ID: 1162931698

View in Genome Browser
Species Human (GRCh38)
Location 19:13960835-13960857
Sequence CCCAGAAGGTTCCAGAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 1, 2: 4, 3: 31, 4: 288}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162931698_1162931709 13 Left 1162931698 19:13960835-13960857 CCTGCCTTCTGGAACCTTCTGGG 0: 1
1: 1
2: 4
3: 31
4: 288
Right 1162931709 19:13960871-13960893 AGGTGGAGGGTGTGGCCGCAGGG 0: 1
1: 0
2: 0
3: 35
4: 304
1162931698_1162931712 26 Left 1162931698 19:13960835-13960857 CCTGCCTTCTGGAACCTTCTGGG 0: 1
1: 1
2: 4
3: 31
4: 288
Right 1162931712 19:13960884-13960906 GGCCGCAGGGCCAGGCAGGCAGG 0: 1
1: 0
2: 13
3: 107
4: 756
1162931698_1162931702 -7 Left 1162931698 19:13960835-13960857 CCTGCCTTCTGGAACCTTCTGGG 0: 1
1: 1
2: 4
3: 31
4: 288
Right 1162931702 19:13960851-13960873 TTCTGGGCCAGAAGCAAGTCAGG 0: 1
1: 0
2: 1
3: 14
4: 208
1162931698_1162931711 22 Left 1162931698 19:13960835-13960857 CCTGCCTTCTGGAACCTTCTGGG 0: 1
1: 1
2: 4
3: 31
4: 288
Right 1162931711 19:13960880-13960902 GTGTGGCCGCAGGGCCAGGCAGG 0: 1
1: 2
2: 6
3: 63
4: 431
1162931698_1162931708 12 Left 1162931698 19:13960835-13960857 CCTGCCTTCTGGAACCTTCTGGG 0: 1
1: 1
2: 4
3: 31
4: 288
Right 1162931708 19:13960870-13960892 CAGGTGGAGGGTGTGGCCGCAGG 0: 1
1: 0
2: 2
3: 36
4: 403
1162931698_1162931703 -4 Left 1162931698 19:13960835-13960857 CCTGCCTTCTGGAACCTTCTGGG 0: 1
1: 1
2: 4
3: 31
4: 288
Right 1162931703 19:13960854-13960876 TGGGCCAGAAGCAAGTCAGGTGG 0: 1
1: 0
2: 2
3: 20
4: 218
1162931698_1162931704 -1 Left 1162931698 19:13960835-13960857 CCTGCCTTCTGGAACCTTCTGGG 0: 1
1: 1
2: 4
3: 31
4: 288
Right 1162931704 19:13960857-13960879 GCCAGAAGCAAGTCAGGTGGAGG 0: 1
1: 0
2: 1
3: 19
4: 235
1162931698_1162931715 28 Left 1162931698 19:13960835-13960857 CCTGCCTTCTGGAACCTTCTGGG 0: 1
1: 1
2: 4
3: 31
4: 288
Right 1162931715 19:13960886-13960908 CCGCAGGGCCAGGCAGGCAGGGG 0: 1
1: 0
2: 8
3: 88
4: 657
1162931698_1162931713 27 Left 1162931698 19:13960835-13960857 CCTGCCTTCTGGAACCTTCTGGG 0: 1
1: 1
2: 4
3: 31
4: 288
Right 1162931713 19:13960885-13960907 GCCGCAGGGCCAGGCAGGCAGGG 0: 1
1: 0
2: 9
3: 81
4: 570
1162931698_1162931706 0 Left 1162931698 19:13960835-13960857 CCTGCCTTCTGGAACCTTCTGGG 0: 1
1: 1
2: 4
3: 31
4: 288
Right 1162931706 19:13960858-13960880 CCAGAAGCAAGTCAGGTGGAGGG 0: 1
1: 0
2: 2
3: 20
4: 246
1162931698_1162931710 18 Left 1162931698 19:13960835-13960857 CCTGCCTTCTGGAACCTTCTGGG 0: 1
1: 1
2: 4
3: 31
4: 288
Right 1162931710 19:13960876-13960898 GAGGGTGTGGCCGCAGGGCCAGG 0: 1
1: 0
2: 8
3: 66
4: 512
1162931698_1162931707 5 Left 1162931698 19:13960835-13960857 CCTGCCTTCTGGAACCTTCTGGG 0: 1
1: 1
2: 4
3: 31
4: 288
Right 1162931707 19:13960863-13960885 AGCAAGTCAGGTGGAGGGTGTGG 0: 1
1: 0
2: 3
3: 37
4: 531

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162931698 Original CRISPR CCCAGAAGGTTCCAGAAGGC AGG (reversed) Intronic
900120170 1:1045469-1045491 CCTCGAAAGTTCCAGAAGCCAGG - Exonic
900610005 1:3540677-3540699 CCCTGGAGGATCCAGAGGGCTGG - Intronic
900977966 1:6028886-6028908 GCTCAAAGGTTCCAGAAGGCTGG - Intronic
902994517 1:20213264-20213286 CCAGGCAGGTTCCTGAAGGCAGG + Intergenic
