ID: 1162935131

View in Genome Browser
Species Human (GRCh38)
Location 19:13978377-13978399
Sequence TAGCCTTGCCCCTGTGCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 211}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162935131_1162935136 5 Left 1162935131 19:13978377-13978399 CCCCAGGCACAGGGGCAAGGCTA 0: 1
1: 0
2: 0
3: 25
4: 211
Right 1162935136 19:13978405-13978427 GGAGCCATGGAGCTACAGAAAGG No data
1162935131_1162935145 25 Left 1162935131 19:13978377-13978399 CCCCAGGCACAGGGGCAAGGCTA 0: 1
1: 0
2: 0
3: 25
4: 211
Right 1162935145 19:13978425-13978447 AGGGCCTCAGGGGTGGGGCCTGG 0: 1
1: 0
2: 8
3: 96
4: 862
1162935131_1162935143 19 Left 1162935131 19:13978377-13978399 CCCCAGGCACAGGGGCAAGGCTA 0: 1
1: 0
2: 0
3: 25
4: 211
Right 1162935143 19:13978419-13978441 ACAGAAAGGGCCTCAGGGGTGGG 0: 1
1: 0
2: 1
3: 22
4: 219
1162935131_1162935140 14 Left 1162935131 19:13978377-13978399 CCCCAGGCACAGGGGCAAGGCTA 0: 1
1: 0
2: 0
3: 25
4: 211
Right 1162935140 19:13978414-13978436 GAGCTACAGAAAGGGCCTCAGGG 0: 1
1: 0
2: 1
3: 15
4: 222
1162935131_1162935137 6 Left 1162935131 19:13978377-13978399 CCCCAGGCACAGGGGCAAGGCTA 0: 1
1: 0
2: 0
3: 25
4: 211
Right 1162935137 19:13978406-13978428 GAGCCATGGAGCTACAGAAAGGG 0: 1
1: 0
2: 2
3: 24
4: 235
1162935131_1162935139 13 Left 1162935131 19:13978377-13978399 CCCCAGGCACAGGGGCAAGGCTA 0: 1
1: 0
2: 0
3: 25
4: 211
Right 1162935139 19:13978413-13978435 GGAGCTACAGAAAGGGCCTCAGG 0: 1
1: 0
2: 0
3: 13
4: 236
1162935131_1162935142 18 Left 1162935131 19:13978377-13978399 CCCCAGGCACAGGGGCAAGGCTA 0: 1
1: 0
2: 0
3: 25
4: 211
Right 1162935142 19:13978418-13978440 TACAGAAAGGGCCTCAGGGGTGG 0: 1
1: 0
2: 0
3: 14
4: 223
1162935131_1162935141 15 Left 1162935131 19:13978377-13978399 CCCCAGGCACAGGGGCAAGGCTA 0: 1
1: 0
2: 0
3: 25
4: 211
Right 1162935141 19:13978415-13978437 AGCTACAGAAAGGGCCTCAGGGG 0: 1
1: 0
2: 1
3: 13
4: 189
1162935131_1162935144 20 Left 1162935131 19:13978377-13978399 CCCCAGGCACAGGGGCAAGGCTA 0: 1
1: 0
2: 0
3: 25
4: 211
Right 1162935144 19:13978420-13978442 CAGAAAGGGCCTCAGGGGTGGGG 0: 1
1: 0
2: 2
3: 39
4: 359
1162935131_1162935135 -8 Left 1162935131 19:13978377-13978399 CCCCAGGCACAGGGGCAAGGCTA 0: 1
1: 0
2: 0
3: 25
4: 211
Right 1162935135 19:13978392-13978414 CAAGGCTATCGCTGGAGCCATGG 0: 1
1: 0
2: 0
3: 8
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162935131 Original CRISPR TAGCCTTGCCCCTGTGCCTG GGG (reversed) Intronic
900098369 1:949720-949742 TGGCCTGGCCCCTGTGTCTGTGG - Intronic
900541334 1:3204519-3204541 TAGCCCTGCCCCTGTCCCAGGGG + Intronic
901460053 1:9386001-9386023 GAGACTTGGGCCTGTGCCTGGGG - Intergenic
901705219 1:11068281-11068303 CAGCCCTGCCCCCGCGCCTGTGG + Intronic
