ID: 1162931742

View in Genome Browser
Species Human (GRCh38)
Location 19:13961026-13961048
Sequence CTACCTCCGTGGCCTGGGAC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 175}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162931737_1162931742 -6 Left 1162931737 19:13961009-13961031 CCGGACACTGACTCCAACTACCT 0: 1
1: 0
2: 2
3: 8
4: 168
Right 1162931742 19:13961026-13961048 CTACCTCCGTGGCCTGGGACCGG 0: 1
1: 0
2: 2
3: 15
4: 175
1162931734_1162931742 -1 Left 1162931734 19:13961004-13961026 CCGCCCCGGACACTGACTCCAAC 0: 1
1: 0
2: 0
3: 8
4: 161
Right 1162931742 19:13961026-13961048 CTACCTCCGTGGCCTGGGACCGG 0: 1
1: 0
2: 2
3: 15
4: 175
1162931735_1162931742 -4 Left 1162931735 19:13961007-13961029 CCCCGGACACTGACTCCAACTAC 0: 1
1: 0
2: 0
3: 4
4: 84
Right 1162931742 19:13961026-13961048 CTACCTCCGTGGCCTGGGACCGG 0: 1
1: 0
2: 2
3: 15
4: 175
1162931733_1162931742 4 Left 1162931733 19:13960999-13961021 CCAGGCCGCCCCGGACACTGACT 0: 1
1: 0
2: 0
3: 9
4: 97
Right 1162931742 19:13961026-13961048 CTACCTCCGTGGCCTGGGACCGG 0: 1
1: 0
2: 2
3: 15
4: 175
1162931736_1162931742 -5 Left 1162931736 19:13961008-13961030 CCCGGACACTGACTCCAACTACC 0: 1
1: 0
2: 0
3: 7
4: 131
Right 1162931742 19:13961026-13961048 CTACCTCCGTGGCCTGGGACCGG 0: 1
1: 0
2: 2
3: 15
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162931742 Original CRISPR CTACCTCCGTGGCCTGGGAC CGG Exonic
901770249 1:11526527-11526549 CCAACTCCGAGGACTGGGACAGG + Intronic
902871331 1:19315350-19315372 CTACCTCCAGGGCCTGGCACAGG - Intronic
902956295 1:19926167-19926189 CTTTCTCCGTGGCCAGGGAAAGG - Intergenic
903364787 1:22799396-22799418 CTACCTATGTGGCCCTGGACAGG + Intronic
905449822 1:38048718-38048740 CTACCTCCCAGGCCTGGGAAAGG - Intergenic
907289525 1:53403842-53403864 ATAGCTGTGTGGCCTGGGACAGG - Intergenic
908980344 1:69949180-69949202 CTACCTCTGGGGGGTGGGACTGG - Intronic
909495372 1:76271942-76271964 CTACCTACTTGGCCTCGGAAGGG - Intronic
912419158 1:109531721-109531743 ATAGCTCCACGGCCTGGGACAGG + Intergenic
912420698 1:109540450-109540472 ATACCTCTGTGGCCTTGGGCTGG + Intronic
915317292 1:155036195-155036217 CTATTTCCCTTGCCTGGGACAGG - Intronic
919639728 1:200036333-200036355 CTAGCTCAGTGACCTTGGACGGG - Intronic
919958040 1:202438624-202438646 CTGCTTCCGGGGCCAGGGACGGG - Intronic
920243828 1:204573286-204573308 CCTCCTCTGTGGCCTGGGCCAGG + Intergenic
922166753 1:223122096-223122118 CTACCTCCAAGGTTTGGGACAGG + Intronic
924952372 1:248896850-248896872 CGGCCTCCCTGGCCTGGGAGCGG - Intergenic
1064622364 10:17229102-17229124 CCTGCTCCGGGGCCTGGGACTGG - Intronic
1067963296 10:50880794-50880816 CTACCTGCCTGGCAGGGGACTGG - Intronic
1069882707 10:71603570-71603592 TTACCTCCGGGGCCTGGGGCAGG - Intronic
1072632395 10:97155318-97155340 CTGCCTCCTTGGCCTGTGTCTGG - Intronic
1076160795 10:128242939-128242961 CTCCCTCCCTGGCCTGAGAGTGG + Intergenic
1076292704 10:129360124-129360146 GTACATCGGTGGTCTGGGACTGG + Intergenic
1076491776 10:130866664-130866686 CTACAGCCGTGCCCTGGGAGGGG - Intergenic