903337396 1:22634365-22634387 CCCAGAAGCTTCGAGATGCCAGG + Intergenic
903491124 1:23729340-23729362 CAGGGAAGGTTCCAGAAGGTGGG + Intergenic
904605630 1:31696248-31696270 CCCAGGAGGTGCCAGATGCCAGG - Intronic
906727590 1:48055231-48055253 CTCAGAAGGCTGAAGAAGGCAGG + Intergenic
907400433 1:54221909-54221931 CCCAGGAGCTCCCAGAGGGCGGG - Intronic
909081416 1:71116982-71117004 CAGAGGAGATTCCAGAAGGCTGG + Intergenic
909101851 1:71358074-71358096 CCCAGAAGGTTTCACAAGTGGGG - Intergenic
914425387 1:147571317-147571339 GCCAGAAGGCTCAAGAAGGAAGG - Intronic
914720327 1:150283626-150283648 CCCAGAAGGTAAGAGAAAGCAGG + Exonic
915073652 1:153292351-153292373 CCCAGCAGGTTCCGTCAGGCGGG - Intergenic
915347031 1:155202773-155202795 CCCAGAAGGGTACAGAAAACTGG - Intronic
915449349 1:155993984-155994006 CCCAGAAGGATCAGGAAGCCGGG + Intronic
915648257 1:157289257-157289279 CTCAGAAGCTTACAGAAAGCAGG + Intergenic
917413372 1:174783115-174783137 CCCTGCAGGATCCAGAGGGCTGG - Intronic
918058875 1:181045468-181045490 AGCAGGAGGTTCGAGAAGGCGGG - Intronic
919678722 1:200411822-200411844 CCGTGAAGGTTCCAGGAGGATGG + Intergenic
919758961 1:201085057-201085079 CCCAGAGGGGCCCCGAAGGCTGG - Intronic
920094921 1:203480385-203480407 GACAGAAGTTTCTAGAAGGCAGG + Intronic
920654050 1:207861918-207861940 CCTAGAATGTTCAAGAAGCCAGG - Intergenic
920812785 1:209302879-209302901 GCAAAAGGGTTCCAGAAGGCGGG + Intergenic
922923933 1:229331683-229331705 CTCAGGAGGTTCCTGGAGGCCGG + Intronic
923097909 1:230790005-230790027 CACAGCAGGGTCCTGAAGGCTGG + Intronic
923967308 1:239156163-239156185 CCCAGTGGCTTCCAGAATGCTGG - Intergenic
924706788 1:246508824-246508846 CCCAGATGCTTCTAGAAGCCTGG + Intergenic
1063913571 10:10857025-10857047 TCCAGAAGGTATCAGAAAGCTGG - Intergenic
1069943090 10:71968755-71968777 CACAGAAGGCTCCAGCAGCCTGG - Intronic
1070095507 10:73334338-73334360 CCAGGAAGGTTCCAGAAGAGGGG + Intronic
1070825425 10:79387806-79387828 GTCAGAAGGTTCTAGAAGGCAGG + Intronic
1070919817 10:80177472-80177494 CCCAGAAGGTCTCAGGAGACTGG - Intronic
1070967805 10:80540272-80540294 CCCAGACAGTTCCAAAAGGCAGG - Intronic
1071988906 10:91080578-91080600 CCCAGAAAGTAACAGAAGGGTGG + Intergenic
1072430725 10:95368687-95368709 CCCAACAGGTTTCAGCAGGCAGG - Intronic
1072686433 10:97540026-97540048 CAGAGAAGGTTCCAGATGGGAGG - Intronic
1074542172 10:114374012-114374034 CACAGAAGGTCCGTGAAGGCAGG - Intronic
1075489497 10:122854452-122854474 TTCAGAAGGTTCAGGAAGGCTGG - Intronic
1075757964 10:124830650-124830672 ACCAGAAGCTTCCAGAAAGTAGG - Intronic
1076443348 10:130495505-130495527 CCCACAGGGTTCCTGAAAGCTGG - Intergenic
1076982665 11:213132-213154 ACCAGAAGGTGGCAGATGGCAGG + Intronic
1078486148 11:11725185-11725207 CCCAGAAGGTACCAGGAGGTGGG + Intergenic
1079314817 11:19398630-19398652 CCCAGAAGGTTGGAGAATGAAGG - Intronic
1080665233 11:34330113-34330135 CCCAGCAGGGACCAGAAGTCAGG - Intronic
1080858668 11:36134201-36134223 CGGAGAAGCTTCCAGAAAGCAGG + Intronic
1080956577 11:37103899-37103921 TGCTGAAGATTCCAGAAGGCAGG - Intergenic
1081856826 11:46309185-46309207 CCCAGAAGGTTCAAGTTGGCAGG - Intronic
1083201072 11:61121434-61121456 CACAGAGGGTGCCAGAAGGAGGG + Intronic
1083253084 11:61481058-61481080 CCTAGAAGGTCTCAGAAGCCTGG + Intronic
