ID: 1162932039

View in Genome Browser
Species Human (GRCh38)
Location 19:13962258-13962280
Sequence CCTGAGCCCCGGGCCGGCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 455
Summary {0: 1, 1: 0, 2: 10, 3: 42, 4: 402}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162932039_1162932048 -6 Left 1162932039 19:13962258-13962280 CCTGCGCCGGCCCGGGGCTCAGG 0: 1
1: 0
2: 10
3: 42
4: 402
Right 1162932048 19:13962275-13962297 CTCAGGGCTGGGCCCAGGACAGG 0: 1
1: 1
2: 8
3: 81
4: 663

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162932039 Original CRISPR CCTGAGCCCCGGGCCGGCGC AGG (reversed) Exonic