ID: 1162932039

View in Genome Browser
Species Human (GRCh38)
Location 19:13962258-13962280
Sequence CCTGAGCCCCGGGCCGGCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 455
Summary {0: 1, 1: 0, 2: 10, 3: 42, 4: 402}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162932039_1162932048 -6 Left 1162932039 19:13962258-13962280 CCTGCGCCGGCCCGGGGCTCAGG 0: 1
1: 0
2: 10
3: 42
4: 402
Right 1162932048 19:13962275-13962297 CTCAGGGCTGGGCCCAGGACAGG 0: 1
1: 1
2: 8
3: 81
4: 663

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162932039 Original CRISPR CCTGAGCCCCGGGCCGGCGC AGG (reversed) Exonic
900110187 1:1001969-1001991 CCTGAGCGCTGGGCCCGGGCGGG + Intergenic
900295631 1:1947752-1947774 GCTGAGCCCGGGGCAGGCTCTGG - Intronic
900630647 1:3633424-3633446 CCGCCGCCCCGGGCCGGGGCCGG - Exonic
900712396 1:4122643-4122665 CCAGAGCCCCGGGCCAGCTGGGG + Intergenic
901068936 1:6507769-6507791 CCCTGGCCCCGTGCCGGCGCGGG - Intronic
901490985 1:9596091-9596113 CATGAGCCCCGGGGCAGGGCAGG - Intronic
902044272 1:13513552-13513574 CCCGAGCGCCGCGGCGGCGCAGG + Exonic
902939682 1:19791741-19791763 CCTGAGCCCCAGGGCGCTGCTGG - Intronic
903263165 1:22142270-22142292 CCAGGGCCCGGGGCTGGCGCTGG - Intronic
903448485 1:23437236-23437258 CCAGGACCCCGGGCCAGCGCTGG + Exonic
906027207 1:42683184-42683206 CCCGCGCCCCGGGCCTGCCCTGG + Intronic
906480879 1:46198260-46198282 CCTGAGCCCTCGGGCGGCTCCGG - Intronic
907278076 1:53327909-53327931 CCGGAGCCCCGGGCCCGCCATGG - Exonic
907311270 1:53540428-53540450 CCTGAGCCCCAGGCCATCCCTGG - Intronic
910251461 1:85201795-85201817 CCGGAGCCCCGGGCCGCGACGGG + Intergenic
912450560 1:109765233-109765255 CCTGAGCCCCAAGCCAGGGCTGG - Intronic
912505065 1:110150655-110150677 CCTGAGCCCCGAGCGCGCGGCGG + Exonic
912576050 1:110674107-110674129 CGAGAGCTCCGGGCCGGCCCGGG - Exonic
915740266 1:158113705-158113727 CCGGAGCCCGAGGTCGGCGCGGG + Intergenic
915903490 1:159862461-159862483 CCTGAGCCCAGGTACGGGGCTGG - Exonic
918048214 1:180953962-180953984 CCTGAGGGCGGGGCGGGCGCGGG - Intergenic
918275778 1:182952902-182952924 CCTGAGCCGCGGGCAGGCGCTGG + Exonic
918355149 1:183700909-183700931 CCTGAGCCCCTGACAGGCCCCGG + Intronic
921155006 1:212432783-212432805 CCTGCGCCCCGGGGTGGGGCTGG - Intergenic
922116468 1:222618353-222618375 CCGCAGCCCCTGGCCGGCCCGGG + Intronic
922526658 1:226309297-226309319 CCTCCTCCCCGGGCAGGCGCGGG - Exonic
922615444 1:226958535-226958557 CATGAGCCCTGGGCCAGGGCAGG + Intronic
922739393 1:228006926-228006948 GCCGAGGCCCGGGGCGGCGCGGG - Intergenic
922795248 1:228336513-228336535 TCTGTGCCCAGGGCCGGCCCAGG - Intronic
923546731 1:234928782-234928804 CCTGTGCCACGGGCCTGCCCCGG - Intergenic
924172439 1:241356756-241356778 CGGGAGCCCCGCGCCGGGGCTGG - Intronic
924593623 1:245426669-245426691 CCTGACCCCAGGGCCTGAGCGGG - Intronic
1062858435 10:791235-791257 CCTGAGCACAGGGCCGGGCCTGG + Intergenic
1063504022 10:6580181-6580203 CCCGCGCCCCGCGCCGCCGCCGG - Intronic
1064462965 10:15552688-15552710 CCTCACCCCCGGGCAGGCCCCGG + Intronic
1066080805 10:31928850-31928872 CGTGAGCCCCGCCCCCGCGCCGG - Intronic
1066220553 10:33334236-33334258 CCTGAGCCCCGGTCCGGGGCGGG + Intronic
1067225531 10:44373667-44373689 CCTCAGCCCCACGCCGGTGCCGG - Intronic
1067705993 10:48606869-48606891 CCTGAGCCCCAGGCTGACTCAGG + Intronic
1071573809 10:86711746-86711768 CCTGAGGCCCGGGAGGGGGCGGG + Intronic
1072021802 10:91410174-91410196 CGCGAGCCCCGGGCGGGCGGGGG + Intergenic
1072151780 10:92689995-92690017 CCCGCACCCCGGGCCGGCGGCGG + Exonic
1072188613 10:93063429-93063451 CCTGGGTCCGGGGCTGGCGCTGG - Intronic
1073290101 10:102409212-102409234 CGTGAGAGCCGGGCCGGCTCGGG - Intronic
1074182608 10:111077400-111077422 CCCCAGCCCCGGGCCGGGCCGGG + Exonic
1075501731 10:122980716-122980738 CCTGGGCCGCGGGGCGGGGCGGG + Intronic
1075572783 10:123557635-123557657 GCTGAGCCCCAGGCCAGGGCAGG + Intergenic
1076231491 10:128823304-128823326 ACTGAGCCCCGGGCTGCTGCAGG + Intergenic
1076279341 10:129232529-129232551 CCTGCACCCCGGGCAGGGGCAGG - Intergenic