1083278980 11:61613867-61613889 CCCAGAAGCCTTCAGGAGGCGGG + Intergenic
1083305272 11:61758701-61758723 TCTAGAAGGTTCCAGATGGCGGG - Intronic
1083570173 11:63756371-63756393 CCTACAAAGGTCCAGAAGGCAGG - Intronic
1084456258 11:69269826-69269848 CCCAGAAACTTCCAGAAGAGTGG + Intergenic
1086593476 11:88543426-88543448 AGCAGAAGGTTTCTGAAGGCAGG + Intronic
1086742989 11:90390830-90390852 CCCAGGAAATTCTAGAAGGCAGG - Intergenic
1087056025 11:93937267-93937289 TCCAGTAGGTTCTAGAAGGTAGG - Intergenic
1088362346 11:109004177-109004199 CCCAGAAAGATCCAGTAGGAAGG - Intergenic
1089168964 11:116499503-116499525 CCCAGAAGGCTCGCGCAGGCCGG - Intergenic
1089336166 11:117725374-117725396 CACAGGAGGTTTCAGAAGGCTGG + Intronic
1093746120 12:22742557-22742579 TCAAGAAGGTGCCAGAAGGGAGG + Intergenic
1094375234 12:29783074-29783096 CCCAGAGGGTTCCGGAGGGGTGG - Intronic
1095942581 12:47736672-47736694 CCCAGAAGACCCCAGAAGCCTGG + Intronic
1096776153 12:53965585-53965607 ACCAGAAGGGACCAGAAGGCTGG + Intergenic
1099787219 12:87281074-87281096 CACAGAAGGTTACAGACTGCTGG + Intergenic
1101435788 12:104663109-104663131 CCCGGGAGGATCCAGCAGGCTGG + Intronic
1101581708 12:106047725-106047747 CCCAGAAACTCCAAGAAGGCTGG - Intergenic
1101882474 12:108634781-108634803 CCCAGACACTTCCAGAAGGGAGG + Intergenic
1101900607 12:108788903-108788925 TCTGGAAGGTTCCAAAAGGCTGG + Exonic
1102030217 12:109736030-109736052 CAGAGAAGGTGCCAGAAGGAGGG - Intronic
1102133079 12:110548830-110548852 CCCAGATGGTTCTGTAAGGCTGG - Intronic
1103394592 12:120597860-120597882 AGCAGAAGGTTCCAGATGGAGGG - Intergenic
1103869339 12:124080040-124080062 CCGAGACCGTTTCAGAAGGCTGG + Intronic
1103996860 12:124835791-124835813 CCCAAAAGAAGCCAGAAGGCAGG - Intronic
1104035143 12:125092647-125092669 ACAGGAAAGTTCCAGAAGGCAGG - Intronic
1104789746 12:131474067-131474089 CCCAGCATGTCCCAGGAGGCAGG + Intergenic
1106173338 13:27307895-27307917 ACCAGGAAGTTCCAGAAAGCAGG + Intergenic
1107298952 13:38945801-38945823 CCTAGAATGTTCCAGAGGCCAGG - Intergenic
1113367400 13:109689397-109689419 CCCAGAAGTTTCCAAAAGGCAGG + Intergenic
1113941853 13:114022521-114022543 GGGAGAAGATTCCAGAAGGCTGG + Intronic
1118662805 14:68033096-68033118 CCCCCAAGATTCCAGAAGGCAGG + Intronic
1120689511 14:87577027-87577049 CCCAGAAGGGTCCAGGATACTGG + Intergenic
1121076963 14:91076947-91076969 TTCAGAAAGTTCCAGTAGGCTGG + Intronic
1121245902 14:92460676-92460698 CCCAGAAGCTCCCAGAGGGCAGG - Intronic
1121930318 14:97966302-97966324 CCCCCAGGGTTCCAGTAGGCGGG - Intronic
1122615453 14:103014667-103014689 CACAGAAGGTTCCAGGGGCCTGG + Intronic
1122651419 14:103229075-103229097 CCCAGAAGGATGGAGTAGGCTGG - Intergenic
1124486853 15:30125293-30125315 CCCAGAAGATCCATGAAGGCAGG - Intergenic
1124541935 15:30594270-30594292 CCCAGAAGATCCATGAAGGCAGG - Intergenic
1124548585 15:30656061-30656083 CCCAGAAGATCCATGAAGGCAGG - Intronic
1124756672 15:32413030-32413052 CCCAGAAGATCCATGAAGGCAGG + Intergenic
1124973767 15:34514881-34514903 CCCACAAGGGTCCAGGCGGCAGG - Intergenic
1128934844 15:71737747-71737769 GCCAGATGGTGACAGAAGGCAGG + Exonic
1129120779 15:73395069-73395091 GCCAGCATGTTCCAGAAAGCTGG - Intergenic
1129234866 15:74218003-74218025 CTCTGGAAGTTCCAGAAGGCAGG - Intergenic