902469391 1:16638098-16638120 AACCCTTGCCCCTAGGCCTGTGG + Intergenic
903501357 1:23801623-23801645 GAGCTTTGCCTCTGTGACTGGGG - Intergenic
904088865 1:27930482-27930504 TTTTCTTGCCCCTGAGCCTGTGG - Intergenic
904308981 1:29613228-29613250 TAGCCTTGCCAAATTGCCTGTGG - Intergenic
905526043 1:38640657-38640679 TGGGCTTGCCCATGTGTCTGTGG - Intergenic
905624543 1:39479520-39479542 TTGCTTTGCCACTGTCCCTGGGG - Intronic
905857387 1:41323006-41323028 TAGCCTTGGCCCTGTGACCTGGG + Intergenic
906128194 1:43440511-43440533 TCCCCCTGCCCCTGTCCCTGGGG + Exonic
907375120 1:54030875-54030897 CAGCAATGCCCCTGTGACTGAGG + Intergenic
908820315 1:68078868-68078890 CAGCCTTGCCCGGGTCCCTGTGG + Intergenic
912845703 1:113073153-113073175 TTGGCTGGCCCCTGTGCGTGAGG + Intergenic
913972111 1:143423453-143423475 GAGCCTAGCCTCTCTGCCTGGGG + Intergenic
914066492 1:144249066-144249088 GAGCCTAGCCTCTCTGCCTGGGG + Intergenic
914112661 1:144717288-144717310 GAGCCTAGCCTCTCTGCCTGGGG - Intergenic
915493564 1:156265650-156265672 TACCTTTGGCCCTCTGCCTGTGG - Intronic
916818972 1:168379603-168379625 TGGCCCTTCCCCAGTGCCTGTGG - Intergenic
916864938 1:168846369-168846391 TAACCTTGCCTCTGTGCCTTTGG - Intergenic
1064019781 10:11799669-11799691 TAGTCTCGCGCCTGTGACTGTGG - Intergenic
1064134198 10:12736340-12736362 TAGCCTTGCCCCAGAGGCTCAGG + Intronic
1064455216 10:15481201-15481223 TAGACTTGCCCTTGGGCATGTGG - Intergenic
1065367529 10:24951031-24951053 TAGGCTTGCCCCTCCTCCTGGGG + Intronic
1067433894 10:46264134-46264156 TGGCCCTGCCCCTGCCCCTGTGG - Intergenic
1067848020 10:49738330-49738352 CAGACTTTCCCCTGAGCCTGGGG - Intronic
1072874926 10:99162460-99162482 TAGCCCTGTCCCTGTGTGTGAGG - Intronic
1073945097 10:108741071-108741093 CAGTCTTGCCCATGTCCCTGTGG + Intergenic
1076420357 10:130327132-130327154 AACCCTGGCCTCTGTGCCTGTGG - Intergenic
1076458465 10:130621635-130621657 GAGGCTTCCCGCTGTGCCTGTGG + Intergenic
1076666380 10:132095299-132095321 TGGCCTTTCCCCAGTGCCTCTGG + Intergenic
1077100827 11:821606-821628 TAACCTTGGCCCTGTGCCCCAGG + Exonic
1077258916 11:1604980-1605002 AGGCCTGTCCCCTGTGCCTGGGG + Intergenic
1079358295 11:19748534-19748556 AAGCCTGGCCCTTGTCCCTGAGG - Intronic
1081584413 11:44374571-44374593 TAGCTCTGCCCCTGTGACTTTGG + Intergenic
1081703183 11:45164605-45164627 CAGCCATGTCCCTGTGCCTTTGG + Intronic
1084493287 11:69489680-69489702 GAGACCTGCCCCTGTCCCTGCGG - Intergenic
1084543442 11:69801463-69801485 AAGCCTGGCCCTTGTGCCTGGGG + Intergenic
1084978605 11:72816575-72816597 TGGCCTCTGCCCTGTGCCTGAGG - Intronic
1086420470 11:86632848-86632870 TAGCCCTGCCCCAGGGCCTGGGG - Intronic
1089511196 11:118998312-118998334 TAGCCTTGCCTCCGCACCTGGGG - Exonic
1091282201 11:134388117-134388139 GAGCCATGGCCCTGTGCCTGTGG - Exonic
