ID: 1162937234

View in Genome Browser
Species Human (GRCh38)
Location 19:13987316-13987338
Sequence AAGGTGACTTTGGAGGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 301}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162937234_1162937241 -10 Left 1162937234 19:13987316-13987338 CCTACCACCTCCAAAGTCACCTT 0: 1
1: 0
2: 1
3: 27
4: 301
Right 1162937241 19:13987329-13987351 AAGTCACCTTTAGGCAGGGCAGG 0: 1
1: 0
2: 3
3: 13
4: 161
1162937234_1162937246 1 Left 1162937234 19:13987316-13987338 CCTACCACCTCCAAAGTCACCTT 0: 1
1: 0
2: 1
3: 27
4: 301
Right 1162937246 19:13987340-13987362 AGGCAGGGCAGGCAGGGACCGGG 0: 1
1: 0
2: 12
3: 142
4: 1046
1162937234_1162937245 0 Left 1162937234 19:13987316-13987338 CCTACCACCTCCAAAGTCACCTT 0: 1
1: 0
2: 1
3: 27
4: 301
Right 1162937245 19:13987339-13987361 TAGGCAGGGCAGGCAGGGACCGG 0: 1
1: 0
2: 6
3: 93
4: 671
1162937234_1162937247 2 Left 1162937234 19:13987316-13987338 CCTACCACCTCCAAAGTCACCTT 0: 1
1: 0
2: 1
3: 27
4: 301
Right 1162937247 19:13987341-13987363 GGCAGGGCAGGCAGGGACCGGGG 0: 1
1: 0
2: 9
3: 104
4: 867
1162937234_1162937243 -5 Left 1162937234 19:13987316-13987338 CCTACCACCTCCAAAGTCACCTT 0: 1
1: 0
2: 1
3: 27
4: 301
Right 1162937243 19:13987334-13987356 ACCTTTAGGCAGGGCAGGCAGGG 0: 1
1: 0
2: 0
3: 25
4: 267
1162937234_1162937251 21 Left 1162937234 19:13987316-13987338 CCTACCACCTCCAAAGTCACCTT 0: 1
1: 0
2: 1
3: 27
4: 301
Right 1162937251 19:13987360-13987382 GGGGCTGGGTGAGCTGTGTCTGG 0: 1
1: 0
2: 4
3: 43
4: 549
1162937234_1162937249 7 Left 1162937234 19:13987316-13987338 CCTACCACCTCCAAAGTCACCTT 0: 1
1: 0
2: 1
3: 27
4: 301
Right 1162937249 19:13987346-13987368 GGCAGGCAGGGACCGGGGCTGGG 0: 1
1: 0
2: 5
3: 81
4: 911
1162937234_1162937248 6 Left 1162937234 19:13987316-13987338 CCTACCACCTCCAAAGTCACCTT 0: 1
1: 0
2: 1
3: 27
4: 301
Right 1162937248 19:13987345-13987367 GGGCAGGCAGGGACCGGGGCTGG 0: 1
1: 1
2: 13
3: 166
4: 1235
1162937234_1162937242 -6 Left 1162937234 19:13987316-13987338 CCTACCACCTCCAAAGTCACCTT 0: 1
1: 0
2: 1
3: 27
4: 301
Right 1162937242 19:13987333-13987355 CACCTTTAGGCAGGGCAGGCAGG 0: 1
1: 0
2: 1
3: 27
4: 293
1162937234_1162937252 26 Left 1162937234 19:13987316-13987338 CCTACCACCTCCAAAGTCACCTT 0: 1
1: 0
2: 1
3: 27
4: 301
Right 1162937252 19:13987365-13987387 TGGGTGAGCTGTGTCTGGTTTGG 0: 1
1: 0
2: 3
3: 19
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162937234 Original CRISPR AAGGTGACTTTGGAGGTGGT AGG (reversed) Intronic
900410553 1:2510658-2510680 GAGGTGAGTGTTGAGGTGGTGGG - Exonic
900415288 1:2531894-2531916 CAGGTGACTTTGGAGGTGGCAGG + Intergenic
900975144 1:6012030-6012052 GAGGTGAAAGTGGAGGTGGTGGG + Intronic
901097256 1:6692274-6692296 GAGATGACATTGGAAGTGGTGGG + Intronic
901398106 1:8996598-8996620 AAGCTGCTTTTGGAAGTGGTTGG + Intergenic
902667674 1:17951027-17951049 AAGGTGACTTTGCAGGGTGATGG - Intergenic
905799933 1:40836998-40837020 AATGTGACTTTTAAGGTGGGTGG - Intronic
906493257 1:46284728-46284750 AAGGAGAGTTTGGAAGTGGTAGG + Intronic
907263871 1:53242629-53242651 ATGGTAACTTTGGGGTTGGTAGG + Intergenic
908680849 1:66659424-66659446 ATGGTGACTTGGGAGATGATAGG + Intronic
913340964 1:117757931-117757953 AAGGTGACTAAGGAGCTGGCTGG - Intergenic