1129373175 15:75110527-75110549 TCCAGGAGCTTCCAGAATGCTGG - Intronic
1129694950 15:77735197-77735219 CCCGCAAGCTTCCAGAGGGCAGG - Intronic
1130196197 15:81782383-81782405 CCCAGAAAGTTCCAGAAAGCTGG + Intergenic
1130227727 15:82072644-82072666 CCCAGAAGCTTGCAGATGCCAGG + Intergenic
1130654073 15:85779749-85779771 TCCTGAGGGCTCCAGAAGGCTGG - Intronic
1130884386 15:88081259-88081281 CTCAGAAGGTGACAGAAGGATGG + Intronic
1130989748 15:88869289-88869311 CCCAGAAACTTCCAGAAGGCAGG + Intronic
1131255232 15:90857691-90857713 CCCAGAATTTTCCTGAAAGCAGG + Intergenic
1133224393 16:4333689-4333711 TCCAGAAGCTGCCAGAAGGCAGG - Intronic
1133767453 16:8847983-8848005 GCCAGAAACTTCCAGAAGGAAGG + Exonic
1134568785 16:15274042-15274064 CCCAGATGGTATCAGAAGGAAGG + Intergenic
1134733650 16:16482320-16482342 CCCAGATGGTATCAGAAGGAAGG - Intergenic
1134904868 16:17971707-17971729 CCCAGAAAGCTCCAAAAGGTAGG + Intergenic
1134933852 16:18229962-18229984 CCCAGATGGTATCAGAAGGAAGG + Intergenic
1135660962 16:24296195-24296217 CCCTGAGGGTGGCAGAAGGCAGG - Intronic
1136578877 16:31140329-31140351 CACAGAGGGTTCCAGGGGGCAGG + Exonic
1137779883 16:51089082-51089104 CAGAGAAGGTTCCAGATGGAAGG - Intergenic
1138386803 16:56641020-56641042 AAGAGAGGGTTCCAGAAGGCAGG + Intronic
1139015563 16:62684830-62684852 CCCAGAAGCTTGGAGAAGCCTGG - Intergenic
1140707758 16:77646700-77646722 CCCAAGAGCTTCCTGAAGGCAGG - Intergenic
1141633824 16:85303364-85303386 CCCAGATGTTTCCAGAAAGGAGG + Intergenic
1141851208 16:86647271-86647293 ACCAGAAGCTCCCTGAAGGCAGG - Intergenic
1142028521 16:87827089-87827111 CCGGGAAGGTTCCTGAAGACAGG - Intergenic
1143206074 17:5139853-5139875 CCCAGATGCTTCTAGAAGCCTGG - Intronic
1143209988 17:5179050-5179072 CCCTCAAGGACCCAGAAGGCAGG + Intergenic
1143801254 17:9383618-9383640 CCCAGATTGTTCAATAAGGCAGG + Intronic
1144483521 17:15646410-15646432 CACAGAAAGTTCTGGAAGGCAGG + Intronic
1144621168 17:16819409-16819431 ACCAGAAGTCCCCAGAAGGCAGG + Intergenic
1144757839 17:17690989-17691011 AACAGAAGCTTCCAGAAGACAGG - Intronic
1144915166 17:18718617-18718639 CACAGAAAGTTCTGGAAGGCAGG - Intronic
1145200344 17:20938860-20938882 CCCACAGGGACCCAGAAGGCAGG - Intergenic
1146842537 17:36165984-36166006 CCCAGATGCTTCTAGAAGCCTGG + Exonic
1146854849 17:36253943-36253965 CCCAGATGCTTCTAGAAGCCTGG + Exonic
1146865771 17:36334433-36334455 CCCAGATGCTTCTAGAAGCCTGG - Exonic
1146870749 17:36377835-36377857 CCCAGATGCTTCTAGAAGCCTGG + Exonic
1146878107 17:36428916-36428938 CCCAGATGCTTCTAGAAGCCTGG + Exonic
1146882048 17:36450020-36450042 CCCAGATGCTTCTAGAAGCCTGG + Intergenic
1147068641 17:37935045-37935067 CCCAGATGCTTCTAGAAGCCTGG - Exonic
1147073632 17:37978459-37978481 CCCAGATGCTTCTAGAAGCCTGG + Intronic
1147080163 17:38014582-38014604 CCCAGATGCTTCTAGAAGCCTGG - Intronic
1147085154 17:38057997-38058019 CCCAGATGCTTCTAGAAGCCTGG + Exonic
1147096112 17:38138542-38138564 CCCAGATGCTTCTAGAAGCCTGG - Intergenic
1147101100 17:38181963-38181985 CCCAGATGCTTCTAGAAGCCTGG + Intergenic
1147302298 17:39539619-39539641 CCCAGAAGCTTCCTGAAGGTGGG - Intronic
1147573148 17:41583702-41583724 ACCAGAAGGCCCCAGAAGGCAGG + Intronic
1148053885 17:44782166-44782188 CCCAAAAGATTCCAGAACGCTGG + Intergenic
