Intronic
1174611524 20:51801784-51801806 ACCCCTGGAAGACCCCCCGGAGG - Intronic
1181830795 22:25558780-25558802 ACTCCTTGCAAGCCCCCAGGTGG - Intergenic
1184361827 22:44023794-44023816 ACTCCTGGAACTCCCCTTGGAGG + Intronic
1184421492 22:44385108-44385130 ACTCATGAAACCCTCCCAGCGGG + Intergenic
1184606937 22:45579623-45579645 ACTCCAGGAGCCCAGCCAGGTGG - Intronic
949924088 3:9027295-9027317 ACTCCAGCACCCCCCCGAGGTGG - Intronic
952866891 3:37861084-37861106 ACTCCTGGGACCCCTCAAGCTGG + Intergenic
954224124 3:49171804-49171826 ACTCCTGGACCCCTGGCAGGAGG - Intronic
954653779 3:52181654-52181676 ACCCATGGAATCCACCCAGGAGG + Intergenic
955091266 3:55753085-55753107 ACTGCTGGAACTCCCCAAGTGGG + Intronic
957529316 3:81420547-81420569 ACTTCTCCAACCCCCACAGGAGG - Intergenic
961623257 3:128241008-128241030 TGTCCTGGAACACCCGCAGGGGG + Intronic
964998143 3:162913820-162913842 ACTCCTGGAACCATCCCCTGTGG - Intergenic
968051691 3:195658639-195658661 ACTCCTCGCACCCACCCAGGCGG - Intergenic
968104125 3:195989694-195989716 ACTCCTCGCACCCACCCGGGCGG + Intergenic
968302427 3:197627284-197627306 ACTCCTCGCACCCACCCGGGCGG + Intergenic
968425214 4:518761-518783 GCGTCTGGAACCCCCCCTGGCGG + Intronic
968586165 4:1417082-1417104 CCCCCTGGATCCCCGCCAGGAGG - Intergenic
968589315 4:1449755-1449777 ACTCCGGGGACCCCCACAGGCGG - Intergenic
968662189 4:1803270-1803292 ACGCCTGCGACCCCCACAGGAGG + Intronic
971168680 4:24210844-24210866 ACTCCTGGAACCTCTCCCAGTGG + Intergenic
971382083 4:26108257-26108279 TCTCCTTGAACCCTCCCACGAGG + Intergenic
979598415 4:122559474-122559496 ACTCCTGCCACCACCCCTGGTGG + Intergenic
982219458 4:153112306-153112328 TCTCCTGGGACCCCGCCAGTAGG - Intergenic
983955688 4:173696459-173696481 ACTTCTTGAACCCATCCAGGTGG + Intergenic
985437639 4:189947101-189947123 ACGCCTGGATCCCGCCGAGGCGG - Intronic
985497759 5:218909-218931 ACTCCTCGCACCCACCCGGGCGG - Intronic
987075633 5:14379489-14379511 ACACCTGGAACGTCACCAGGAGG - Intronic
992403243 5:76430473-76430495 ACTCTTGGAACCCTCCCACTTGG - Intronic
998105046 5:139462989-139463011 ATTCCAGGAAAACCCCCAGGCGG - Intergenic
999153776 5:149443682-149443704 ATCCCTGGAACCCCGGCAGGAGG - Intergenic
999423277 5:151463601-151463623 ACTCCTGGGACTCCCTCTGGCGG + Exonic
1001650083 5:173309931-173309953 ATTCCTGTAACCCCTCCAGATGG - Intergenic
1002311708 5:178319031-178319053 ACTGCTGGTACCCTCACAGGCGG + Intronic
1003405190 6:5822083-5822105 GCTGCTGGAACCCCAGCAGGAGG + Intergenic
1004958586 6:20758871-20758893 ACTCCTGTAACCCCAGCAGTTGG + Intronic
1005476128 6:26209938-26209960 TCTGCTGAAACCCCCCCAAGTGG + Intergenic
1007836268 6:44676389-44676411 AATCCTGGCACCCTGCCAGGAGG - Intergenic