914902637 1:151719361-151719383 AGGGTGAGCTTGGGGGTGGTGGG - Intronic
915940863 1:160117458-160117480 AAGGGGAGTTTGGGGGTGCTAGG - Intronic
916155937 1:161848056-161848078 ATGGTGACTTTGGAGAAGGGAGG - Intronic
918449408 1:184644523-184644545 AAGGAGGCTTTGAATGTGGTTGG - Intergenic
918639271 1:186819090-186819112 TAAGTGACTTTGGGGGTGCTTGG - Intergenic
919074997 1:192802634-192802656 ACAGTCACTTTGGAAGTGGTTGG + Intergenic
920608596 1:207414808-207414830 AGATTGACTTTGGTGGTGGTAGG - Intergenic
1062907193 10:1187053-1187075 CAGGTGACTTTCGAAGTGGTTGG - Intronic
1064164154 10:12972445-12972467 AAGGGGACTTGGTAGGTAGTAGG - Intronic
1064601977 10:17003209-17003231 GAGGTTACTTTGGAGGCGGATGG + Intronic
1066400727 10:35073267-35073289 AAGGTGAGAGTGGAGGAGGTGGG + Intronic
1066448388 10:35505110-35505132 TGGGTGACATTGTAGGTGGTTGG + Intronic
1067834741 10:49631696-49631718 ACTGAGACTTTAGAGGTGGTGGG + Intronic
1067946939 10:50695631-50695653 AAGGTGGCCTTGAAGGTGTTGGG + Intergenic
1068853646 10:61773948-61773970 AAGCAGAACTTGGAGGTGGTTGG + Intergenic
1069885551 10:71621232-71621254 AAGGTGACTCTGGATTTGCTTGG + Intronic
1069957209 10:72059623-72059645 AACTTCACTTTGGAGGGGGTGGG - Exonic
1071276408 10:84059633-84059655 AAGGTGGATTTGGAGGTGAGAGG - Intergenic
1073035298 10:100560681-100560703 AAGGTGAGTTTGGAAGTGTTTGG + Intergenic
1073352719 10:102831292-102831314 AGGGTGAATTTGCAGTTGGTTGG + Intronic
1073888714 10:108071747-108071769 AAGGCGAGTTTGGAGGTGATAGG - Intergenic
1074029215 10:109667951-109667973 AAGGTGATTTTTGATATGGTTGG - Intergenic
1074103871 10:110374640-110374662 ATGGTGAGTTGGCAGGTGGTGGG - Intergenic
1075114075 10:119611468-119611490 TAGGTGAATTTGGTGGTGGGAGG + Intergenic
1076254309 10:129008985-129009007 AACAAGACTTTGAAGGTGGTTGG - Intergenic
1076933711 10:133553186-133553208 AAGCTGAGTTTGGGTGTGGTTGG + Intronic
1077217818 11:1402370-1402392 AAGGTGGCCTTGGGGGTGGATGG + Intronic
1077976834 11:7255276-7255298 ATGGTGACTTCAGAGGTGGCTGG + Intronic
1081564757 11:44251325-44251347 AGGATGACTTTGGATGAGGTTGG + Intergenic
1083364138 11:62131168-62131190 AAGCTGACTCTGGAGCTGGCCGG + Intronic
1083697588 11:64453151-64453173 AAGGGGAAATTGGAGGTGGGAGG - Intergenic
1084279183 11:68075764-68075786 AAAGAGACTTCGGTGGTGGTGGG - Intronic
1085277759 11:75310914-75310936 AAGGTCACTGTGGTTGTGGTGGG - Intronic
1088367043 11:109050803-109050825 TAGGTGACTCTGGAGCTGGGAGG + Intergenic
1088722988 11:112611015-112611037 AATGTGACTTAGGAGGTAGATGG - Intergenic
1089136981 11:116257120-116257142 AAAGTAACTTTGGAAGTGGAAGG - Intergenic
1089237969 11:117049220-117049242 ATGGTGTTTATGGAGGTGGTTGG - Intronic
1090442441 11:126735588-126735610 AAGGTGGCTTTGGAGGTAACAGG + Intronic
1091006995 11:131962395-131962417 ATGGGGACTTTGAAGGTGATTGG + Intronic
1091058178 11:132438467-132438489 AAGGTGTCTGTGGAGGGGGTGGG + Intronic
1091111517 11:132973282-132973304 TAAGTGATTTTGGAGGTGGAAGG - Intronic
1091283580 11:134395936-134395958 AAGCTCACTTGGGTGGTGGTGGG + Intronic
1091370181 11:135051135-135051157 AAGGTGATTTTGGCACTGGTAGG - Intergenic
1091694381 12:2618054-2618076 AAGGGGACTTTGGAGGCTGAGGG + Intronic
1091704405 12:2684037-2684059 AAGGTGTGGCTGGAGGTGGTGGG + Intronic