1079627795 11:22635888-22635910 CTTCCTCCATGGCCTGGGGCAGG + Intronic
1081275887 11:41148660-41148682 CTAGCTCTCTGGCCTGGAACTGG + Intronic
1083366854 11:62146604-62146626 CTGCCTCTCTGGCCTGGGCCTGG + Intronic
1083712706 11:64559013-64559035 CTACCTCTGTGACCTGGCACTGG + Intronic
1083992865 11:66257712-66257734 CTACCTCGGTGGCGTCGGAGGGG - Intronic
1084268874 11:68018763-68018785 CCAGCTGCGTGGCCTGGGCCGGG - Exonic
1084456379 11:69270266-69270288 CTAACTCAGAGGCCTGGGACAGG - Intergenic
1084570006 11:69953620-69953642 CTACCTGGGTGCCCTGTGACAGG - Intergenic
1089641996 11:119853826-119853848 CTGCCTCTGTGGCCTGTGAGTGG + Intergenic
1097801474 12:63919163-63919185 CCACCTCAGTCTCCTGGGACTGG + Intronic
1102573809 12:113843601-113843623 CTTCCACTGTGGCCTGGGCCCGG - Intronic
1103036894 12:117664164-117664186 CTACTCCCCTGGCCTGGGAGTGG - Intronic
1103186854 12:118965725-118965747 CTATCTCCGTGGTTTGGGGCTGG + Intergenic
1104661040 12:130611580-130611602 TTACCTCCGTAGCCTGGGCTAGG + Intronic
1107058092 13:36128477-36128499 CTAGCTCAGTGACCTTGGACAGG + Intronic
1113899521 13:113788469-113788491 CTGCCTGCGTGGCCTGGCACTGG + Intronic
1114189509 14:20429943-20429965 CTTCCGCTGTGGCGTGGGACTGG - Exonic
1115177412 14:30579740-30579762 CTAACTCCTTGACCTTGGACAGG + Intronic
1115934055 14:38531538-38531560 CTGCCTCCATTGCCTTGGACTGG + Intergenic
1118558305 14:67050888-67050910 CTACCTCCCTTGGCTGGGAGTGG - Intronic
1120836275 14:89040873-89040895 CTGCCTCCCTGGCCCGGGACTGG - Intergenic
1122227251 14:100286915-100286937 CTAGCTGTGTGGCCTTGGACAGG + Intergenic
1122574328 14:102732161-102732183 CTACTTCTGTTGCCTGGGATTGG + Intergenic
1123706865 15:22956846-22956868 GTCCCTCCGTGGCCAGGGGCTGG - Intronic
1124966319 15:34435778-34435800 CTCCCTCTCTGGGCTGGGACTGG - Intronic
1125767709 15:42146291-42146313 CCATCCCCGTGGCCTGGGGCCGG + Intronic
1126841052 15:52717834-52717856 CTACCACCGTGGCCTGGATAGGG + Intergenic
1126890078 15:53195581-53195603 CTACCTCTGTGGGCAGTGACAGG + Intergenic
1127682512 15:61311372-61311394 CTGCCTCCGTGTCATGGGATGGG - Intergenic
1128738465 15:70066883-70066905 CTAGCTGTGTGGCCTGGGGCAGG + Intronic
1128755396 15:70180389-70180411 CTAGCTCCGAGGCCTGGCCCAGG + Intergenic
1128783894 15:70380618-70380640 CTTCCTGTGTGGCCTGGGAAAGG - Intergenic
1132555663 16:570954-570976 CTACCTGCCTGGTCTGGGAATGG + Intronic
1132744987 16:1432785-1432807 CTTCCTCCGTGGCCTCTGCCCGG - Intergenic
1132803711 16:1766254-1766276 CCTCCTCTGTGGACTGGGACGGG - Exonic
1133271245 16:4611798-4611820 CAGCCTCCGTTTCCTGGGACAGG - Intronic
1133596285 16:7296689-7296711 CCACATCCATGGCCAGGGACAGG - Intronic
1135510239 16:23076540-23076562 CTAGCTCTGTGTCCTGGGGCAGG - Intronic
1136025016 16:27463504-27463526 CTGGCTCCGGGGCCTGGGGCGGG - Intronic
1136578524 16:31138731-31138753 CGACTTCCCTGCCCTGGGACAGG + Intergenic
1138241825 16:55433706-55433728 CTAGCTCTGTGGCCTGCTACAGG + Intronic
1138530846 16:57633587-57633609 CTGGCTGTGTGGCCTGGGACAGG + Intronic