1091768747 12:3138184-3138206 TGGGCTGGCCCCTCTGCCTGGGG + Intronic
1092091945 12:5810870-5810892 TGGCCCTGCCCCTGTGGATGTGG - Intronic
1092288703 12:7145440-7145462 TTTCCTTGCCCCTGTCCCTGTGG + Intronic
1092387649 12:8048241-8048263 TGGCCTTGTGCCTGTGGCTGTGG - Exonic
1094701796 12:32877654-32877676 TAGCTTGGCCCCTGTCCCTGAGG + Intronic
1096810522 12:54166759-54166781 TCTCCTGTCCCCTGTGCCTGAGG - Intronic
1097185323 12:57193513-57193535 CAGCCCTTTCCCTGTGCCTGTGG + Intronic
1099227663 12:79989267-79989289 CAGCCTTCCTCATGTGCCTGTGG + Intergenic
1101640850 12:106584841-106584863 TAGCCTTTCCCCACTCCCTGGGG - Intronic
1103715847 12:122944953-122944975 ATGCCTTCCTCCTGTGCCTGGGG + Intronic
1104689676 12:130816084-130816106 AGGCCTGGCCACTGTGCCTGGGG + Intronic
1104747244 12:131218497-131218519 AGGACTTGCCCCTGTGCCTCTGG + Intergenic
1104872737 12:132011962-132011984 TAGCTTCTCCTCTGTGCCTGTGG - Intronic
1104876894 12:132041114-132041136 TAGCCTTGGCCTTTTGCCAGCGG + Intronic
1106119709 13:26849937-26849959 TAGCAGTGCCCCTGGCCCTGAGG + Intergenic
1106314059 13:28578221-28578243 GAGCCATGCCCCTGAGCATGCGG + Intergenic
1107432876 13:40355602-40355624 TAGCCTGGCTCCTGGGACTGTGG - Intergenic
1110561070 13:76911193-76911215 TTCCCCTGCCTCTGTGCCTGAGG - Intergenic
1110793528 13:79611866-79611888 TGGCCTTTCCCCAGTGCCTCTGG + Intergenic
1111898591 13:94172103-94172125 AATCATTGCCCCTGTGCCTGAGG - Intronic
1114931023 14:27466915-27466937 TAGCCTGGAGCCTGTGTCTGTGG - Intergenic
1115310582 14:31974655-31974677 CAGCCTGGCCCCTGTGCTTTAGG + Intergenic
1119191624 14:72686541-72686563 CATCCTTGACCCTGTGGCTGAGG - Intronic
1120509517 14:85396546-85396568 TGGCCTTCCCACTGTGCTTGTGG - Intergenic
1121601504 14:95208060-95208082 CTGCCTTGCCCCTGTGTCTCTGG - Intronic
1122887918 14:104718796-104718818 TGGCCTTGGGCCTGGGCCTGAGG - Exonic
1123012777 14:105357366-105357388 GTGCCCTGCCCCTGAGCCTGTGG + Intronic
1123995631 15:25716179-25716201 TGGCCTCCTCCCTGTGCCTGGGG - Intronic
1124630766 15:31335814-31335836 GAGCCTGTGCCCTGTGCCTGGGG - Intronic
1126875498 15:53036970-53036992 CAGCCTTGCCCCTCTGTCTTTGG + Intergenic
1127263545 15:57343663-57343685 TGGCCTTGCCCAAGTCCCTGGGG - Intergenic
1132763148 16:1520779-1520801 AAGCCCTGCAGCTGTGCCTGGGG - Exonic
1132836055 16:1954064-1954086 TCACCTTGCCCCGGTGCCGGTGG + Exonic
1134619201 16:15674960-15674982 TTGCGTTGCCCCTGTGGATGAGG + Intronic
1136083481 16:27868082-27868104 TCTACTTGGCCCTGTGCCTGGGG + Intronic
1139846842 16:69927420-69927442 CAGCCCTGACCCTGGGCCTGTGG + Intronic
1141032657 16:80603024-80603046 TCTCCTTGCCCCTGTGCCCCTGG - Exonic
1141064728 16:80904794-80904816 TAGCTTGTCCCCTGTGCATGGGG + Intergenic