1091710979 12:2740387-2740409 AAGGTGTGGCTGGAGGTGGTGGG + Intergenic
1091847768 12:3670441-3670463 AAAGTGAGTTTGGAGGTGTGAGG - Intronic
1093444732 12:19243629-19243651 AAGGAGAATTTGTAGATGGTGGG + Intronic
1093553802 12:20447194-20447216 GAGGTGACAGTGAAGGTGGTAGG + Intronic
1093824492 12:23666969-23666991 AAGGAGAAATTGAAGGTGGTGGG - Intronic
1094208397 12:27864591-27864613 GAGGAAACTTTGGAGGTGATCGG - Intergenic
1094289102 12:28826062-28826084 AGGGTGATTTTGGAGGAGATAGG - Intergenic
1094385637 12:29890022-29890044 AAGGTGAATTTGGAGCTGAGAGG + Intergenic
1095275125 12:40272846-40272868 AGGGTGACTGTGGAGGTAGTGGG + Intronic
1096623689 12:52879989-52880011 AGGCTGACTTGGGAGGTTGTTGG - Intergenic
1096657506 12:53100855-53100877 ATGGTGCGTTTGGAGCTGGTAGG + Exonic
1096876478 12:54633920-54633942 CAGGTGACATTAGAGTTGGTTGG + Intronic
1097072311 12:56364091-56364113 AGGGTGCCCTTGGAGGAGGTGGG - Intergenic
1097074590 12:56383582-56383604 AGGGTGGCCTTGGAGGAGGTGGG - Intergenic
1097263741 12:57734299-57734321 AAGGTGAGGGTGGAGGTGGTGGG - Exonic
1099848301 12:88057914-88057936 AAGGGGACATTGGAGGTGCATGG + Intronic
1101013101 12:100471536-100471558 GAGATGACAGTGGAGGTGGTGGG + Intergenic
1101883598 12:108642430-108642452 AAGGTGACTGCTGAGTTGGTTGG - Intergenic
1104319925 12:127741496-127741518 ATGGGGCCTTTGGAGGTGATTGG + Intergenic
1106315146 13:28586884-28586906 AAGGTGAATTATGAGGTGGCTGG - Intergenic
1107492686 13:40896599-40896621 GAGGAGACTTTAGAGGTGGATGG - Intergenic
1107548780 13:41457068-41457090 AAGGGGACTTCCGAGATGGTGGG - Intergenic
1108005783 13:45944915-45944937 AAGCAGACTTTGGAGGGGATGGG - Intergenic
1109578120 13:64288822-64288844 AGGGTGAGTTTGGAGATGATAGG + Intergenic
1110332115 13:74284693-74284715 ATGGTGGCTTTGGAGGTGAGAGG + Intergenic
1111904275 13:94237475-94237497 AAGGTCTCTTTGTAGGTGGGTGG + Intronic
1111953097 13:94726034-94726056 AAGGAGAATTTGTAGGGGGTGGG + Intergenic
1112258901 13:97860126-97860148 AAGGAGGCTTTGGGGGTGCTGGG + Intergenic
1113503460 13:110796464-110796486 AGGGTGACCTTGGAGGAGGGAGG + Intergenic
1113645198 13:111990021-111990043 GAAGTGACTTTGGAACTGGTTGG + Intergenic
1114727424 14:24953933-24953955 AAGGTGACAATAGAGGGGGTTGG + Intronic
1115402082 14:32973071-32973093 AAAATGATTTTGGTGGTGGTGGG + Intronic
1115966658 14:38897276-38897298 TAGGTGAATTTGGAGCTGGCTGG - Intergenic
1116969196 14:51047225-51047247 AAGATGACATTGGAGTTGCTGGG - Intronic
1118602916 14:67482875-67482897 ACTGTGACTTGGGAGGTGGAGGG - Intronic
1120090569 14:80328012-80328034 ATGGTGACTTACAAGGTGGTTGG - Intronic
1120128551 14:80777215-80777237 GAGGTGATTTGGGAGGTGATTGG + Intronic
1121499783 14:94425641-94425663 AGGGTGAATTTGGAGGTGAGAGG - Intergenic
1122261657 14:100526887-100526909 ATGATGACAGTGGAGGTGGTGGG - Intronic
1122455649 14:101848615-101848637 CAGGTGAGTTTAGAGGTCGTCGG + Intronic
1122469008 14:101953448-101953470 GAGGTGGCTTTGGAGGAGTTTGG - Intergenic
1124067903 15:26363319-26363341 ATGGAGGGTTTGGAGGTGGTGGG + Intergenic
1124562583 15:30788914-30788936 AATGTGACTTTGGAGTTTGGAGG - Intergenic
1125004123 15:34799088-34799110 AAGGTATTTTTGGTGGTGGTTGG - Intergenic
1127266231 15:57364604-57364626 GAGAAGACTGTGGAGGTGGTGGG - Intergenic
