ID: 1162934109

View in Genome Browser
Species Human (GRCh38)
Location 19:13972653-13972675
Sequence GTGGTTGGTAACCACCGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 37}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162934105_1162934109 -2 Left 1162934105 19:13972632-13972654 CCACACAGGCTCCTGCTAGCGGT 0: 1
1: 0
2: 0
3: 11
4: 83
Right 1162934109 19:13972653-13972675 GTGGTTGGTAACCACCGTCATGG 0: 1
1: 0
2: 0
3: 1
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162934109 Original CRISPR GTGGTTGGTAACCACCGTCA TGG Intronic
904058398 1:27687133-27687155 GTTCTTGGTTACCACCTTCATGG + Intergenic
911532044 1:99054589-99054611 GTAATTGGTAACCATTGTCAAGG + Intergenic
920849321 1:209617989-209618011 GTGGTTGGGAACCTGCGGCAGGG - Exonic
1072913617 10:99523606-99523628 GGGGCTGTGAACCACCGTCAGGG + Intergenic
1074398482 10:113120556-113120578 GTGGTTGGTAATCAGAGTCTTGG + Intronic
1085996368 11:81919685-81919707 GGGGTTGGTAATCACTGTGATGG - Intergenic
1090826545 11:130391192-130391214 GTGCTAGGTAACCACTGTCCCGG + Intergenic
1092845716 12:12583133-12583155 GTGGTATGCAAACACCGTCATGG + Intergenic
1107769662 13:43776322-43776344 GTGCTTGGAAACCACAGTCGAGG + Intronic
1119065692 14:71524005-71524027 GTGTTTAGAAACCACCGTCTGGG + Intronic
1121107572 14:91291205-91291227 GAGGGTGCTCACCACCGTCATGG + Intronic
1124658544 15:31527161-31527183 GAGGTTGGTATCCACTGGCATGG - Exonic
1127399585 15:58572844-58572866 GTGGGTGGTAATGACCTTCAAGG - Intergenic
1129581591 15:76817396-76817418 GTGGTTGGTTAACAAGGTCAGGG + Intronic
1162934109 19:13972653-13972675 GTGGTTGGTAACCACCGTCATGG + Intronic
929899073 2:45986016-45986038 GATGTTGGTACCCACCCTCATGG - Intronic
930154330 2:48090386-48090408 GGGGGTGGTAACCACCGATATGG + Intergenic
1173183521 20:40821838-40821860 TTGGGTGGTACCCACAGTCAAGG - Intergenic
1184222317 22:43109173-43109195 GTGGCTGTTAGCCACAGTCAGGG + Intergenic
952793703 3:37220380-37220402 GTGTTTGGTAACCACAGTATCGG - Intergenic
953736440 3:45497993-45498015 GTGGCTGGGAACCACCAGCATGG + Intronic
961461258 3:127051820-127051842 AGGGTTGGTGACCACAGTCATGG - Intergenic
961703613 3:128766374-128766396 GTCCTGGGTAACCACCGTCATGG + Intronic
962113865 3:132481069-132481091 GTGGATAGTAACCACCTCCAAGG - Intronic
967474620 3:189902262-189902284 GTGGCAGGTAACCACCTCCAAGG - Intergenic
977155534 4:93568339-93568361 GTGGTTGGTAATCCCCTTCTAGG + Intronic
983979549 4:173977494-173977516 GTGGTAGGTAACCTCCGTGGTGG + Intergenic
1004754179 6:18593797-18593819 TTGGTTGGAAACCAACCTCAAGG - Intergenic
1006422928 6:33946809-33946831 GTGGTTGCTAACTAATGTCAAGG - Intergenic
1007086083 6:39146608-39146630 GTTGTTGGTCACCAGCTTCATGG - Intergenic
1008563330 6:52743363-52743385 GTGTTTGGAAACCTCTGTCAGGG + Intergenic
1008575684 6:52858028-52858050 GTGTTTGGAAACCTCTGTCAGGG + Intronic
1008577853 6:52878513-52878535 GTGTTTGGAAACCTCTGTCAGGG + Intronic
1008580444 6:52902094-52902116 GTGTTTGGAAACCTCTGTCAGGG + Intronic
1031385063 7:121139482-121139504 GTTGGTGGTACCCATCGTCATGG + Intronic
1031604997 7:123758007-123758029 GTTGCTTGTAACCACCTTCATGG - Intergenic
1034089228 7:148348656-148348678 TTTGTTTGTAAGCACCGTCAAGG + Intronic
1058818310 9:108705802-108705824 GTGCCTGGTAACCTCGGTCATGG - Intergenic
1194580121 X:95661639-95661661 GTGGGTCGTACCCACCGACAGGG - Intergenic