1016567399 6:145471910-145471932 ACTCCTGGAGCCACCCCAGCTGG - Intergenic
1018394695 6:163369300-163369322 GCTCCTGGAAAACCCCAAGGGGG - Intergenic
1018505129 6:164458944-164458966 ATTCATGGAACCCTCCTAGGAGG + Intergenic
1019696082 7:2446857-2446879 GCTCCAGCAACCCCTCCAGGTGG + Intergenic
1020446721 7:8276598-8276620 ACTCTTTGAAGCTCCCCAGGTGG + Intergenic
1021645710 7:22787491-22787513 AGTCCTAGGACCCCCTCAGGTGG + Intergenic
1027223069 7:76226292-76226314 ACTCCAGGGACCCAGCCAGGAGG + Intronic
1029496224 7:100896626-100896648 ACTTCTGGAACCCCCGCGGGTGG + Intronic
1034335882 7:150323336-150323358 GCTCCCGGAACGCGCCCAGGGGG - Exonic
1035223206 7:157418891-157418913 GCTCCTGGACCCGCCCTAGGGGG - Intergenic
1036654855 8:10671494-10671516 ACCCCTGGACACCCCACAGGCGG + Intronic
1037965169 8:23128338-23128360 ACTCCTGGAACCCGCTCATGAGG + Intergenic
1042268784 8:66935362-66935384 AAACCTGGACCCCCACCAGGTGG - Intergenic
1042845706 8:73167812-73167834 AGTCCTTGAACCTGCCCAGGTGG - Intergenic
1043862621 8:85338088-85338110 ACTTCTGGAAAACGCCCAGGTGG - Intronic
1049051823 8:140203813-140203835 ACTCCTGGTACCCAGCCAGTGGG - Intronic
1049140999 8:140954058-140954080 ATTCCTTGAACCTCCACAGGAGG - Intronic
1052399408 9:27981613-27981635 ACTCTTATAACCCACCCAGGAGG + Intronic
1053557237 9:39149918-39149940 AGCCCTGAAACCCTCCCAGGGGG + Exonic
1053821345 9:41970186-41970208 AGCCCTGAAACCCTCCCAGGGGG + Exonic
1054090222 9:60838338-60838360 AGCCCTGAAACCCTCCCAGGGGG + Intergenic
1054111633 9:61113895-61113917 AGCCCTGAAACCCTCCCAGGGGG + Intergenic
1054609224 9:67217230-67217252 AGCCCTGAAACCCTCCCAGGGGG - Intergenic
1057302261 9:93893806-93893828 AATCCTCGAAAACCCCCAGGTGG - Intergenic
1058197696 9:101999145-101999167 ACCCCAGGAACAACCCCAGGTGG + Intergenic
1059405918 9:114098401-114098423 ACTTCTGGACCCCCGCCTGGAGG + Intronic
1060004299 9:119986098-119986120 AGTCCTGTAAGACCCCCAGGTGG + Intergenic
1060695802 9:125707799-125707821 TCTCCTGGAAACCTCCCAGCAGG - Intergenic
1060939279 9:127534462-127534484 AGTCCTGGGTCCCCACCAGGAGG + Intronic
1061385939 9:130289424-130289446 CATCCTGGACCCCTCCCAGGGGG + Intronic
1061963992 9:134003082-134003104 ACCCCTGAGACCTCCCCAGGAGG - Intergenic
1062027736 9:134348242-134348264 AGACCTGGAAGCCTCCCAGGAGG + Intronic
1062099119 9:134718869-134718891 ATTCTTGCAGCCCCCCCAGGAGG - Intronic
1062308653 9:135923695-135923717 ACTCCTGGAGCCCAGCCTGGGGG - Intergenic
1062401216 9:136373528-136373550 GCTCCTGGAAGACCCTCAGGTGG - Exonic
1062452009 9:136619760-136619782 ACTACTGGCACCCCCAGAGGAGG + Intergenic
1187690064 X:21857142-21857164 ATGCCTGGTAACCCCCCAGGAGG - Exonic
1198392730 X:136192690-136192712 ACCCCTGGAACCCCAAGAGGGGG - Intronic