1127722777 15:61719244-61719266 GAGCTGACTTTGGAGGTGCAGGG - Intergenic
1128146287 15:65334159-65334181 AAGGAAACTCTGGAGGGGGTGGG - Intronic
1129164769 15:73770241-73770263 CAGGAGACCTTTGAGGTGGTTGG + Intergenic
1130222517 15:82032498-82032520 AAGATGAAGTTGCAGGTGGTAGG - Intergenic
1130853591 15:87821363-87821385 AATGGGACTTTGGAGGTGCAAGG - Intergenic
1133277325 16:4646826-4646848 AAGGTGCCCTGGGAGGAGGTTGG + Intronic
1133809272 16:9148715-9148737 AAAGTGACTTTGGAGTTTCTGGG + Intergenic
1134840898 16:17400724-17400746 AAGCTGACTTTGAAGGTTGATGG - Intronic
1135052521 16:19204324-19204346 AAGGTGACCTTAGATGTGGTGGG + Intronic
1136071016 16:27787131-27787153 AAGCTGTCTGTGGAGGTGGGTGG + Intergenic
1137663525 16:50232195-50232217 AAGGTGACTGTGAAGGTGCCTGG + Intronic
1138237709 16:55399043-55399065 AAGGTGATTGGGGAGGTGGAAGG - Intronic
1138420678 16:56897232-56897254 CAGGTGAGGTGGGAGGTGGTAGG + Intronic
1139589732 16:67926952-67926974 AATCTGACTTAGGATGTGGTGGG + Intronic
1140044294 16:71430496-71430518 AAGGTGACTTGGGAGTTCATAGG + Intergenic
1140665444 16:77223225-77223247 AAGGTGAATTTGGAGCTGAGAGG - Intergenic
1140674657 16:77316128-77316150 ATGGTGACTGTGAAGGTGGCAGG - Intronic
1140942392 16:79734292-79734314 AAGGTGAGGGTGGAGGTGGTTGG - Intergenic
1141091050 16:81130562-81130584 GAGGTGTCTGTTGAGGTGGTAGG + Intergenic
1143176131 17:4956219-4956241 AAGGTAAGCTTGGAGTTGGTGGG - Intronic
1143599122 17:7932434-7932456 AAGGTTTCTTTTGGGGTGGTCGG + Exonic
1143664955 17:8352201-8352223 AAAGTGTTTTTGGAGATGGTGGG + Intergenic
1143924823 17:10360247-10360269 AAAGTAACATTGGGGGTGGTTGG + Intronic
1144006911 17:11109075-11109097 ATGGTGACAGTGGAGGTTGTTGG + Intergenic
1144622159 17:16824491-16824513 AAGGAGACGGTGGTGGTGGTGGG - Intergenic
1144884265 17:18448222-18448244 AAGGAGACGGTGGTGGTGGTGGG + Intergenic
1145147966 17:20496155-20496177 AAGGAGACGGTGGTGGTGGTGGG - Intergenic
1145793752 17:27643929-27643951 AAGGTCACTGTGGCAGTGGTTGG - Intronic
1146530372 17:33603225-33603247 AAGGTGGCAGTGGTGGTGGTGGG + Intronic
1146811631 17:35908484-35908506 AAGGTGTCATTGCAGGTGCTGGG + Intergenic
1147232949 17:39032406-39032428 AAGGTGCCATTGTAGGTGTTGGG - Intergenic
1147399718 17:40173182-40173204 AAAGTGACTTTGGATCTGGTAGG - Intergenic
1148097639 17:45064334-45064356 AAAATGAGTTTGGAGGTAGTAGG + Intronic
1148188216 17:45660051-45660073 AAGGAGACTTGGGATGTGATGGG - Intergenic
1149200681 17:54182671-54182693 AGGGTGACTGAGGAGGTGGTGGG - Intergenic
1150210744 17:63440217-63440239 AAGGTGACTTGGGACGAGCTGGG - Intronic
1150986051 17:70198190-70198212 AAGGTAACTTAGTAGGCGGTAGG + Intergenic
1151241937 17:72764948-72764970 AAGGGCAGTTTGGAGGTTGTAGG - Intronic
1152056842 17:78035302-78035324 AAGGTCACACAGGAGGTGGTGGG - Intronic
1152377024 17:79924178-79924200 GTGGAGACTTTGGAGCTGGTGGG - Intergenic
1153582846 18:6592672-6592694 CTGGTGACCTTGGAGGTGGAAGG - Intergenic
1154260712 18:12829893-12829915 AAGATTACTTCAGAGGTGGTGGG - Intronic
1154405794 18:14090026-14090048 GAGGTGACTGTGGAGATGCTCGG + Intronic
1155584920 18:27353868-27353890 AAGGTGCGCTTGGTGGTGGTGGG - Intergenic
1157619468 18:49007963-49007985 GAGCTGACTTTGGAGGCAGTAGG + Intergenic