1076818449 10:132926137-132926159 CCTGACGCCAGGGCCGGCGGTGG + Intronic
1077213291 11:1383271-1383293 CCTGATCCCCGCACCGGCACCGG - Intergenic
1077214627 11:1390251-1390273 CGGGCGCCCCTGGCCGGCGCCGG + Intronic
1077233328 11:1468379-1468401 CCTGAGGCAGGGACCGGCGCTGG - Intergenic
1077366714 11:2164169-2164191 CCTGAGCTCCGGGACAGTGCAGG + Exonic
1078729636 11:13963325-13963347 CCAGCGTCCCGGGCCGTCGCGGG + Intronic
1079122518 11:17695914-17695936 CCGCAGCCCCGGCCCGGCCCCGG - Intergenic
1081757785 11:45556973-45556995 CCAGAGCCCTGGGCTGACGCAGG - Intergenic
1081812729 11:45922623-45922645 CCTGAGCCCAGGTCGGGGGCGGG + Intronic
1083782291 11:64924838-64924860 ACTCAGCCCCGGGCCGGGACTGG - Exonic
1084086305 11:66856905-66856927 CCCGAGGCCCGGGCCGGCGCGGG - Intronic
1084129175 11:67119735-67119757 CCTGCGGCCGGGGCCGGCCCGGG + Exonic
1084129178 11:67119742-67119764 CCCGAGCCCCGGGCCGGCCCCGG - Exonic
1084165583 11:67373421-67373443 CGGGAGCCCCGCGCCGGGGCCGG - Intronic
1084181959 11:67451322-67451344 CCTGCGCCCGGGGCCGCCTCTGG + Exonic
1084430025 11:69105883-69105905 GCTGAGCCCCGGGCTGGCAGAGG - Intergenic
1084595090 11:70112077-70112099 CCAGAGCCCCGGGCCAGCTGGGG - Intronic
1084642932 11:70436645-70436667 CCTGCGCCCCGGACCTGGGCTGG + Intergenic
1084888120 11:72223828-72223850 CCGGCTCCCCGGGGCGGCGCGGG + Intronic
1085284368 11:75350510-75350532 GCTGAGCCCCTGACCAGCGCTGG + Intronic
1085987751 11:81806883-81806905 CCTGAGTCCGTGACCGGCGCCGG - Intergenic
1087118113 11:94544987-94545009 CCAGGCCCCCGGGCCAGCGCTGG + Exonic
1088383374 11:109221386-109221408 CCTGAGCCCCTGGCCGGAGTTGG + Intergenic
1088480878 11:110296068-110296090 ACTGGGCCCCGGGCCCGGGCTGG - Intronic
1088893037 11:114059532-114059554 GCTGAGCCCGGGGACGGCGCGGG + Intergenic
1089533855 11:119149219-119149241 CCGGCGGCCCGGGCCGGGGCGGG - Exonic
1089564717 11:119364433-119364455 CCTGAGGCCCTGGCCGGCCTCGG + Intronic
1089622234 11:119728728-119728750 TCCGGGCCCCGGGCCGCCGCCGG + Exonic
1090107791 11:123870328-123870350 CCTGAGTCCGTGACCGGCGCCGG + Intergenic
1091434012 12:459896-459918 CCTGTGCCCGGGGCGGGGGCGGG + Intergenic
1091651994 12:2317761-2317783 CCAGAGCCTCTGGCCTGCGCAGG - Intronic
1094844360 12:34354946-34354968 CCTGGGCCCCGCGCATGCGCAGG + Intergenic
1095419969 12:42015319-42015341 CCTGAGCCCTGGGCTGGAGTGGG - Intergenic
1096465848 12:51847582-51847604 CCTGCGCTCCGGGCCGCCGCTGG + Intergenic
1096514207 12:52147350-52147372 CCTGAGCCCTGGGCTGGGGTGGG + Intergenic
1096550701 12:52369955-52369977 GCTGAGCCCAGGGCTGGGGCTGG + Intergenic
1097107692 12:56635026-56635048 CCCCAGCCCTGGGCCGGCGGCGG + Intronic
1099502661 12:83432688-83432710 CCTGAGCCCCTGGCTGGAGTTGG + Intergenic
1100260492 12:92928792-92928814 ACGGAGCCCCGCGCCGGAGCGGG + Intronic
1100594624 12:96061222-96061244 CTTGAGGCCGGGGCCGTCGCTGG + Intergenic
1101089475 12:101270383-101270405 CCTGAGCCGCGGACCGGTACCGG + Intergenic
1102527422 12:113521690-113521712 CCTGACCCCCAGGCCGGGTCAGG + Intergenic
1103410990 12:120711031-120711053 CCTCGGCCCCCGGCCGGCTCAGG - Intronic
1103415911 12:120741424-120741446 CCTGAGCCCAGGGCAGGGACAGG - Intergenic
1103433011 12:120904059-120904081 CCTGGGCCCCGGGGCGGGGCGGG + Exonic
1103509713 12:121466564-121466586 TGCGAGCCGCGGGCCGGCGCGGG - Intronic
1103940580 12:124499362-124499384 GCTGAGCCCCGGGCTAGTGCTGG + Intronic
1104901851 12:132193693-132193715 CCTGAGCCCAGGGACTGTGCTGG + Intergenic
1105074526 12:133264216-133264238 TCTGCGCCCCGCGCCGGCGCGGG + Intergenic
1105403881 13:20118454-20118476 CCTGAGCACCCGGCCTGCCCAGG + Intergenic
1108202419 13:48057080-48057102 CCTGAGTCCGTGACCGGCGCCGG - Intronic
1108206440 13:48094918-48094940 CCTGAGAGCCGGGCTGGAGCTGG - Intronic
1108690053 13:52851433-52851455 CGTGAGCTCCGGGCCGGCAGCGG + Intergenic
1109829923 13:67773028-67773050 CCTGAGCCCCCGCCCCGCGGTGG - Intergenic
1110630196 13:77698198-77698220 CCTGGGGCTCGGGCTGGCGCTGG + Intronic
1112344398 13:98577403-98577425 CGTGCCCACCGGGCCGGCGCCGG + Intronic
1113470515 13:110541671-110541693 GCTGAGCCCCAGGCAGGCGAAGG - Intronic
1113910079 13:113837576-113837598 CCTCAGCCCAGGGCCAGAGCTGG - Intronic