1148203716 17:45766338-45766360 CCCAGGAGGTCCCAGTAGGGAGG - Intergenic
1149845691 17:60008426-60008448 CCCAGATGCTTCTAGAAGCCTGG + Intergenic
1150084039 17:62265006-62265028 CCCAGATGCTTCTAGAAGCCTGG + Intergenic
1151582717 17:74989155-74989177 TCCACAAGGCTCCAGAGGGCTGG + Intronic
1151997194 17:77617550-77617572 TCCAGAATGTTCCACATGGCTGG - Intergenic
1152342252 17:79731614-79731636 CCCAGAAGGCTTCAGGAGGAGGG + Intronic
1152607382 17:81299543-81299565 TCCCGGAGCTTCCAGAAGGCAGG - Intergenic
1152876163 17:82787358-82787380 CCCAGGAGCTGCCAGAAGCCCGG - Intronic
1154018022 18:10637591-10637613 GCCAGAAGCTTCCAGAAGGGAGG + Intergenic
1154123887 18:11672884-11672906 CTCAGAAGGTTGCAGAAGCTGGG - Intergenic
1154186847 18:12191991-12192013 GCCAGAAGCTTCCAGAAGGGAGG - Intergenic
1154306541 18:13234565-13234587 CCCAGAAGTTGGCAGAAGGGAGG - Intronic
1155480121 18:26277157-26277179 CCCAGGAGGGTCAAGAAAGCAGG - Intronic
1156381136 18:36562548-36562570 CCCAGCAGGCTCCAAATGGCTGG - Intronic
1160910097 19:1470223-1470245 GAGAGAACGTTCCAGAAGGCCGG - Exonic
1161097135 19:2398955-2398977 TCCAGAAGATTCCAGCAGGGCGG + Intronic
1162501566 19:11056985-11057007 CCCAGAAAATTCCAGAGGGCAGG - Intronic
1162675144 19:12293351-12293373 CCCAGAAAGTTCCATAACACAGG + Exonic
1162931698 19:13960835-13960857 CCCAGAAGGTTCCAGAAGGCAGG - Intronic
1163020702 19:14479627-14479649 CCCAGAAACTTGCAGAAGCCTGG - Intronic
1163054256 19:14706422-14706444 CCAAGGAGGCTCCAGAAGTCAGG - Intronic
1165431666 19:35776442-35776464 CCCATAAGGTTCCCCAAGGCAGG - Intronic
1165479781 19:36055579-36055601 CGCAGAAGGTGAGAGAAGGCGGG - Intronic
1165895225 19:39137254-39137276 CCCAGATGGCTCCAGAGGCCAGG - Intronic
1166762901 19:45235721-45235743 CCCATCCGTTTCCAGAAGGCGGG + Intronic
1166918173 19:46210252-46210274 TCAAGAAGATTCCAGAAGGTGGG + Intergenic
1167098840 19:47391644-47391666 CCCTCAAGGTTCCACCAGGCCGG + Intergenic
1168544160 19:57236363-57236385 CACAGAAGGTTACAGAAGGCTGG - Intergenic
925007598 2:456285-456307 CCCAGAAGTCACCAGAAGGTTGG + Intergenic
927509596 2:23636088-23636110 CCTAGAAGCTTCCAGAACCCGGG + Intronic
929664811 2:43825680-43825702 CCCAGGAGGTTGCAGAGAGCTGG - Intronic
930694739 2:54400191-54400213 CTCAGAAGGTTGCTGCAGGCTGG + Intergenic
930710272 2:54544264-54544286 CCAAGAAGGTTGGAAAAGGCAGG - Intronic
931782015 2:65587045-65587067 CCCTGAAGCTTCCCAAAGGCAGG + Intergenic
933950284 2:87323202-87323224 CCCAGAAGGTGCCATGAGGGTGG - Intergenic
934150231 2:89139990-89140012 CACAGAAGATTACAGCAGGCAGG - Intergenic
934616194 2:95772760-95772782 CCATGAGGGTTCCTGAAGGCTGG - Intergenic
934644701 2:96051800-96051822 CCATGAGGGTTCCTGAAGGCCGG + Intergenic
934838116 2:97607890-97607912 CCATGAGGGTTCCTGAAGGCTGG + Intergenic
935364371 2:102273949-102273971 CACAGGACGTTCCAGAAGACAGG + Intergenic
936329904 2:111538394-111538416 CCCAGAAGGTGCCATGAGGGTGG + Intergenic
937311144 2:120904164-120904186 CCTAGAATGTTCCAGAACTCAGG - Intronic
938317465 2:130340044-130340066 CTGAGAGGATTCCAGAAGGCAGG - Intronic
938736545 2:134191467-134191489 ACCAGCAGGTTCCAGATGGAAGG + Intronic
939133571 2:138267271-138267293 CTCACAAGGTCCCAGAAGCCTGG - Intergenic
946185752 2:217979597-217979619 CCTATAAGGTTCCCGAAGCCTGG + Intronic