1160426047 18:78780010-78780032 ATGGTGACCTTGGAGGAGGCTGG + Intergenic
1160557691 18:79736567-79736589 GAGGTGACTCTGCAGTTGGTGGG + Intronic
1160972093 19:1774076-1774098 AAGAAGACTTTGGAGGAGGAGGG - Intronic
1161259389 19:3328416-3328438 AGGGTGACTTTGTGGGTGGTGGG - Intergenic
1161396648 19:4048052-4048074 GAGGTGTCTGTGCAGGTGGTCGG + Exonic
1161498324 19:4599063-4599085 AAGGTGACTGGGGAGATGCTGGG + Intergenic
1161821530 19:6533528-6533550 AAGGGGTCTTTGGAGGGGGAAGG - Intronic
1161821566 19:6533613-6533635 AAGGGGTCTTTGGAGGGGGAGGG - Intronic
1161821604 19:6533705-6533727 AAGGGGACTCTGGAGGGGGCAGG - Intronic
1161821627 19:6533755-6533777 AAGGTGTCTCTGGAGGGGGAGGG - Intronic
1162937234 19:13987316-13987338 AAGGTGACTTTGGAGGTGGTAGG - Intronic
1163233536 19:16018872-16018894 GAGGTGAGTTTGGTGATGGTCGG - Intergenic
1165196468 19:34107917-34107939 AAGGTGACACTGGAGGAGTTGGG - Intergenic
1165367651 19:35378659-35378681 ACAGTGACTTTGGAGGTTGGTGG - Intergenic
1166505772 19:43370590-43370612 AAGGAGGTTTTGGAGGTGGGAGG + Intergenic
1166759146 19:45213563-45213585 AAGGGGGATTTGGAGATGGTTGG - Intronic
1167206962 19:48109192-48109214 CATATGAATTTGGAGGTGGTGGG - Intronic
925875183 2:8305311-8305333 GAGGTGACTTGGGAGGCCGTGGG - Intergenic
928022093 2:27713354-27713376 AAGGCGAATTTGCAGGTGGTAGG + Intronic
928181323 2:29070976-29070998 AAGGGGACATTGGGGGTGATGGG + Exonic
928417250 2:31106035-31106057 AAAGTGGGTGTGGAGGTGGTGGG - Intronic
928912733 2:36439301-36439323 AAGGAGACGTGGGAGGAGGTTGG - Intronic
929584843 2:43107126-43107148 AATGAGACTTGGGAGGTGGGAGG - Intergenic
931213603 2:60221090-60221112 AGTCTCACTTTGGAGGTGGTGGG - Intergenic
931480256 2:62632807-62632829 GAAGTGACTTTGGAATTGGTTGG - Intergenic
933745820 2:85570600-85570622 AAGGTGAATTTAGAGGGGATTGG + Intronic
933746160 2:85572854-85572876 AAGGTGAGTTTAGAGGGGATTGG + Intronic
933779769 2:85793248-85793270 CAGATGGCTTTGGAGGTGGTTGG - Intergenic
934074103 2:88412852-88412874 AAGGTGTCTTTGGAGGCGTTTGG - Intergenic
935135341 2:100295622-100295644 AAGGTGAACAAGGAGGTGGTGGG + Intronic
936870076 2:117126106-117126128 AAGGCTATTTTGGTGGTGGTGGG + Intergenic
937103274 2:119288032-119288054 AAGGAGGTTTTGGGGGTGGTGGG + Intergenic
937135738 2:119550502-119550524 AATGTGACCTTGGAGGTTGATGG - Intronic
937365328 2:121257179-121257201 AAGGTGACCTTGGGAGTGGCAGG + Intronic
940078976 2:149778463-149778485 GAGGGGACAGTGGAGGTGGTTGG + Intergenic
940509064 2:154589451-154589473 AAAATGACTTTGGCAGTGGTAGG + Intergenic
941143264 2:161811940-161811962 AAGGTGGGTTTGCAGGAGGTTGG - Intronic
942561053 2:177219034-177219056 CAGGTAACTATGGTGGTGGTGGG + Exonic
946119422 2:217496553-217496575 AATGGCACTTTGGTGGTGGTCGG + Intronic
946156957 2:217813357-217813379 AAGCAGTCTTGGGAGGTGGTGGG - Intronic
946791560 2:223305621-223305643 AATCTGACTTTGGAAGTGGTAGG - Intergenic
947609322 2:231513826-231513848 AAGGTGATTTTTGATGTTGTAGG + Intergenic
947665882 2:231905057-231905079 AAAGTGCCTTTGGGGGTGGCAGG - Intergenic
948918042 2:241048233-241048255 AAGGTGCCATTGGAGCTGGGCGG + Intronic
1171165033 20:22962355-22962377 AAGCTGACTTTGAAGGAGCTGGG - Intergenic
1172456439 20:35078070-35078092 AAAGTCACTGTGGAGGTGGCTGG + Exonic