1141685819 16:85569346-85569368 TAGCTGAGCCCCTGGGCCTGGGG + Intergenic
1203138335 16_KI270728v1_random:1744487-1744509 TAGCATCCCCCCTCTGCCTGCGG + Intergenic
1143480844 17:7226559-7226581 TACCCTGGCTCCTCTGCCTGGGG - Exonic
1143965855 17:10756107-10756129 TCGCCTGGGCCCTGTGTCTGGGG + Intergenic
1146522832 17:33539618-33539640 AAACCCAGCCCCTGTGCCTGGGG + Intronic
1146526414 17:33570748-33570770 TAGCCTTGCCCACGTGTCTGGGG + Intronic
1147658715 17:42105588-42105610 GCTCCTTGCCCCTCTGCCTGGGG + Intronic
1149310021 17:55384590-55384612 TCACCTTGCACTTGTGCCTGTGG + Intergenic
1149443944 17:56699282-56699304 TAGCCTTGTCCCGGTCCCTTGGG - Intergenic
1149564385 17:57630794-57630816 TAGCCCTGGCCCTGAGGCTGTGG - Intronic
1150448234 17:65244157-65244179 TGGCTTTGCTCCTGGGCCTGGGG + Intergenic
1150526752 17:65931737-65931759 TGGGCTTGCCTCTGAGCCTGGGG - Intronic
1151051030 17:70978712-70978734 TAGCCTGGCTTCAGTGCCTGGGG - Intergenic
1152401766 17:80070790-80070812 CACCCATGCCCCTGTGTCTGGGG - Intronic
1153964359 18:10166622-10166644 AACCCTTGCCCCAGGGCCTGCGG + Intergenic
1155902573 18:31409513-31409535 AAGATTTGCTCCTGTGCCTGAGG + Exonic
1156719672 18:40054656-40054678 AAGCCTTGCCTCTGGGCCTGAGG + Intergenic
1157190687 18:45578897-45578919 TGGCCTTGCTCATGTGTCTGTGG + Intronic
1157884891 18:51357483-51357505 TAGCACTGCCACTGGGCCTGTGG - Intergenic
1160835737 19:1123702-1123724 CAGCCTGGCCCCTGCCCCTGGGG - Intronic
1161226507 19:3148908-3148930 TGGCCTTGCCCCAGGGTCTGGGG - Intronic
1161262773 19:3346726-3346748 CCTCCGTGCCCCTGTGCCTGGGG + Intergenic
1161374589 19:3933045-3933067 TAGCCTTGCCCAGGTGACCGGGG - Intergenic
1161405124 19:4087185-4087207 TAGCCCTGCCCCCATGTCTGAGG - Intergenic
1162800087 19:13105386-13105408 CCGCCTTGCCCCTGTGCGAGGGG + Exonic
1162935131 19:13978377-13978399 TAGCCTTGCCCCTGTGCCTGGGG - Intronic
1163135048 19:15304377-15304399 CAGCCTTGTCACTGTGCCGGGGG + Intronic
1165771894 19:38385090-38385112 CTGCCTTGACCCTGTCCCTGAGG - Intronic
1168228704 19:55015028-55015050 CAGCCCTGCCCCTGTGCCGCAGG + Exonic
1168528250 19:57105875-57105897 TAGCCTCGCACCTGTGCAGGAGG - Intergenic
930009165 2:46922545-46922567 TGGCCTTGCCCCCTTGACTGGGG - Intronic
930238548 2:48911546-48911568 TGGCCTTTCCTCTGTGCATGTGG + Intergenic
931022852 2:58069519-58069541 TTGCCATGCACCTGTGTCTGCGG + Intronic
931249555 2:60517692-60517714 TAGACTTGGCCCAGAGCCTGGGG - Intronic
932833369 2:75011611-75011633 TGGCCTTTCCTCTGTGCATGTGG - Intergenic
934176810 2:89584390-89584412 GAGCCTAGCCTCTCTGCCTGGGG + Intergenic
934287117 2:91658750-91658772 GAGCCTAGCCTCTCTGCCTGGGG + Intergenic
935102505 2:100010367-100010389 TAGCTCTGCCCGTGTGGCTGGGG + Intronic
937214357 2:120301923-120301945 TAGCCCCTGCCCTGTGCCTGAGG - Intergenic