946298601 2:218807423-218807445 ACCAGATAGTTCTAGAAGGCAGG - Intronic
946465815 2:219911000-219911022 CCAAGAAGGTCCCAGAGTGCTGG + Intergenic
947736111 2:232456363-232456385 GCCTGGCGGTTCCAGAAGGCCGG - Exonic
948692047 2:239712226-239712248 CCCACTAAGTTCCAGAAGGAAGG + Intergenic
1171240778 20:23565615-23565637 CCCAGGTTCTTCCAGAAGGCAGG + Intronic
1172011006 20:31845556-31845578 CCCAGCAGGTCCCAGCAGCCTGG - Exonic
1174413583 20:50352224-50352246 CCCAGAAGGTGCAAGGTGGCAGG - Intergenic
1175139088 20:56846568-56846590 CCCAGATCTTTCCAGGAGGCAGG - Intergenic
1175843500 20:62046467-62046489 CCCAGCAGGTGCAAGAAGCCGGG - Intronic
1175929920 20:62489043-62489065 CCCACAAGCCCCCAGAAGGCTGG + Intergenic
1175960451 20:62634007-62634029 ACCTGAAGTTCCCAGAAGGCAGG + Intergenic
1176290873 21:5043969-5043991 CCCAGGAGACTCCAGCAGGCAGG - Intergenic
1176973176 21:15289542-15289564 CCCAGAAGCTTGGAGATGGCAGG + Intergenic
1178188985 21:30258416-30258438 CCCTGAAAGTTTTAGAAGGCAGG - Intergenic
1179065997 21:38025362-38025384 CCCAGAAGGTCCCAGATCTCTGG + Intronic
1179309689 21:40184774-40184796 CCCAGGAGTTTCCCAAAGGCAGG - Intronic
1179866382 21:44219672-44219694 CCCAGGAGACTCCAGCAGGCAGG + Intergenic
1179885951 21:44314371-44314393 CCCAGCAAGGTCCAGACGGCAGG + Intronic
1179896189 21:44364973-44364995 CTCAGAACCCTCCAGAAGGCTGG - Intronic
1179896199 21:44365045-44365067 CTCAGAACCCTCCAGAAGGCTGG - Intronic
1179896204 21:44365081-44365103 CTCAGAACCCTCCAGAAGGCTGG - Intronic
1179896213 21:44365152-44365174 CTCAGAACCCTCCAGAAGGCTGG - Intronic
1179896218 21:44365188-44365210 CTCAGAACCCTCCAGAAGGCTGG - Intronic
1179896223 21:44365224-44365246 CTCAGAACCCTCCAGAAGGCTGG - Intronic
1180741539 22:18056393-18056415 CCCACAAGGTTCCAATGGGCTGG - Intergenic
1181099042 22:20526767-20526789 CCTAGAGGGTTCCAGAAGGGAGG - Intronic
1181105715 22:20573986-20574008 CACAGGAGGTGCCAGAAGCCGGG - Intronic
1181596321 22:23917287-23917309 CCCAGAGGGGACCAGGAGGCTGG - Intergenic
1181673849 22:24439355-24439377 CTCAGAAGGTGCAAGGAGGCCGG - Intronic
1181851105 22:25750581-25750603 TCCACAAGGTTCCTGGAGGCAGG - Intronic
1183068572 22:35380702-35380724 CCCAGAAGGTTCCAGAAAGCTGG - Intronic
1183092300 22:35530905-35530927 GCCAGAAGGTTCTAGAAGGGCGG + Intergenic
1183159094 22:36098897-36098919 CCCAGGAGGTTGCAGTAAGCCGG - Intergenic
1184344660 22:43905755-43905777 CCCAGAAACTTCCAGAAAGCAGG + Intergenic
949469928 3:4383582-4383604 CTCAGAAGATGACAGAAGGCAGG + Intronic
950439434 3:13000542-13000564 CCCAGAAGGTCCCTGAAAGCAGG + Intronic
953329118 3:42037371-42037393 ACCAGAAGCTTCCAGAGGTCAGG + Intronic
954042514 3:47899581-47899603 CCCAGGAGCTTCTAGAAGGTAGG + Intronic
954360888 3:50122266-50122288 CCCAGAAGGTGGCAGGAGGGAGG + Intergenic
954420742 3:50417810-50417832 CCCACAAGGTCCCTGAGGGCAGG + Intronic
955147623 3:56335896-56335918 ACCATAAGCTTCCTGAAGGCTGG - Intronic
960179535 3:114559080-114559102 ACTAGAATGTTCCAGAAGGAAGG + Intronic
961751281 3:129096225-129096247 CCCAGACAGTTCCTGAAGGCAGG + Intronic
962267397 3:133953710-133953732 CCCAGCAGGTACCCGAAAGCCGG + Exonic
964129984 3:153276116-153276138 CCAACAAGGAACCAGAAGGCAGG + Intergenic
965486791 3:169287796-169287818 TTCAGAAGGTTCCAGAAGCAGGG + Intronic