1173742797 20:45413401-45413423 ACAGTGCCTTTGGAGGTGGGAGG + Intergenic
1173907636 20:46640443-46640465 AAGGTGCCTGTGGTGCTGGTAGG - Intronic
1174502141 20:50993075-50993097 AGGGTGACTTTGGAGCTGAGAGG - Intergenic
1175494813 20:59406497-59406519 AAGATGGCTTTGGAGGTTCTGGG + Intergenic
1175901741 20:62362600-62362622 AGGGTGACTGTGGAGGAGGAAGG - Intronic
1177656398 21:24021963-24021985 AATGTGGCTTTCGAGGTAGTTGG + Intergenic
1177664117 21:24130470-24130492 AGGCTGAATTTGGAGCTGGTAGG - Intergenic
1177968861 21:27762833-27762855 AAGCAGACCTTGGAGGTGCTAGG - Intergenic
1178905795 21:36635043-36635065 TAGGTGAAGTTGGAGGTGCTGGG - Intergenic
1179768218 21:43590882-43590904 AAAGTGCCTTTGGAGGTGATGGG + Intronic
1180718874 22:17892019-17892041 AGTGTTACTTTGGAGGGGGTAGG - Intronic
1180796390 22:18607803-18607825 AAGGTGACTCTGTAGGTGGATGG + Exonic
1181225333 22:21387468-21387490 AAGGTGACTCTGTAGGTGGATGG - Exonic
1181253300 22:21547345-21547367 AAGGTGACTCTGTAGGTGGATGG + Exonic
1182793175 22:32970258-32970280 AAGGTTACTCAGGAAGTGGTGGG + Intronic
1183306994 22:37087922-37087944 AGGGGGACTTTGGTGGTGATGGG - Intronic
1183751556 22:39723815-39723837 GTGGAGACTTGGGAGGTGGTGGG + Intergenic
1184306806 22:43608707-43608729 AAGGTGATTAAGGAGGTGGATGG - Intronic
953411923 3:42695473-42695495 CAGGTGGTATTGGAGGTGGTGGG - Intronic
954529673 3:51308138-51308160 AAGGCTACTGTGGAGGTGGGAGG + Intronic
955131325 3:56171926-56171948 AAGGTGGGTGTGGAGGTGGATGG + Intronic
955327398 3:58019921-58019943 AAGGTTGCTTTGGAGGAGGTGGG + Intronic
955708804 3:61756867-61756889 AAAGTGACTCTGAAGGTAGTGGG + Intronic
957898829 3:86461341-86461363 CATGTGAGTTTGGTGGTGGTGGG + Intergenic
958058185 3:88440710-88440732 AAAGTGACTTTTGAGGTGTGTGG + Intergenic
959005355 3:101013548-101013570 TTGTTGACTTTGGAGGTGGAGGG - Intergenic
961076685 3:123989378-123989400 AAGGTGAATTTGGAGCTGAGAGG - Intronic
961152648 3:124652535-124652557 AAGGTGACCTCTGAGGTGGCAGG + Intronic
961232973 3:125336657-125336679 AAGGTGATTTCTGGGGTGGTTGG - Intronic
963789979 3:149573849-149573871 AATGTGATTTGGAAGGTGGTAGG - Intronic
965370881 3:167861048-167861070 AAACTAACTTTGGAGGTGGGAGG - Intergenic
965676269 3:171200264-171200286 AAGGTCAAGTTGAAGGTGGTTGG + Intronic
966920965 3:184611071-184611093 AATGTGACAATGGTGGTGGTCGG - Intronic
967089309 3:186121761-186121783 GAGGTGAGTTTGGAGGAAGTTGG + Intronic
967852625 3:194093619-194093641 AAGGTCACTTTGGGTGTGGATGG - Intergenic
970060913 4:12033151-12033173 AAGATGAACTTGGAAGTGGTGGG + Intergenic
970691074 4:18621315-18621337 AGGCTGAATTTGGTGGTGGTAGG - Intergenic
972297866 4:37757312-37757334 ATGGTGACTTTGAAGATGGGAGG + Intergenic
972390054 4:38605856-38605878 CAGGAGACTTTTGAGGGGGTTGG - Intergenic
974014265 4:56634606-56634628 AAGGTGATTCTGGAGGTTGCAGG + Intergenic
974149235 4:57984414-57984436 TAGATGAGTTTGGAGGTGGTAGG + Intergenic
974879159 4:67732846-67732868 AAGGTGAGTTTAGAAATGGTAGG + Intergenic
977340870 4:95755687-95755709 AAGGTGATTGTTGGGGTGGTGGG + Intergenic
977441852 4:97077521-97077543 ATGGTGAGTTTAGAGGTGCTGGG + Intergenic
978319973 4:107482525-107482547 AAGGTGTCTTTAGAGGGGGAGGG - Intergenic
978810125 4:112840392-112840414 AAGGTTCCTCTGGAGGTGGCAGG + Intronic