937219127 2:120331539-120331561 TAGCTCTGCCCCTGGGCTTGAGG - Intergenic
937907609 2:127059836-127059858 CACCTTCGCCCCTGTGCCTGGGG - Intronic
940425463 2:153526100-153526122 TAGACATGCCCCAGGGCCTGGGG + Intergenic
940856047 2:158729502-158729524 GACACTTGCCCCTGTGGCTGAGG - Intergenic
942865108 2:180663983-180664005 GAGCCTTGGCACTATGCCTGGGG - Intergenic
946401756 2:219472106-219472128 TTGCCTTGCCCCTGCCCCTGCGG + Intronic
946413289 2:219526354-219526376 TAGACTTTTCCCTGGGCCTGAGG - Intronic
948326586 2:237126683-237126705 CAGCCTTGCCAATGTGCATGGGG - Intergenic
948809762 2:240468554-240468576 TAGCCCCGCTCCTGTTCCTGTGG + Intergenic
1169112718 20:3044175-3044197 GAGCCTTCTCCCTGAGCCTGGGG - Intronic
1171396584 20:24838128-24838150 GAGCCTTGACCCTGTTCCTTTGG + Intergenic
1172646408 20:36472913-36472935 TAGCCTGGCGCCTCTCCCTGCGG - Intronic
1172996276 20:39072417-39072439 CAGCCATGTCCCTGTACCTGAGG - Intergenic
1176270093 20:64231865-64231887 CAGCCGTGACCCTGGGCCTGGGG - Intronic
1176309456 21:5142019-5142041 GAGCCTTGCCCCTGTGCCCACGG + Intronic
1176518950 21:7810624-7810646 CTGCCTTGACCCTGTGCCTCTGG + Intergenic
1177114654 21:17071289-17071311 TGGGCTTGCCCATGTACCTGTGG + Intergenic
1178314797 21:31558977-31558999 CAGCCGTGCCCCTGGGGCTGCGG + Exonic
1178652978 21:34440637-34440659 CTGCCTTGACCCTGTGCCTCTGG + Intergenic
1179474004 21:41631864-41631886 TTGCTTTGCCGCTGTGCCTGCGG + Intergenic
1179718506 21:43302363-43302385 TGGCCTTGCCCCTCAGCCTCAGG - Intergenic
1179847604 21:44120014-44120036 GAGCCTTGCCCCTGTGCCCACGG - Intronic
1180710845 22:17838421-17838443 TGGCCCTGCCCCTGGCCCTGTGG + Intronic
1180969289 22:19806668-19806690 TGGGCATGCCCATGTGCCTGCGG - Exonic
1181563263 22:23717741-23717763 TAGCCCTGACCCTGGGCCTCTGG + Intergenic
1182034346 22:27186055-27186077 GAGCCTTCCCGCCGTGCCTGTGG + Intergenic
1182279215 22:29208397-29208419 TTGGCTTGCCCCTGCCCCTGGGG + Intronic
949504849 3:4717930-4717952 TAACCTTGCCGGTGAGCCTGCGG - Intronic
952338201 3:32423092-32423114 TAGGCTTGCTTCTGTGGCTGGGG + Intronic
952419022 3:33114609-33114631 TAGCCCCGCCCCTGCGCCCGGGG + Intronic
952877436 3:37958279-37958301 TGACTTTGCCCATGTGCCTGAGG + Intronic
954300045 3:49696114-49696136 AACCCTTGCCCCTAGGCCTGTGG - Intronic
961354769 3:126330214-126330236 TAATCTTGCTCCTGTGTCTGTGG - Intergenic
965411462 3:168336850-168336872 TAGGTTTGCCCCTGTGTCTTGGG - Intergenic
965736801 3:171829211-171829233 TAGCATTGCCCCTGTGGCACTGG - Intergenic
967598544 3:191356834-191356856 TAGCCTTGGCCCCTGGCCTGAGG - Intronic
973236921 4:47914966-47914988 TAGCCTTGCCTTTGAGCTTGCGG + Intronic
973269778 4:48250788-48250810 TGGGCTTGCCCATGTGTCTGTGG - Intronic
975266841 4:72379309-72379331 TTGCCTTGCCCCTGTGGCCTCGG - Intronic