968187523 3:196643466-196643488 CCCAAAAGGTTGCCTAAGGCAGG + Intronic
968502852 4:959225-959247 CCCAGGAGGCTGCAGCAGGCTGG + Exonic
968782597 4:2594392-2594414 CCCAGAAGCTTCTCCAAGGCCGG - Intronic
968826261 4:2899912-2899934 CCCGGCATGGTCCAGAAGGCGGG + Intronic
969894960 4:10295143-10295165 CCCAGAAGATTCCTGAAGGGTGG + Intergenic
970613275 4:17745066-17745088 CCCTGAAGGTTAGAGAAGGCAGG - Intronic
971176742 4:24289420-24289442 CCCAGAGGGTTGGAGGAGGCAGG - Intergenic
973861195 4:55066641-55066663 CCCAGCAGGTTGCAGAGGTCAGG + Intergenic
974013413 4:56627410-56627432 CCCAGTGGGTAACAGAAGGCTGG - Intergenic
974092237 4:57323167-57323189 CTCTGCAGGCTCCAGAAGGCAGG + Intergenic
975523793 4:75327855-75327877 CCCAGAAAGGCCCAGCAGGCAGG - Intergenic
979648871 4:123107073-123107095 CCCAGAAGCTTGGAGAAGCCAGG + Intronic
981128310 4:141132235-141132257 CCCAGAAGGAGCCTGGAGGCAGG + Intronic
982436327 4:155385481-155385503 CCCAGATGGTTCTAGAAGCCTGG - Intergenic
982542541 4:156692110-156692132 CCCACCAGGTTCCACAAGGGAGG + Intergenic
985090480 4:186357899-186357921 CCCAGGAGCCTCCAGAAGGAAGG + Intergenic
985656189 5:1132622-1132644 CCTGGAATGGTCCAGAAGGCAGG - Intergenic
987117242 5:14735653-14735675 CCCAGGAGCTACCAGAAGCCAGG - Intronic
988103333 5:26710027-26710049 CCAAGATGGTTCCAGAAGCATGG + Intergenic
988832575 5:35002425-35002447 CCCTGAAGGTTCCAGAAATGAGG - Intronic
988974188 5:36499160-36499182 CCTAAAATGTTCCAGAAGGCAGG + Intergenic
994431762 5:99674295-99674317 CTCAGAAGGAAGCAGAAGGCAGG - Intergenic
995721823 5:115143171-115143193 CCCAGGAGCTTACACAAGGCTGG + Intronic
996374354 5:122788483-122788505 ACCAAAATGTTCCAGAAGGAAGG - Intronic
996749589 5:126875271-126875293 CACAGCAGGTTCCAGAAGGTGGG + Intronic
997589324 5:135063319-135063341 CCCAGGAGCTTTCAGAGGGCAGG + Intronic
999739082 5:154535560-154535582 CCCAGCAGGATCCAGTAAGCAGG - Intergenic
1002538424 5:179891058-179891080 CCCTGCAGGGCCCAGAAGGCAGG + Intronic
1003777954 6:9390380-9390402 CCTAGAAAGTTCCAGAGGACAGG - Intergenic
1004437419 6:15609972-15609994 CCCAGTAGGTCCCAGAACTCCGG - Intronic
1005378198 6:25207128-25207150 CCCGGAAAGTGCCAGAAGCCAGG + Intergenic
1006427694 6:33976462-33976484 TCCAGAAGGTTCCAGCAAGGAGG + Intergenic
1007412496 6:41673135-41673157 TCCAGAAGCTTCCAGCAGGAGGG + Intergenic
1009588719 6:65638526-65638548 CCCAGAAGCTTCGAGACGCCAGG - Intronic
1011034384 6:82957383-82957405 CCAAGCAGGTTGCAGAGGGCAGG + Exonic
1013090443 6:106895763-106895785 CGTAAAAGGTTACAGAAGGCTGG - Intergenic
1014405938 6:121050955-121050977 CCCAGGAGTTTCCAGATGGAAGG - Intergenic
1016384180 6:143515015-143515037 CCGTGATGGTTCCAGAAGGGAGG - Intergenic
1016544148 6:145201768-145201790 CACAGAAGATACCAGAAGGTGGG + Intergenic
1016742177 6:147540564-147540586 CCCATAAGCTTGCAGCAGGCTGG - Intronic
1016890245 6:148998936-148998958 CCCAGAAGGAGCCACATGGCTGG - Intronic
1017370410 6:153699489-153699511 CCAAGAAGGTAACTGAAGGCAGG + Intergenic
1018055205 6:160046383-160046405 CCCAGGAGGTTCCCAACGGCAGG - Intronic
1019618821 7:1979574-1979596 CCCTGATGGGTCCACAAGGCGGG + Intronic
1021039167 7:15839831-15839853 GCCAGCACATTCCAGAAGGCAGG - Intergenic
1022418973 7:30202471-30202493 CACAGAAGATTTAAGAAGGCAGG - Intergenic