1113989864 13:114352892-114352914 CCAGCGCCCCGTGCTGGCGCCGG - Intergenic
1113994451 14:16054830-16054852 CCCGACCCCCTGGCCGGGGCCGG - Intergenic
1114270667 14:21098309-21098331 CACGAGCCCCGGGCGGGCGGCGG + Exonic
1114551102 14:23533367-23533389 CCTCAGCCCCGGGCCAGCCAAGG + Exonic
1114792223 14:25672383-25672405 CCTGAGCCCCGGGAGTGCTCTGG + Intergenic
1115119882 14:29927202-29927224 CCTGCGCCGCGGGGAGGCGCCGG + Intronic
1115120060 14:29927860-29927882 CCCGAGCGCCGGGCGGGGGCCGG + Intronic
1115511881 14:34145949-34145971 CCTGAGCCCCCGACAGGCCCTGG - Intronic
1115701970 14:35962655-35962677 CTTGAGCCCAGGGGCAGCGCAGG - Intergenic
1115985781 14:39102897-39102919 GCTGAGGCCCGGTCCGGCGCGGG - Intronic
1116817913 14:49599927-49599949 GCTGAGCCCGGGGCCGGGGCGGG + Intronic
1118285260 14:64465373-64465395 CCGGAGGCGCGGGGCGGCGCGGG - Intronic
1118610124 14:67533288-67533310 CCGGAGTCCCGGGCTGCCGCCGG - Exonic
1119759601 14:77141346-77141368 CCTCAGCCCTGGCCCTGCGCGGG + Intronic
1121587008 14:95069329-95069351 CCTGAGCCCAGCGCCTGCGAGGG - Intergenic
1121776189 14:96592689-96592711 ACTGAGCCGAGGGCCGGCGCGGG - Intergenic
1122264695 14:100541130-100541152 CCTCAGGCCCAGGCGGGCGCTGG + Intronic
1122293486 14:100692327-100692349 CCTCAGTCCCTGCCCGGCGCCGG + Intergenic
1122300111 14:100726798-100726820 CGTGCGCACGGGGCCGGCGCCGG - Intronic
1122898538 14:104772492-104772514 CCTGAACCCAGGGCCTGGGCAGG - Intronic
1123421984 15:20142356-20142378 CCTCTGCCCTGGACCGGCGCTGG - Intergenic
1123531212 15:21148896-21148918 CCTCTGCCCTGGACCGGCGCTGG - Intergenic
1124109323 15:26772500-26772522 CCCGCGCCCCGCGCCGGAGCTGG - Intronic
1124496730 15:30191906-30191928 CCTGAGGCGCGGGCGGACGCGGG - Intergenic
1124746846 15:32346741-32346763 CCTGAGGCGCGGGCGGACGCGGG + Intergenic
1125484070 15:40100288-40100310 CCTGAGCCCCTGGGCTGCCCTGG - Intronic
1126109501 15:45167293-45167315 CGTCAGCCCGGGGACGGCGCCGG + Exonic
1126167081 15:45662798-45662820 GCTGAGCCCAGGGCAGGGGCAGG + Intronic
1126530391 15:49704010-49704032 CCTGAGTCCAGGACTGGCGCCGG + Intergenic
1127433287 15:58933199-58933221 CCCGCGCCCCGGGCCGGGCCGGG - Intronic
1128028654 15:64460790-64460812 CCGGGGCCCCGGGCGGGCGGAGG + Intronic
1128199530 15:65792508-65792530 CCCGAGCCCCAGGCTGGCGTGGG + Intronic
1128322582 15:66703538-66703560 TCGGAGCCAGGGGCCGGCGCTGG + Exonic
1128482958 15:68054989-68055011 AGCGAGCCCCGGGCCGGCGTTGG + Intronic
1128501250 15:68229187-68229209 CCAGCGACCCGGGCTGGCGCCGG - Intronic
1128521502 15:68377955-68377977 CCTGAGTCCAGGGCCTGTGCAGG + Intronic
1128612749 15:69087218-69087240 CCTGCACCCCTGGCCGGAGCTGG + Intergenic
1129231364 15:74198946-74198968 CCTGAGCTCAGGGCTGGCCCTGG + Intronic
1129273863 15:74433199-74433221 CCCGAGCTCCGGGCCGGGGCGGG + Intronic
1129539107 15:76336708-76336730 CACTAGCCCCGGGCCGGAGCTGG - Exonic
1129654015 15:77510767-77510789 CCTGAGCCAGGGGCTGGCCCAGG + Intergenic
1129791204 15:78341629-78341651 CCAGGGACCCGGGCGGGCGCGGG - Intronic
1130305326 15:82709426-82709448 CTGGAGCCCCGGCCCAGCGCGGG - Intronic
1130335369 15:82952951-82952973 CCAGGGCCCCGGGTCGGCGTGGG - Intronic
1131272809 15:90957201-90957223 GCTGCGCGCCGGGCCGGGGCCGG + Exonic
1132566413 16:625562-625584 CCTGGGCCCCGGGTAGGCTCTGG + Intronic
1132661047 16:1061655-1061677 CCTGAGCCCCGGGGAGGAGCTGG + Intergenic
1132728293 16:1348279-1348301 CCTGGGCTCTGGGCCGGCACAGG - Exonic
1132743902 16:1428856-1428878 CCTGAACCCCAGGCAGCCGCAGG + Intergenic
1132779372 16:1614368-1614390 CCAGACGCCCGGGCCGGCGGCGG - Intronic
1132804594 16:1769643-1769665 CCTGAGGCCTGGGCCTGCCCTGG - Exonic
1132915280 16:2340577-2340599 CCTGGGCGCCGGGGCGGCGGCGG + Exonic
1132947175 16:2538093-2538115 CATGGGCCCCGCGTCGGCGCGGG - Exonic
1132950262 16:2557844-2557866 GCCGAGCCTCGGCCCGGCGCCGG + Exonic
1132964084 16:2642326-2642348 GCCGAGCCTCGGCCCGGCGCCGG - Intergenic
1133129952 16:3670875-3670897 CCTGTGCCGCGGGCAGGAGCAGG - Intronic
1135016079 16:18926122-18926144 CCTCAGCCCCGGGCCGGAGCGGG - Exonic
1135321705 16:21501967-21501989 TCTCAGCCCCGGGCCGGAGCGGG - Intergenic