976854142 4:89582957-89582979 TAGCTTTACCCATGGGCCTGTGG - Intergenic
977418620 4:96766614-96766636 TAATCTTGGCCCAGTGCCTGAGG - Intergenic
979293996 4:119010182-119010204 TTCCCTTGCCCCTCTGCATGAGG + Intronic
981642486 4:146960841-146960863 AAGCATTGCCCCTGAGACTGAGG + Intergenic
982081693 4:151796631-151796653 TAGGCTGCCCTCTGTGCCTGGGG - Intergenic
982184113 4:152779379-152779401 TCGCGCTGCCCCCGTGCCTGGGG - Intronic
984518957 4:180777039-180777061 TGGCCACGCCCCTGTGCTTGAGG - Intergenic
984926353 4:184810628-184810650 TAGCCTTGTCTCTGTCCCTGGGG - Intronic
986120031 5:4826636-4826658 TATCCTTGACGCTGTGACTGTGG - Intergenic
986269506 5:6218528-6218550 TGGCTCTGCCCCTCTGCCTGTGG - Intergenic
986870179 5:12036459-12036481 TGGCCTTTTCCCAGTGCCTGTGG - Intergenic
987955426 5:24732910-24732932 TAGCCTAGTCTCTGTGACTGGGG - Intergenic
988729602 5:33958354-33958376 AAGCCTTGGCCCTGACCCTGGGG + Intronic
992623145 5:78613095-78613117 TGGCCTTGCCCCTGCCCCTCAGG - Intronic
993204312 5:84860949-84860971 TACCCTTGCCTCTGTACCTTGGG + Intergenic
993885568 5:93411705-93411727 TAGGCTTGGATCTGTGCCTGGGG - Intergenic
997249169 5:132375743-132375765 TAGACTTGCCCCTCTTCCTGGGG - Intronic
998228013 5:140341797-140341819 TAATGTTGCCACTGTGCCTGAGG - Intronic
998663057 5:144262300-144262322 TATCCTTGCCCTGGTGCATGAGG - Intronic
1001473838 5:172035304-172035326 TTGCCTCGCCCCAGTTCCTGAGG - Intergenic
1005989012 6:30891903-30891925 TGGCCATGCCACTGTGCCGGAGG + Intronic
1006300344 6:33190697-33190719 AAGCCTGGCCCCTGCGCGTGTGG + Intronic
1007242491 6:40437161-40437183 TAGCCTTGGCCCTGGGCCCAGGG - Intronic
1007751736 6:44075417-44075439 TAGTGTTGGGCCTGTGCCTGGGG + Intergenic
1007944296 6:45811553-45811575 TCCCCTTGCCCCTGTCCCTTAGG - Intergenic
1010465727 6:76165602-76165624 TGGCCTTCCACGTGTGCCTGGGG - Intergenic
1013227471 6:108130487-108130509 TAGTCTTGCCTCTGGGCTTGTGG + Intronic
1013466231 6:110419241-110419263 TAGCCTTGCTGGTGTGTCTGTGG + Intergenic
1013974366 6:116060178-116060200 TGGCCATGCCTCTGTGACTGGGG + Exonic
1018875139 6:167815764-167815786 TTTCCTTGCCTCAGTGCCTGTGG - Intergenic
1019576935 7:1742154-1742176 AAGCCTCCTCCCTGTGCCTGTGG + Intronic
1019647438 7:2138655-2138677 TTGCTTGGCCCCTGGGCCTGGGG - Intronic
1019752290 7:2738924-2738946 TAGCCTCGTGGCTGTGCCTGTGG + Intronic
1022089998 7:27101963-27101985 TTGCCTTGTCCCTGCCCCTGTGG - Intronic
1022184067 7:27949734-27949756 TAGTCTTGCTCCGTTGCCTGGGG - Intronic
1022324532 7:29319042-29319064 TAGCCTCTGCCCTGTGTCTGAGG - Intronic
1022894927 7:34740478-34740500 TAGCCTTTTCCCAGTGCCTCTGG + Intronic
1023866697 7:44241818-44241840 TGGCCTCTCCCCTGTGCCTCGGG - Intronic
1025051988 7:55740070-55740092 TAGCCCTGCAGCTGTGCCGGGGG + Intergenic