1138559891 16:57795141-57795163 CTATCTCTCTGTCCTGGGACAGG - Exonic
1138607545 16:58098623-58098645 CAACAGCCGTGGCCTGGCACTGG + Intergenic
1139346814 16:66309092-66309114 CTGGCTCTGTGGCCTTGGACAGG - Intergenic
1141432508 16:83977704-83977726 CTGCATCTGTGGCCTGGGAGAGG + Intronic
1141483340 16:84321848-84321870 CTTCCTCCGTGGCCTTGAGCAGG + Intronic
1143872500 17:9966953-9966975 CTACCTCCTGATCCTGGGACTGG + Intronic
1144748899 17:17634616-17634638 CCACCTCCGAGGCCAGGGGCTGG - Intergenic
1145045720 17:19614077-19614099 CTTCCTCCGTGGCGTGAGTCAGG - Intergenic
1146352653 17:32108628-32108650 CTAGCTCTGTGGCCTTGGGCCGG - Intergenic
1146456416 17:33013023-33013045 CTCCCTCCGGGGCCTAGGAAAGG - Intergenic
1149362718 17:55911413-55911435 ATGCCTCAGGGGCCTGGGACAGG - Intergenic
1149658440 17:58322546-58322568 CTAGCTCTGAGGCCTGGGCCTGG - Intronic
1152381892 17:79946505-79946527 CACACTCCGTGGCCTGGGGCTGG + Intronic
1152888619 17:82867163-82867185 GCACCTCCGTGGCCTGGGGTGGG + Intronic
1153720463 18:7896456-7896478 CTGCCTCCCTGGCCTCTGACTGG - Intronic
1153984517 18:10340619-10340641 CAACCACAGGGGCCTGGGACAGG + Intergenic
1154491287 18:14924304-14924326 CTAGCTCCGTAGCCAGGGAAAGG - Intergenic
1157052433 18:44182322-44182344 ATACTTCCATAGCCTGGGACTGG - Intergenic
1160866145 19:1256980-1257002 CTACCTCCTTTGCAGGGGACCGG + Exonic
1162547303 19:11338659-11338681 CTGCCTCCGTGGACTGGGGCTGG - Intronic
1162931742 19:13961026-13961048 CTACCTCCGTGGCCTGGGACCGG + Exonic
1163243245 19:16076882-16076904 CTCCTTCCTGGGCCTGGGACAGG + Intronic
1166130863 19:40744786-40744808 CTCCCTCGCTGGCCTGGGAGAGG - Intronic
1166818394 19:45561000-45561022 CTCCCTCCGTGGTGGGGGACCGG + Intronic
1168536819 19:57177729-57177751 CTACCTCAGTGGCCTGGGAGGGG - Intergenic
925023152 2:587689-587711 CTCCCTCCGTGGCATGAAACCGG - Intergenic
926677964 2:15642453-15642475 CAGCCTCCGGGGCCCGGGACCGG - Intergenic
928201088 2:29247783-29247805 CTGCCACCGAGGCCTGGCACTGG - Intronic
930656248 2:54009907-54009929 CTAGCTGAGTGGCCAGGGACAGG - Intronic
933823486 2:86137030-86137052 CTACTTCAATGGCCTGGGAAGGG - Exonic
934715329 2:96539664-96539686 CAACTTCCCTGGCCTGGGTCGGG - Intronic
937083432 2:119156433-119156455 CTACCTCCCTGGCCAGGGCCCGG + Exonic
940859038 2:158753351-158753373 CTAACTCCGTGACCTTGGATAGG - Intergenic
942314973 2:174689812-174689834 CAGCCTCCCTGGCCTGGAACAGG + Intergenic
948778182 2:240300776-240300798 CTCCTGCTGTGGCCTGGGACAGG - Intergenic
1168890668 20:1293775-1293797 CTTCCTCCCTGGCCTGGGGGAGG - Intronic
1171187436 20:23132978-23133000 CCACCTCTGGGGCCTGGGGCTGG - Intergenic
1172188743 20:33048965-33048987 CTTCCTCTGTGGCATGGGCCTGG - Intergenic
1173912769 20:46682579-46682601 CTAACTGAGTGGCCTGGGGCAGG + Intronic
1175927613 20:62478723-62478745 CTAGCTGTGTGGCCTGGGGCAGG - Intergenic
1176386646 21:6141326-6141348 CTGCCTGCGCGGCCTGGGAGCGG + Intergenic
1177198697 21:17930097-17930119 CTCCCTCCTTGGCCTGGCAGTGG - Intronic
1178350001 21:31866116-31866138 CTGCCTCCGTGGCCCTGGGCAGG - Intergenic