980766390 4:137311317-137311339 AAGGCTACTGTGGAGGTGTTGGG + Intergenic
982314417 4:154017089-154017111 AAGGAACTTTTGGAGGTGGTGGG + Intergenic
983293734 4:165839353-165839375 AGGGTTACTTTGGAGGTTGAAGG - Intergenic
983527505 4:168774243-168774265 ATGCTGACTTTGAAGGTGGCAGG - Intronic
983645970 4:169991823-169991845 GAGGAGATTATGGAGGTGGTTGG - Exonic
985116431 4:186596588-186596610 AAGGGGAGTTTGAAGGGGGTGGG + Exonic
985144077 4:186874995-186875017 GGGGTAACTTTGGTGGTGGTGGG + Intergenic
986833525 5:11608727-11608749 AATAAGACTCTGGAGGTGGTGGG - Intronic
987797075 5:22641486-22641508 AGGGTGACTCTGGAGGAGATTGG - Intronic
991052422 5:62287431-62287453 GAGCTGACTTTGAAGGTGCTTGG + Intergenic
991371857 5:65926641-65926663 TAGGTGGCTTTGGTGGGGGTTGG - Intronic
991464752 5:66898964-66898986 AAGGTGAGTTTGAAGCTGATGGG + Intronic
993232015 5:85248482-85248504 GAGTTGACTGTGGATGTGGTAGG + Intergenic
993790893 5:92209905-92209927 AAGGAGAATTTGGAGGTTGGCGG + Intergenic
995563757 5:113411589-113411611 TGGGTGACATTGTAGGTGGTTGG - Intronic
995739783 5:115343535-115343557 AGGGTGACTTTGGAGCTGAGAGG + Intergenic
999115915 5:149163135-149163157 AAGTTGCCACTGGAGGTGGTGGG + Intronic
1000951470 5:167488667-167488689 GAGATCACTTTGGATGTGGTGGG - Intronic
1001698470 5:173689968-173689990 AAGGGGACTTTGGGGAAGGTGGG + Intergenic
1003177690 6:3764962-3764984 GGGGTGGCTTTGGAGGTGGGTGG - Intergenic
1004239491 6:13906927-13906949 AATGTGACTTTGGAAATTGTTGG + Intergenic
1006188166 6:32192038-32192060 AAGGGGAGTCTGGAGGAGGTGGG + Intronic
1006375723 6:33670801-33670823 AAGCTCACTTTTGAGGTGGCTGG + Exonic
1007291049 6:40787045-40787067 AAGGAGAATGTGGAGGTGGAGGG - Intergenic
1008012989 6:46488946-46488968 AAAGTGACTGTGGAGGTGTGAGG - Intronic
1011741127 6:90361871-90361893 AAGGTGAGCCTGGAGGAGGTGGG - Intergenic
1014500806 6:122186572-122186594 AAGGTGACTTAGGAATTTGTAGG + Intergenic
1015222786 6:130824053-130824075 AAGAAAACTTTGGGGGTGGTGGG + Intergenic
1015268912 6:131318973-131318995 AAAGTGACTTTGGAGTTGGGGGG - Intergenic
1015846934 6:137530648-137530670 AAGGTGACTTTGGAAGAGACTGG - Intergenic
1017908196 6:158771151-158771173 CAGGTGACTGTGGAGCTGATGGG - Intronic
1018841086 6:167517632-167517654 AAGGTTACTTTGCAGCTGGCTGG - Intergenic
1019815192 7:3194782-3194804 AAGGTCAGTTAGGAGGTGGAGGG + Intergenic
1024316746 7:48027004-48027026 CAGGTACCTTTGGAGGTGGGAGG - Intronic
1026586863 7:71662563-71662585 ATGGTTGCTTGGGAGGTGGTGGG - Intronic
1026816886 7:73520551-73520573 AAGTGGATCTTGGAGGTGGTCGG - Intronic
1027629055 7:80579634-80579656 AAGTTGACTTTGGTGGAGGGTGG - Intronic
1027753129 7:82177162-82177184 AAGGTGAATTCTGGGGTGGTAGG - Intronic
1028331890 7:89605111-89605133 AAGGTAAATTTGGAGGTGAAAGG - Intergenic
1028484877 7:91346739-91346761 AATGTGACTTGGAAGTTGGTTGG + Intergenic
1029479861 7:100805764-100805786 ATGGTGACTTGGAAGATGGTAGG + Intronic
1030806713 7:113928944-113928966 GAAGTGACTTTGGAACTGGTTGG + Intronic
1031959277 7:127974322-127974344 AAGGTGAATTTGGAGTGGTTTGG + Intronic
1032146959 7:129392512-129392534 AAGGTGATTATGGAAGTGATTGG - Intronic
1032868395 7:135953100-135953122 AAGGGGAGTTTGGAGGAGTTTGG - Intronic
1032984056 7:137317369-137317391 ATTATGATTTTGGAGGTGGTTGG - Intronic