1135437263 16:22437298-22437320 CCTCAGCCCCGGGCCGGAGCGGG + Intergenic
1136110970 16:28063512-28063534 CCCGAGCCCCGGGGCGCGGCGGG - Intergenic
1136333169 16:29595047-29595069 CCTCAGCCCCGGGCCGGAGCGGG - Intergenic
1136447863 16:30335113-30335135 CCTCAGCCCCGGGCCGGAGCGGG - Intergenic
1136455614 16:30378266-30378288 CCGTAGCCCCGCCCCGGCGCTGG - Exonic
1137738431 16:50742154-50742176 CCCGCGTCCCGGGCCGGCCCCGG - Intronic
1138572381 16:57884220-57884242 CATGAGCCCGGGCCCGGAGCCGG - Exonic
1140156018 16:72427439-72427461 GCTGAGCCAGGGGCAGGCGCTGG + Intergenic
1141658337 16:85428234-85428256 CAGGAGCCCAGGGCCGGGGCTGG - Intergenic
1141839493 16:86565773-86565795 CCCGTGGCCCAGGCCGGCGCCGG - Intergenic
1142009731 16:87707734-87707756 CCTCTGCCCCGGGCCAGGGCTGG - Intronic
1142191324 16:88719548-88719570 CCTGGGCCCAGGGCGGGGGCCGG - Intronic
1203124327 16_KI270728v1_random:1561467-1561489 CCTCTGCCCTGGACCGGCGCTGG + Intergenic
1142876161 17:2853250-2853272 CCTGAGCCCGGCGCCCGCCCCGG - Intronic
1143150851 17:4807107-4807129 CCTGAGCCCCGGCCCCGCCTCGG + Exonic
1143340603 17:6207949-6207971 CCTGAGCTCCGGGGCCGCCCTGG + Intergenic
1144773301 17:17771322-17771344 CATGAGCCCCTGGCCTGAGCAGG + Intronic
1145197620 17:20908591-20908613 CCTGAGCCCCAGCGCAGCGCAGG + Intergenic
1146171657 17:30639135-30639157 CCTGAGCCCCGGGGAGGCTGAGG - Intergenic
1146627014 17:34442588-34442610 CCTGACCCCCAGGCCAGCGCTGG + Intergenic
1146912565 17:36658048-36658070 CCAAGGCCCCGGGCCGGTGCGGG + Intergenic
1147141565 17:38463416-38463438 CCTGAGCCCTGGGGCAGCACCGG + Intronic
1147646355 17:42036663-42036685 CCTGAGCCCCTTGCTGGCCCTGG - Intronic
1147648863 17:42050669-42050691 CCCGGGACCCTGGCCGGCGCTGG - Intronic
1147971165 17:44219710-44219732 GCTGAGGCCGGGGCCGGCGGCGG - Intronic
1149685366 17:58531816-58531838 CCTGTGCCCGGGGCCGGCGACGG + Intronic
1150692388 17:67377533-67377555 GCCGAGCCCCGGAGCGGCGCGGG + Intronic
1150747319 17:67825984-67826006 CCAGCGCCCCGGGCCGGGGGGGG + Exonic
1151332662 17:73420075-73420097 GCTGAGCCCCAGGCAGGAGCAGG + Intronic
1151534163 17:74729387-74729409 CCTGAGCCCAGGCCCAGAGCTGG - Intronic
1151654632 17:75490182-75490204 CCTGAGCTCCGGGCCTGGGGAGG - Intronic
1151969789 17:77451647-77451669 CCTGGGCCCCGGCCCGAGGCCGG + Intronic
1152386370 17:79977261-79977283 CCTGTGCACCGGGCCGTCTCTGG - Intronic
1152413897 17:80146692-80146714 CCGGAGCGCAGGGCCGGCCCGGG + Intronic
1152592987 17:81222768-81222790 GCTGCGCCCCCGGCCCGCGCAGG - Exonic
1152608098 17:81303062-81303084 CCAGAGCACCAGGCCGGGGCAGG - Intergenic
1152654824 17:81514645-81514667 CCTGAGCCGCGGGGAGGGGCGGG + Intronic
1152900573 17:82938674-82938696 TCTGAGCCCCGGGCCCACCCTGG - Intronic
1154173822 18:12068582-12068604 CCTGCGGCCGGGGCCGGAGCTGG - Intergenic
1156924282 18:42557354-42557376 CCTGAGTCCATGACCGGCGCTGG + Intergenic
1157279161 18:46334406-46334428 CCTGAGCCCCCGGCCGCCCGCGG - Intronic
1157777120 18:50404330-50404352 TCAGAGACCAGGGCCGGCGCAGG - Intergenic
1157856620 18:51110448-51110470 CCCCAGCCCGGGGCAGGCGCTGG - Intergenic
1158954381 18:62524447-62524469 CCCGAGCCCCAGCCCGGCGCAGG + Intronic
1160499735 18:79395802-79395824 CCTGCTGCCCGGGCCCGCGCGGG - Intergenic
1160691054 19:460846-460868 CCTGGGCCGCGGCCCGGCGGCGG - Exonic
1160932876 19:1578820-1578842 GCTGAGCCCCGGGGAGGCTCAGG - Intronic
1161014361 19:1976319-1976341 CCTGAGCCCGGGACCAGGGCTGG - Intronic
1161242088 19:3228317-3228339 CCTGAGCCCCTGGCCTGGGGTGG - Intronic
1161581038 19:5081264-5081286 CCTGAGCCCCGGGGTGCAGCAGG + Intronic
1161620076 19:5293091-5293113 CCCGAGGCCCGGGCCGCCCCGGG - Intronic
1161768660 19:6219975-6219997 TCTGAGCCCCGGGCGTGCTCCGG - Intronic
1162413095 19:10517994-10518016 CCTGAGCCGGGGGCGGGAGCGGG - Intergenic
1162445228 19:10718588-10718610 CCTGGGGCCCGGGCCTGCTCCGG - Intronic
1162495147 19:11019355-11019377 CCTCAGGCCCCGGCCGCCGCTGG + Intronic
1162523488 19:11194922-11194944 CCTCAGCCCAGGCCCGGAGCTGG + Intronic
1162781371 19:13008633-13008655 CCTGAGCTCCAGGCCTGGGCAGG - Intronic