1179152963 21:38824484-38824506 CTAGCTGCGTGGCCTTGGACGGG + Exonic
1179736827 21:43396926-43396948 CTGCCTGCGCGGCCTGGGAGCGG - Intergenic
1180166421 21:46033121-46033143 CCCCCTCCGAGGCCCGGGACTGG - Intergenic
1180166436 21:46033156-46033178 CCCCCTCCGAGGCCCGGGACTGG - Intergenic
1180166451 21:46033191-46033213 CCCCCTCCGAGGCCCGGGACTGG - Intergenic
1180166466 21:46033226-46033248 CCCCCTCCGAGGCCCGGGACTGG - Intergenic
1180571402 22:16724787-16724809 CTACCTCTGTGACCTCAGACAGG - Intergenic
1180571414 22:16724861-16724883 CTACCTCTGTGACCTCAGACAGG - Intergenic
1180571421 22:16724897-16724919 CTACCTCTGTGACCTCAGACAGG - Intergenic
1180571428 22:16724934-16724956 CTACCTCTGTGACCTCAGACAGG - Intergenic
1180571435 22:16724971-16724993 CTACCTCTGTGACCTCAGACAGG - Intergenic
1180571442 22:16725008-16725030 CTACCTACGTGACCTCAGACAGG - Intergenic
1180843355 22:18969439-18969461 CCACCTCCATGGCCAGGGGCAGG + Intergenic
1180920299 22:19518257-19518279 CCACCTGCGTGGGCTGGGTCTGG + Intronic
1181058118 22:20269296-20269318 CCACCTCCATGGCCAGGGGCAGG - Intronic
1181514660 22:23403745-23403767 CCACCTCCATGGCCAGGGGCAGG - Intergenic
1181519547 22:23437204-23437226 CTGCCTCCGTGCCCTGGGGCAGG - Intergenic
1181745488 22:24952819-24952841 CTACCTCGTCGGCCGGGGACAGG - Intronic
1183279480 22:36924285-36924307 CCACCGCCGGGGCCTGGGCCTGG + Intronic
1183931779 22:41239608-41239630 GGAGCTCCGGGGCCTGGGACGGG + Exonic
1183971992 22:41484391-41484413 CCAGCTCCCTGGCCTGGTACAGG - Intronic
1184615216 22:45633351-45633373 CGATCTGCCTGGCCTGGGACGGG + Intergenic
1185140454 22:49097957-49097979 GTACCTCCGGGGGCTGGGAGAGG + Intergenic
1185182860 22:49373097-49373119 CTCCCTCCTTGGGCTGGGTCTGG - Intergenic
949332580 3:2938621-2938643 TTACCTCCCTGGCATAGGACTGG + Intronic
949697475 3:6715799-6715821 CTGCCTCAGTCCCCTGGGACTGG + Intergenic
950630341 3:14278063-14278085 CTGACTCTGTGGCCTGGGGCCGG - Intergenic
955347257 3:58170359-58170381 CTACCTGGGTGACCTTGGACTGG - Intronic
957106752 3:75899464-75899486 CTACCTCTGTGACCTCAGACAGG + Intergenic
957106759 3:75899501-75899523 CTACCTCTGTGACCTCAGACAGG + Intergenic
957106766 3:75899537-75899559 CTACCTCTGTGACCTCAGACAGG + Intergenic
957106773 3:75899574-75899596 CTACCTCTGTGACCTCAGACAGG + Intergenic
957106780 3:75899610-75899632 CTACCTCTGTGACCTCAGACAGG + Intergenic
957106787 3:75899647-75899669 CTACCTCTGTGACCTCAGACAGG + Intergenic
957106794 3:75899684-75899706 CTACCTCTGTGACCTCAGACAGG + Intergenic
959943913 3:112107656-112107678 CTAGCACAGTGACCTGGGACAGG + Intronic
962840843 3:139230972-139230994 CTGTCTCTGTGTCCTGGGACAGG - Intronic
964487240 3:157198740-157198762 CTAACTCTGTGGCCTGGCCCAGG + Intergenic
968624634 4:1621626-1621648 CTGCCTCCGTGACCTGGGACAGG - Intronic
969657273 4:8505489-8505511 GTTCCTCCGTGGCCCTGGACAGG + Intergenic
970273500 4:14371782-14371804 CTAGCCCCTTGGCCTAGGACGGG - Intergenic
970599887 4:17633440-17633462 TTAGCTCTGTGGCCTTGGACAGG - Exonic