1022502241 7:30889101-30889123 CCCAGAGGGTGGCAGAAGGGAGG - Intronic
1023129037 7:36984261-36984283 CCCATGAGGCTCCAGATGGCTGG - Intronic
1026508593 7:71007956-71007978 CCTACCATGTTCCAGAAGGCGGG + Intergenic
1027701843 7:81479197-81479219 CCCAGTAGCTTCCAGAAAGAAGG + Intergenic
1028091620 7:86709547-86709569 CCCCGAAGGTACCACAAGGCTGG - Intronic
1028121080 7:87057627-87057649 GACAGAAGGTTCAGGAAGGCTGG - Intronic
1028596130 7:92547535-92547557 CCCAGAAGCTTGGAGAAGCCAGG - Intergenic
1029118285 7:98249443-98249465 TTCAGATGGTTCCAGAAAGCTGG - Intronic
1029554902 7:101262027-101262049 GAAAGAATGTTCCAGAAGGCCGG + Intergenic
1030089876 7:105849223-105849245 CCAAGGAGGTGGCAGAAGGCTGG + Intronic
1031460037 7:122037456-122037478 CCCAGTAAGTTCCACAAAGCTGG - Intronic
1032196547 7:129792561-129792583 CCCAGAGGCTTCCAGTGGGCAGG + Intergenic
1032410199 7:131689074-131689096 GCCAGAAGGTCCCCGAATGCTGG + Intergenic
1032850227 7:135788778-135788800 CCCAGCAGATGCCAGAGGGCAGG + Intergenic
1034551095 7:151821125-151821147 CATAGAAGTTTCCAGAAGGAAGG + Intronic
1035402008 7:158572031-158572053 CACAGAAGGTTCTGAAAGGCAGG + Intronic
1036627031 8:10480586-10480608 CCAAGAATGTACCAGAAGCCAGG + Intergenic
1038642436 8:29338795-29338817 CACAGATGGTGCCATAAGGCCGG - Intronic
1041112000 8:54491979-54492001 TCGAGAAGATTGCAGAAGGCTGG + Intergenic
1041377730 8:57219814-57219836 CCAAGAAGGTATCAGGAGGCAGG - Intergenic
1047274426 8:123395246-123395268 CACAGAAGGTTGAAGAAGTCGGG - Intronic
1047507533 8:125491680-125491702 CCCAGAGGGCTCCAGAAAGAGGG - Intergenic
1049306350 8:141906329-141906351 CAGAGAAGGTTCCAGAAAGGTGG + Intergenic
1049457359 8:142700459-142700481 CTGCGAAGGTTCCAGAAGGGCGG + Exonic
1049482761 8:142834771-142834793 CCCCGAAAGTTCCAGAAAGCGGG + Intronic
1055763218 9:79632301-79632323 CACAAAAGGTTCCAGTAGGATGG + Intronic
1055960295 9:81814157-81814179 TGCAAAAGGTTCCAGAAGGCAGG - Intergenic
1056680358 9:88712239-88712261 CCCACAACGTGCCAGAAGGAGGG - Intergenic
1056942252 9:90965543-90965565 CCTAGTTGGTTCCAGCAGGCTGG + Intergenic
1056956438 9:91085296-91085318 CCATGAAGGTTCCTGAAGGATGG + Intergenic
1058633814 9:107017285-107017307 CCCAGAAAGTTGAAGGAGGCTGG + Intergenic
1059220675 9:112614900-112614922 CACGGAAGGGTCCAGAATGCTGG - Intronic
1060014737 9:120077304-120077326 CCTAGAAGATGCCAGAAGGTGGG - Intergenic
1060943970 9:127559142-127559164 CCAAGAAGGTTCCATCAAGCTGG - Intronic
1060955267 9:127634272-127634294 CAGGGAAGCTTCCAGAAGGCAGG - Intronic
1061055958 9:128223047-128223069 CCCAGCAAGTTGCAGTAGGCGGG - Intronic
1061177345 9:129005720-129005742 GCCAGAAGGGTCCCGAAGGAGGG - Exonic
1061878196 9:133555429-133555451 CCAAGAAGCTCCCAGAAGGAGGG - Intronic
1062008791 9:134256143-134256165 CCCAGGGGATTCCAGAAGGAAGG + Intergenic
1062252433 9:135605059-135605081 CCCGGAAGGAACCAGAAGGGAGG - Intergenic
1185600769 X:1337424-1337446 CTCAGAATGTTCCAGATGGCTGG + Intronic
1186482343 X:9905513-9905535 GCCAGGAGAGTCCAGAAGGCCGG + Intronic
1187935490 X:24331834-24331856 TCCAGAAGGGTCCTGAATGCAGG - Intergenic
1189299314 X:39941388-39941410 GCCAGGAGGTTCCTGCAGGCTGG + Intergenic
1192195547 X:69025386-69025408 ACCAGAAGCTTCTTGAAGGCAGG + Intergenic
1198787764 X:140309066-140309088 ACCAAAAGGTACCAGAAGGAGGG + Intergenic