1162932039 19:13962258-13962280 CCTGAGCCCCGGGCCGGCGCAGG - Exonic
1162935617 19:13980159-13980181 GCAGAGCCCTGAGCCGGCGCAGG - Intronic
1162944161 19:14032150-14032172 CCGGAGCCCCGGGGCGGGGTGGG + Intronic
1162964577 19:14149861-14149883 CCTGCGGCCCGGGCCAGCCCGGG - Exonic
1163218883 19:15899956-15899978 CCTGAGCCCCCGGCCTCCGTAGG + Intergenic
1163361072 19:16846780-16846802 CCTGAGCCCCGGCCATGGGCAGG - Intronic
1163438589 19:17310035-17310057 CCTGGGCCCCGGGGCGGGGGAGG + Intronic
1163462616 19:17448159-17448181 CCTGGGCGCCGAGCTGGCGCGGG - Exonic
1163631344 19:18419445-18419467 CCTGCGGCCGGGGCCGGAGCTGG + Exonic
1163723618 19:18910218-18910240 CCTGAGCCACAGGCCAGCGTTGG - Intronic
1164134922 19:22405931-22405953 CCTGAGCCCCTGGCTGGAGTTGG - Intronic
1164169119 19:22709071-22709093 CCTGCGCCTCTGACCGGCGCTGG + Intergenic
1164671381 19:30074015-30074037 CCTAAGTCCAGGGCCGGGGCAGG - Intergenic
1164834855 19:31350141-31350163 CGTGGTCCCCGGGCCGGGGCTGG + Intergenic
1165452156 19:35889997-35890019 CCTGCCCCCTGGGCCGGCCCAGG - Exonic
1167070952 19:47221723-47221745 CCTGACACCCTGGCCAGCGCGGG - Exonic
1167105979 19:47430044-47430066 CCCTAGCCCCGGGCGGGCGGTGG + Exonic
1167146334 19:47682316-47682338 CCTGAGACCAGGGCCGGCCCTGG + Intronic
1167437194 19:49486345-49486367 CTGGAGCCCCGGGCCGGCGCTGG + Intergenic
1167636544 19:50659138-50659160 CCTGACGCCCGGGCGGGCCCCGG + Exonic
1168728569 19:58606505-58606527 CCAGCGCCCCGTGCTGGCGCAGG - Intergenic
925730534 2:6917319-6917341 TCCGGGCCTCGGGCCGGCGCAGG + Intergenic
926077085 2:9950884-9950906 CGCGCGCCCCGGGCCGGCCCCGG - Intergenic
926205223 2:10830839-10830861 CCTGAGCCACCAGCCGGCGGGGG - Intronic
927658435 2:24971688-24971710 GCTGAGACCCGGGCCTGCTCGGG + Intronic
927891197 2:26750672-26750694 TCAGAGGCCGGGGCCGGCGCGGG + Intergenic
928167025 2:28979153-28979175 CCTGAGCCCCGGGCCTCTGGGGG - Intronic
929584472 2:43105190-43105212 CCTGAGCCCCAGGTCAGCCCTGG + Intergenic
929588626 2:43131337-43131359 TCTGAGCCCGGGGCTGGCTCAGG + Intergenic
929966906 2:46542983-46543005 GCTGAGCCCGGGGCCGGGGCGGG + Exonic
930025146 2:47025143-47025165 GCTGAGCTCCAGGCCGGCGGAGG + Intronic
930031848 2:47063118-47063140 CCTGAGCCTCAGGCCAGCACAGG - Intronic
932416310 2:71575603-71575625 CCTGAGCACTGGGCAGGGGCTGG + Intronic
932496579 2:72148617-72148639 ACAGAGCCCCGGGCGGGCGATGG + Intergenic
932567930 2:72921054-72921076 CCTGAGCCCCTGGCCGGCGGCGG + Intronic
934238862 2:90251374-90251396 CCTCTGCCCTGGACCGGCGCTGG + Intergenic
935219772 2:101002401-101002423 CCGGAGCCCCGGGCTGGCTCGGG - Intronic
935556053 2:104510614-104510636 CCTGACCCCCGGGCAGGCCCCGG - Intergenic
935645334 2:105329677-105329699 CAGGAGCCGCGGGCCGGAGCGGG - Exonic
937221738 2:120346056-120346078 GCGGAGGCCCGGGCGGGCGCGGG + Intergenic
938455663 2:131460935-131460957 GCTGAGCCCGGGGCCGGGGCGGG + Intergenic
940036898 2:149320733-149320755 CCTGAGCCCCAGGGCCGCGGGGG + Intergenic
940971992 2:159904838-159904860 CCTCGGCCCCGGGGCGGAGCGGG + Intergenic
941935010 2:170975276-170975298 CCTGAGACCCGGGCAGGTGTGGG + Intergenic
944495874 2:200306880-200306902 CCTCCGTCCCGGGCCGGAGCCGG - Intronic
946235582 2:218322961-218322983 CCTGAGCCCTGGGAAGGGGCAGG - Intronic
947582575 2:231330684-231330706 CCTGAGGCCCTTGCTGGCGCAGG + Intronic
948046831 2:234951874-234951896 CCGAAGCCCCGCCCCGGCGCGGG + Intergenic
948403539 2:237701533-237701555 CCTGAGCCCCCAGCCTGAGCCGG + Intronic
948473723 2:238203418-238203440 CCTGAGGCCCGGGGCGGCTGAGG - Intronic
948806583 2:240455822-240455844 CCTGTGGCCCCGGCCTGCGCCGG + Intronic
948806589 2:240455835-240455857 GCGGAGCTCCGGCCCGGCGCAGG - Intronic
948824852 2:240569114-240569136 CGTGAGTCCGGGGCGGGCGCCGG + Exonic
1171439715 20:25150251-25150273 CCTGTGCCCCAGGCCAGCCCAGG + Intergenic
1171452836 20:25248022-25248044 CCTGCGCGCCGCGCCGGGGCGGG - Intergenic
1171865931 20:30487700-30487722 CCCGACCCCCCGGCCGGGGCCGG + Intergenic
1172005267 20:31815313-31815335 CCTGAGCCCAGGGCCTTGGCAGG - Intergenic
1172389613 20:34558335-34558357 CCTAAGCCCCGTGAAGGCGCCGG + Intronic