978490139 4:109303049-109303071 CCACCTCTCTGGCCTGGGCCGGG + Intergenic
981037417 4:140187131-140187153 CTATCCCCGTGGCCTAGGCCAGG - Intergenic
988880070 5:35492583-35492605 CTACCTATGTGGCCTTGGACAGG + Intergenic
994344080 5:98664414-98664436 CTACCTCCCTTGGCTGGGAGTGG - Intergenic
995799548 5:115979161-115979183 ATGCTTCCCTGGCCTGGGACTGG + Intronic
995840453 5:116438875-116438897 TTACCTCCGTGTTCTGTGACGGG + Intergenic
999196778 5:149786836-149786858 CTACTTCTGAGGCCTGGGAGAGG - Intronic
1002043788 5:176531166-176531188 CTGCCTGGGTGGCCTAGGACAGG - Intronic
1005387119 6:25296248-25296270 CTATCTCCCTGTCCTGGGAGAGG + Intronic
1005859467 6:29889450-29889472 CGAGCTCCGTGTCCTGGGTCTGG - Intergenic
1005867031 6:29944243-29944265 CGAGCTCCGTGTCCTGGGTCTGG - Exonic
1005905929 6:30261325-30261347 CAAGCTCCGTGTCCTGGGTCTGG - Intergenic
1007378800 6:41473486-41473508 CTACCTCTGTGCCCTGGGGAAGG + Intergenic
1019227285 6:170523733-170523755 TTGCCTCTGTGGCCTGGGAATGG - Intergenic
1019340469 7:506668-506690 CTACCCCCGAGGCTTGGGTCTGG + Intronic
1019564805 7:1674000-1674022 GTACCCCCGTGGCCTGGAGCAGG - Intergenic
1019591714 7:1839074-1839096 CTGCCTCCGTGCCCTGGGGCAGG + Intronic
1026852662 7:73734948-73734970 CTTCCTCCTTGGCCTGGCAGGGG + Intergenic
1029215916 7:98949563-98949585 CTACCTTGATGGCCTGGAACTGG - Exonic
1029599473 7:101555386-101555408 CTACCTTCGGGCCCTGGGATAGG + Intronic
1031665748 7:124480647-124480669 CTAGCTCCGCGGCCTCGGCCGGG - Intergenic
1038010569 8:23472583-23472605 GTGCCTCAGTGGCCAGGGACAGG + Intergenic
1039270014 8:35869854-35869876 CTGCCTCGGGGGCCTGGCACTGG + Intergenic
1040019006 8:42723714-42723736 CTAGCTGTGTGGCCTTGGACAGG + Intronic
1043160514 8:76840886-76840908 CTACCAGCGTGGCCTGGTGCTGG + Intronic
1048275466 8:133062539-133062561 CTGCCTCCGAGGCCCGGGTCAGG + Intronic
1049531922 8:143159365-143159387 CTTCCTCCAGGGCCTGGAACTGG - Intronic
1049696806 8:143988050-143988072 CTGCCTCAGTAGCCTGGGACTGG + Intronic
1049998358 9:1051630-1051652 CTGGCTCCGCGGCCGGGGACTGG + Exonic
1050035341 9:1429674-1429696 GTACCTCCATGGCCTGGGGTAGG + Intergenic
1050357835 9:4799773-4799795 CTACCTCCCTGGGTTGGGAGTGG + Intronic
1056795188 9:89654214-89654236 CAACCTCCCTGGCAGGGGACAGG - Intergenic
1058094487 9:100843979-100844001 CACCCTCCGTGGGCTGGGAAAGG + Intergenic
1058868914 9:109185883-109185905 CTACCTACCAGGCCTGGGAATGG - Intronic
1061000506 9:127899646-127899668 CCACCTCCCAGGCCTGGGCCGGG - Exonic
1061275907 9:129569234-129569256 CTCCCTCCCTGGCCTGGCCCCGG - Intergenic
1062023965 9:134332020-134332042 CCAGCTCTGTGCCCTGGGACTGG + Intronic
1188669681 X:32868136-32868158 CTACCTCCCTTGGCTGGGAGTGG - Intronic
1189974507 X:46447766-46447788 CTACCTACGTGACTTTGGACAGG - Intronic
1190069334 X:47266566-47266588 CTGTCTCCATGGCCTGGCACTGG + Intergenic
1190597849 X:52065064-52065086 CTGCCTGCCTGGCCTGGGCCTGG - Intronic
1190610975 X:52189009-52189031 CTGCCTGCCTGGCCTGGGCCTGG + Intronic
1198506147 X:137303192-137303214 CTAGCTCTGTGGCCTTGGGCAGG - Intergenic