1025128945 7:56365738-56365760 TAGCCCTGCAGCTGTGCCGGGGG + Intergenic
1025177329 7:56808626-56808648 TAGCCCTGCAGCTGTGCCGGGGG + Intergenic
1025257955 7:57398458-57398480 TAGCCTTGACCCTGGGCCTCTGG - Intergenic
1025729835 7:64099820-64099842 TAGCCTTGACCCTGGGCCTCTGG - Intronic
1025929524 7:65982641-65982663 TAGCCTTGACCCTGGGCTTCTGG + Intergenic
1026744078 7:72997694-72997716 TGGCCTTGGCACAGTGCCTGGGG - Intergenic
1027030184 7:74882371-74882393 TGGCCTTGGCACAGTGCCTGGGG - Intergenic
1027099659 7:75367398-75367420 TGGCCTTGGCACAGTGCCTGGGG + Intergenic
1027270306 7:76515202-76515224 TAGCCTGGCCTCTTTGCATGGGG + Exonic
1029608946 7:101616347-101616369 CAGCCTTGTGCCTGTCCCTGTGG - Intronic
1031762303 7:125728936-125728958 TAAGCTTTCCCTTGTGCCTGAGG + Intergenic
1032514180 7:132494851-132494873 CAGCTCTGCCCCTGAGCCTGGGG - Intronic
1035449050 7:158963498-158963520 TCTCTGTGCCCCTGTGCCTGGGG + Intergenic
1035933184 8:3807082-3807104 TAACCTTCCCCCAGTGCGTGGGG - Intronic
1036107598 8:5857415-5857437 TACCCTTTGCCCTGTGCCTCAGG + Intergenic
1038415439 8:27391578-27391600 TAGCATCTCCCCTGTGCCAGGGG + Intronic
1039785231 8:40828985-40829007 TAGCCTTGTCCATGGTCCTGAGG + Intronic
1039911880 8:41832831-41832853 TAGGCATGCCCCTGTGGGTGGGG - Intronic
1040975897 8:53194407-53194429 CACCCTTGCTCCTCTGCCTGCGG + Intergenic
1041647027 8:60263607-60263629 TGGCCATGCCCCTGTGCTTGAGG + Intronic
1042225316 8:66510746-66510768 TGGCCTTCCCTCTGTGCATGTGG + Intronic
1047821461 8:128525814-128525836 TAGCCTTGCTCCCTTGTCTGTGG - Intergenic
1048342733 8:133553346-133553368 CAGCCTTGCCCGTGTGCCTCTGG + Intronic
1048615403 8:136068926-136068948 TAGCCTGGGTCCTGTGCATGGGG + Intergenic
1049263524 8:141652723-141652745 TCCCCTTGCCCCTGTGCTCGTGG - Intergenic
1049685066 8:143936079-143936101 TACCCCTGCCCCTGTGCATGTGG - Intronic
1049685411 8:143937400-143937422 TGGCCTGGCCCCTGGGCCGGTGG - Intronic
1049757741 8:144318261-144318283 CAGCCTTGGCCCTGGCCCTGCGG + Exonic
1053195856 9:36118040-36118062 TATGCTTGCCCCTCTCCCTGGGG + Intronic
1058775546 9:108279908-108279930 CAGCCTTGCCCCATTGCCTCTGG - Intergenic
1059388997 9:113987076-113987098 TAGCCTCTCCACTGTGCCAGAGG - Intronic
1061509606 9:131052599-131052621 CAGGCTTGGCCCTGTCCCTGAGG + Exonic
1062167365 9:135114626-135114648 AACTCTTGCCTCTGTGCCTGCGG - Intronic
1192192003 X:68996554-68996576 AAGCCTTGACTCTTTGCCTGAGG - Intergenic
1192202254 X:69073868-69073890 TAGCCTTCCCTCTGTTCCTGAGG + Intergenic
1193087332 X:77458461-77458483 TAGCCTTGCTGCTGTGCCTATGG + Intergenic
1195941533 X:110171843-110171865 TAACCCTGCCCCTTGGCCTGGGG + Intronic
1198520941 X:137451614-137451636 CAGCCTTGCCCCCGGGCCTGTGG + Intergenic
1200208581 X:154335147-154335169 GAGCCTTTTCCCCGTGCCTGTGG + Intergenic