1172618777 20:36306619-36306641 CCTGAACCGGGGGACGGCGCTGG + Intronic
1173856024 20:46251301-46251323 CCTGGGCCCCAGCCCCGCGCAGG - Exonic
1174058399 20:47815369-47815391 CCTGAGTCCAGGGCAGGTGCTGG - Intergenic
1174576670 20:51542319-51542341 CCTGAGCCCCTGGCGGGCTCAGG + Intronic
1174747750 20:53080762-53080784 CCTGGGCCGCGGGCCGGTACAGG - Intronic
1175367655 20:58466998-58467020 CCAGAGCCCTGGGCAGGCCCAGG + Intronic
1175847201 20:62065286-62065308 CCCGGGGCCGGGGCCGGCGCGGG + Exonic
1175877799 20:62238654-62238676 CCTGGGCCGCGGGCTGGGGCTGG + Intronic
1175918320 20:62437988-62438010 GCTGAGCCCCGGGCAGTCGGTGG - Intergenic
1176091460 20:63320252-63320274 TCTGAGCCCCGGGGCTGAGCCGG + Intronic
1176387916 21:6148462-6148484 TCTGAGCCCCGGGCGGGAGAGGG - Intergenic
1178487139 21:33026298-33026320 TCTGGGCCCCGCGCCGGCTCTGG + Exonic
1178840718 21:36135651-36135673 GCTGAGCCCCAGGCGGGCCCGGG + Intronic
1179631268 21:42680104-42680126 CCTGAGCCCGGGGGCAGCGGAGG - Intronic
1179675113 21:42975321-42975343 CCTCAGCCGGGCGCCGGCGCGGG + Intronic
1179735556 21:43389786-43389808 TCTGAGCCCCGGGCGGGAGAGGG + Intergenic
1179997383 21:44980279-44980301 CCTCAGCCCCGGGCAGGCCCAGG + Intergenic
1180032982 21:45224664-45224686 CGGGAGCCCTGGGCCGGGGCAGG + Exonic
1180091155 21:45534405-45534427 CCTGTGCCCCGGCCAGGGGCTGG - Intronic
1180312640 22:11252574-11252596 CCCGACCCCCCGGCCGGGGCCGG + Intergenic
1180699623 22:17774294-17774316 CCTGAGCTCCACGCCGGGGCAGG + Intronic
1180699720 22:17774566-17774588 CCACAGCCCCGCGCCGGCGCGGG - Intronic
1180960100 22:19758679-19758701 CCTGCGCACCGGCCGGGCGCAGG - Intronic
1182338985 22:29603984-29604006 CCTGAGCCCCGCGCCATGGCCGG + Exonic
1182355281 22:29720042-29720064 CCTGAGCGCCGGGCCGGTAGCGG + Intergenic
1183107039 22:35622315-35622337 TCTGAGCCCTGGCCTGGCGCTGG - Intronic
1183293706 22:37018147-37018169 CCTGGGCACCGAGCCGGAGCCGG - Exonic
1183411760 22:37659073-37659095 CCGGAGGCCCGGGCAGGCGCTGG - Exonic
1183466253 22:37981840-37981862 GCTGAGCCCTGGGCCTGCCCTGG + Intronic
1184039260 22:41933528-41933550 CCAGAGCCCCGGACCTGCACAGG - Intergenic
1184465877 22:44668724-44668746 CCGGAGCCCGGGGCCGGGGGAGG - Intronic
1184782402 22:46655851-46655873 CCTGAGCCCTGGGGAGGCACCGG + Intronic
1185226492 22:49656613-49656635 CCTGATCACCGGGCAAGCGCGGG - Exonic
1185230587 22:49678300-49678322 CTGGAGCCCCAGGCCGGCTCAGG + Intergenic
1185313823 22:50170428-50170450 CCTGACCCCGGGGGCGGCGGCGG + Intergenic
1185340192 22:50287618-50287640 CCTGGGCCCCAGGCCGGGCCAGG - Intronic
1185399203 22:50607262-50607284 CCTGAGCCCCAGGCCCACTCAGG - Intronic
950548985 3:13655202-13655224 CCGCAGCCCCTGGCCGGGGCTGG + Intergenic
950578856 3:13850132-13850154 CCTGTGCCCAGGGGCGGGGCAGG + Intronic
951816620 3:26761955-26761977 CCTGAGCCTCAGGCCAGCCCAGG - Intergenic
952962889 3:38603882-38603904 CCTGGGCACTGGTCCGGCGCAGG + Exonic
953391508 3:42536373-42536395 TCCGAGCCCAGGGCCGGGGCTGG - Exonic
954110038 3:48428814-48428836 CCTGACCCCCGGGCGGGTGGGGG - Intronic
954147187 3:48640278-48640300 CCTGGGACCCTGGCCGGCTCAGG + Exonic
955182165 3:56682840-56682862 GCTGAGCCCAGCGGCGGCGCTGG - Exonic
961446224 3:126983013-126983035 CCAGAGCCCGGGGGCGGGGCGGG - Intergenic
961446517 3:126983863-126983885 GCTAAGCCCCCGGCCGGCCCTGG + Intergenic
961551058 3:127670961-127670983 CCTGATGCCAGGGCCGGTGCAGG - Intronic
963870316 3:150408759-150408781 CGGGAGCCGCGGGCCGGAGCTGG - Exonic
964118756 3:153161811-153161833 ACTCAGCCCCGGGCGGGCGTGGG - Intergenic
965070074 3:163908252-163908274 CCTGAGTCCGTGACCGGCGCCGG - Intergenic
968161638 3:196432021-196432043 CCGGGTCCCCGGGCCGGCGGGGG + Intronic
968341599 3:197960283-197960305 GCTCAGGCCCGGGCCGGAGCCGG + Exonic
968505955 4:971646-971668 CCTGAGCACCCCGCCGGCTCAGG - Intronic
968512280 4:1001006-1001028 CCTGGGGCCCTGGCCGGGGCGGG + Intronic
968521648 4:1037068-1037090 GCTGAGCCCAGGGCCTACGCAGG - Intergenic
968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG + Intronic
968556293 4:1248017-1248039 CCTGAGCCCCGGGCCGAGACTGG - Intronic
968724820 4:2241905-2241927 CCTGATCCCCGGGCAGCTGCTGG + Intronic
968879877 4:3293286-3293308 CCTGGTCCCGGGCCCGGCGCGGG + Intronic
968905721 4:3449721-3449743 GCTGAGCCCCGGCCTGGGGCTGG - Intergenic
973018687 4:45172660-45172682 CCTGAGCCCCTGGCTGGAGTTGG + Intergenic
973292442 4:48483686-48483708 GCTGAGCCCAGGGCCGGGGCCGG - Exonic
973293318 4:48490691-48490713 CCCGAGTCCCCGGCCGGCCCCGG + Exonic
975151874 4:71032187-71032209 CCTGAGTCCATGACCGGCGCCGG - Intergenic
977693765 4:99946241-99946263 CCCGAGCCCCAGCCCGGAGCCGG + Intronic
977957965 4:103052346-103052368 CCCAAGCCCCGGGCCGTGGCAGG - Intronic
978741906 4:112145940-112145962 CGCGACCCCGGGGCCGGCGCTGG - Intronic
981508369 4:145527960-145527982 CTTGAACCCAGGGCCGGGGCCGG - Intronic
981615588 4:146640163-146640185 CCTGAGTCCCGGGCTGGCCCTGG + Exonic
983533418 4:168833067-168833089 CCCCAGCCCCGGGGCGGGGCCGG - Intronic
984680984 4:182608877-182608899 CCTGAGCCCCTGGCTGACCCAGG - Intronic
985550182 5:528785-528807 CCGGAGCCCCGGGCGGGGGGAGG - Intergenic
985760259 5:1745296-1745318 CACGAGCCCCGGGCCTGGGCAGG - Intergenic
987050411 5:14143580-14143602 GCAGAGCCCCGGGGCGGCGGGGG - Intergenic
987089605 5:14499089-14499111 GGTGAGTCCCGGGCCTGCGCAGG + Intronic
987785607 5:22494396-22494418 CCTGAGCTGCGGGCAGGCTCCGG + Intronic
988577806 5:32444112-32444134 CCAGAGCCCCGGCCCGCTGCAGG - Intronic
997950970 5:138242218-138242240 CCCCAGCCCCGCACCGGCGCGGG - Intergenic
998134672 5:139668416-139668438 CCTGGGACCCGGGCGGGCGCCGG - Intronic
998349695 5:141492524-141492546 CCTGCGCCCCGGGCTGGGCCGGG + Intronic
999192580 5:149759607-149759629 CCTGAGCCCTGGGCTGGGGTGGG + Intronic
1001239992 5:170061367-170061389 CCTGAGCCACGGGGCAGAGCTGG - Intronic
1002067437 5:176658985-176659007 CCTGGGCCCCTGACAGGCGCTGG + Exonic
1002184236 5:177446875-177446897 ACAGAGCCCCGGGCCTGCGGGGG - Exonic
1002919354 6:1555241-1555263 CCTGAGCCCCGCGCTCCCGCCGG + Intergenic
1004193941 6:13487574-13487596 CCTCGGCCCCAGGCCGGCTCAGG + Intronic
1004241327 6:13924997-13925019 CCCGGGCCCTGGGCCGCCGCCGG + Exonic
1005881100 6:30061602-30061624 CCTGAGCCCCGGGCAGAGGCAGG - Exonic
1005926684 6:30451134-30451156 CCTGAGCCCGGGGCCACCGCTGG - Intergenic
1005928419 6:30463853-30463875 CCTGTGCCCTGGGCCACCGCTGG - Intergenic
1006180163 6:32149652-32149674 CCTGGGCCCTGGGGCGGCGGGGG + Exonic
1006950704 6:37819546-37819568 CCGGAGCCCCCCGCCGGCTCCGG - Exonic
1007362476 6:41369010-41369032 CCTGCGCCCCCTGTCGGCGCTGG + Intergenic
1007419806 6:41712707-41712729 CCTGGGCCCCGTGCCTGCCCAGG - Intronic
1007431500 6:41779871-41779893 CCTTAGCTCCGGGCGGGCGGCGG - Exonic
1007557792 6:42781921-42781943 GCGGCGCCCCGGCCCGGCGCGGG + Intronic
1007781590 6:44257584-44257606 GCAGCGCCCCGGGCCGCCGCCGG + Intronic
1008244227 6:49150652-49150674 CCTGAGCCCCTGGCTGGAGTTGG + Intergenic
1013272949 6:108559950-108559972 GCCGTGCCCCGGGCCCGCGCGGG + Intronic
1013273095 6:108560530-108560552 CCCGAGCCCGGGGACTGCGCGGG - Intronic
1013330311 6:109094572-109094594 CCTCAGCAGCCGGCCGGCGCCGG + Exonic
1014001521 6:116370927-116370949 ACTGAGAGCCGGGCCGGCGGGGG - Exonic
1015024638 6:128519472-128519494 CCAGAGCCCCAGGCCGGATCCGG + Intronic
1018613430 6:165663363-165663385 CCTGCACCCGGGGCCGGGGCGGG + Intronic
1018757389 6:166862338-166862360 CGTGAGCGCGGGGCCTGCGCCGG + Exonic
1018827524 6:167421077-167421099 CCGGGGGCCCGGGCCGGCTCAGG - Intergenic
1019151304 6:170007765-170007787 CGTGAGCCCGGGGGCGGCGCAGG + Intergenic
1019366360 7:635450-635472 CCTGAGCCCCAGGGGGGTGCAGG - Intronic
1019484752 7:1284410-1284432 CCTGAGCCCCTGCCCTGCTCAGG + Intergenic
1019554099 7:1620011-1620033 CCTGAGGCCCGGGCGGGGGCGGG - Intergenic
1019989667 7:4682605-4682627 GCAGAGCCCGGGGCCGGCGCTGG + Exonic
1020137379 7:5594579-5594601 CCTGGGCCCGGGGGCGGCGCGGG - Intronic
1020278078 7:6636872-6636894 CCAGATCCCCGGGCCCGCGCGGG - Intergenic
1021969337 7:25951317-25951339 CGTGCGCCCCGGGCGGGCCCGGG + Intergenic
1024043836 7:45574485-45574507 CCGGCGCCCCGGGCCGGCGAGGG + Intronic
1026805017 7:73424068-73424090 CCCCAGCCCCGGGCCGGGCCGGG - Intergenic
1029274095 7:99393974-99393996 CCTGAGCCCAGCGCCAGCACAGG + Intronic
1029423436 7:100483476-100483498 CCTCGGCCCCGGACCGACGCTGG + Intergenic
1029443230 7:100599765-100599787 CCTGAGCCCAGGGCCTGCTGTGG - Intronic
1029546116 7:101211540-101211562 CCTGGGCCCCGGGTCGGAGGAGG + Intronic
1032037689 7:128531808-128531830 GCTGAGCCCCGGGCGGGGGAGGG + Intergenic
1032125229 7:129188727-129188749 GCTGGGCCGCGGGCTGGCGCGGG + Intergenic
1033390646 7:140924609-140924631 CCCGAGGCCGGCGCCGGCGCCGG - Exonic
1033477031 7:141701747-141701769 CGGGAGCCCGGGGCCGGCCCTGG + Intronic
1034917588 7:155053695-155053717 CCTGAGCCCCGGGGAGGCCGAGG - Intergenic
1034941992 7:155236668-155236690 CGTGAGCCCTGGGCTGGAGCAGG - Intergenic
1035496815 7:159335241-159335263 TCTGCGCCCCGCGCCGGCGCGGG + Intergenic
1036664642 8:10730623-10730645 CCTGCGTCCCGGGCCGCCGCCGG + Intronic
1037116767 8:15237135-15237157 CCTGTGCCCCAGCCCGGCACGGG - Intronic
1042190060 8:66177381-66177403 CCTGAGCCGCGGGCCGGTCCCGG - Exonic
1045114949 8:98972467-98972489 CCTAAGCCATGAGCCGGCGCCGG - Intergenic
1049272164 8:141701561-141701583 CCTGGGGCCGGGGCCAGCGCAGG - Intergenic
1049352900 8:142173550-142173572 TGTGAGCCCCGGGCCAGCCCCGG + Intergenic
1049372616 8:142274952-142274974 CCTGAGCCCAGGGCCTGCAGAGG + Intronic
1049419467 8:142510555-142510577 CCCGCGCCCCCGGCCCGCGCGGG - Intronic
1049536656 8:143185766-143185788 CCTGAGCACCGAGTGGGCGCTGG - Intergenic
1049758248 8:144320331-144320353 CCTGAGTGCTGGGCTGGCGCTGG + Intronic
1049767258 8:144360662-144360684 CCTGAGCCCCTGCCCGCCCCTGG + Exonic
1052824641 9:33166456-33166478 CCTGAGCCTCGGGCCACAGCAGG + Intronic
1052862030 9:33443206-33443228 CATGAGCCCGGGGCCTGGGCAGG + Intronic
1053198355 9:36136699-36136721 CCTGGGCTCTGGGGCGGCGCTGG + Intronic
1053893988 9:42725399-42725421 CCAGAGGCCCGGGAAGGCGCCGG - Intergenic
1056382591 9:86068525-86068547 CCTGAGACCTGGGCAGGGGCAGG - Intronic
1056765607 9:89442895-89442917 CCTGGGCCCCGGGCCTGGGCTGG + Intronic
1056969951 9:91193486-91193508 CCCGAGCCCCGTGCCGGGCCTGG - Intergenic
1057361134 9:94374703-94374725 CCTGACCCGCAGGCCGCCGCGGG + Exonic
1057478669 9:95426860-95426882 TCTGAGCCCCGCCCCGCCGCGGG - Intergenic
1057662227 9:97013461-97013483 CCTGACCCGCAGGCCGCCGCGGG - Exonic
1059769856 9:117414888-117414910 CCGGAGCCCCGAGCCGGGGCCGG + Exonic
1060402064 9:123355002-123355024 CCAGAGCCCAGGGCCTGCGTGGG + Intergenic
1060968485 9:127724670-127724692 CCTGGCCCCCGGGCTGGAGCCGG + Intronic
1061212693 9:129202984-129203006 CCTGTCCCCCGGGCAGCCGCTGG + Intergenic
1061415882 9:130446546-130446568 GCTGAGCGCCTGGCCGGTGCGGG + Intronic
1061908845 9:133712363-133712385 CCTGAGCCCCTGGACAGCTCTGG - Intronic
1061959068 9:133978912-133978934 CCTGAGCCTGGGGCTGGCCCCGG + Intronic
1061961767 9:133992347-133992369 CCTGAGCCCCGCGCGCGCGCGGG - Intronic
1062052535 9:134455059-134455081 CCTGAGCCCCGAGGCGTGGCTGG + Intergenic
1062328114 9:136022442-136022464 CCAGAGCCCAGGGCCGGCTGTGG + Intronic
1062467334 9:136687056-136687078 CCGGAGCCCCGGAGCGGGGCGGG + Intronic
1062478961 9:136742743-136742765 CCTGAGCCGGGCGCCGGCTCTGG - Intronic
1062547458 9:137070115-137070137 GCTGATCCCCGGGCCGGGCCGGG + Exonic
1062658961 9:137618577-137618599 CCTGGGCCGCGGCCTGGCGCGGG - Exonic
1185642812 X:1597869-1597891 CCAGAGCCCCGGGGAGGGGCAGG + Intronic
1185778838 X:2828934-2828956 CCTCGGCCCAGAGCCGGCGCTGG - Exonic
1190056866 X:47186199-47186221 CTGGAGCCCGGGGCCGGGGCCGG + Intronic
1191775359 X:64807831-64807853 CCTGAGCCCCTGGCTGGAGTTGG - Intergenic
1192437754 X:71153358-71153380 CCTGGGCCCAGGCCCGGAGCTGG + Intronic
1192726937 X:73763687-73763709 CCTGAGCCCCTGGCTGGAGTTGG + Intergenic
1196525755 X:116725959-116725981 CCTGAGTCCGTGACCGGCGCCGG + Intergenic
1199772698 X:150984303-150984325 CCCGAGCCCCCGGGCGGCCCGGG + Intronic
1199982296 X:152927775-152927797 CCTGAGCCCCAGGCCTGCCCTGG - Intronic
1200117081 X:153774117-153774139 CCTGAGCACCGTGGCGGGGCAGG - Intronic
1200418177 Y:2935178-2935200 TCGGCGCCCCGGGTCGGCGCCGG - Intronic
1201077301 Y:10197508-10197530 CCTGACCCTCCGGCCGGGGCTGG - Intergenic