1033285405 7:140037001-140037023 TAGGCGACTTTGGAGTTGATGGG - Intronic
1034455033 7:151165438-151165460 GAGATGACTTTGGAGGAGATAGG - Intronic
1036058595 8:5289132-5289154 ATTGTGATTGTGGAGGTGGTGGG + Intergenic
1036504077 8:9339411-9339433 TAGGTGAGGGTGGAGGTGGTGGG + Intergenic
1036655951 8:10677621-10677643 GAGGTTAGTTAGGAGGTGGTGGG - Intronic
1037649703 8:20825227-20825249 ATGGGGACTTTGTAGGTGATTGG - Intergenic
1039188170 8:34940842-34940864 AAGCTGACTTTGAAGTTTGTTGG - Intergenic
1041364752 8:57090262-57090284 AAGGTGTCTTAGGAGGTAGATGG + Intergenic
1041799340 8:61782083-61782105 AAGGAAACTTTGGAGGTGATAGG - Intergenic
1043263205 8:78227795-78227817 AATGTTATTTTGGAGGTGATGGG - Intergenic
1043512237 8:80960979-80961001 AAGGTGAGGTTAGAGGTTGTCGG - Intergenic
1045491598 8:102674395-102674417 AAGGTGCCTAGGGAGGTGGTGGG - Intergenic
1046375077 8:113367827-113367849 AAAGACACTTTAGAGGTGGTGGG - Intronic
1046899852 8:119512467-119512489 AAGTGGACTTGGGAGGTGGCAGG - Intergenic
1047380377 8:124356488-124356510 AAGGAAACTTTGGATGTGGAAGG - Intronic
1047486388 8:125334698-125334720 AGGATGACTTTGGGGATGGTGGG + Intronic
1047547002 8:125827942-125827964 AAGGAGAAGTTGGTGGTGGTTGG + Intergenic
1048007979 8:130434600-130434622 AAGGTGACTTGGCGGGTGGAGGG - Intronic
1050686998 9:8182955-8182977 CAGGTGAGTTAGGAGGTGGTGGG - Intergenic
1051224189 9:14881680-14881702 AAGGTGAGGTTGGATGTTGTGGG - Intronic
1052869996 9:33495533-33495555 GAGGAGACTTTAGAGGTGGATGG - Intergenic
1052945377 9:34164250-34164272 AAAGTGACATTGGAGGGGCTGGG - Intergenic
1053368499 9:37541299-37541321 AAGGTGCCTGTGGAGATTGTAGG - Exonic
1054791912 9:69264550-69264572 AAGGTAAGTTTGGTGGTGCTGGG + Intergenic
1054950910 9:70850461-70850483 AAGAACACTTTGGAGGTGTTGGG + Intronic
1057222227 9:93263616-93263638 AAGGCGCCTTTGGAGGGGGCAGG + Exonic
1057269287 9:93639588-93639610 AAGGTGATATTGGAGGTTCTTGG - Intronic
1057688400 9:97259546-97259568 GAGGAGACTTTAGAGGTGGATGG + Intergenic
1058644079 9:107114388-107114410 AATGTCATTTTGGAGCTGGTTGG + Intergenic
1059238503 9:112783136-112783158 AAGGTGAATGTGGTGGTAGTTGG + Intronic
1059801165 9:117750819-117750841 CAGGTGGCTATGGAGGTGATTGG - Intergenic
1060992939 9:127859064-127859086 AAGGTGACCAGGGAGGTGGGAGG - Intergenic
1061322419 9:129839587-129839609 GAGGGGACTGTGGAGGGGGTGGG + Intronic
1062026452 9:134342852-134342874 AAGGTCACTGTGGTGGTGGCAGG - Intronic
1062177678 9:135173266-135173288 AGTGTGACTTGGGAGGTGGCGGG + Intergenic
1186709061 X:12173747-12173769 AAGGTGGCTTTGGAAGTAGGTGG + Intronic
1188598463 X:31930462-31930484 ATGGTGATTTTGGAGGTCTTGGG - Intronic
1188964982 X:36539826-36539848 AAGTAGACTTTGGAGTTGTTTGG + Intergenic
1190145881 X:47891373-47891395 AAGGTGAATGGGGATGTGGTGGG + Intronic
1190393045 X:49951673-49951695 GAGGTGACATTTGAGCTGGTTGG + Intronic
1190877643 X:54471025-54471047 AAGCTGGATTTGGAGGTGGCTGG + Intronic
1194209549 X:91054798-91054820 GAGGTGGCATTGGTGGTGGTAGG + Intergenic
1196046114 X:111258162-111258184 ATGCTGAATTTGGATGTGGTAGG - Intronic
1198328389 X:135596800-135596822 AAGGTGAATTTGGAGCTGACAGG + Intergenic
1199278030 X:145969493-145969515 GAGGTGACTTTGGTGCTGCTGGG + Intergenic
1200913804 Y:8553903-8553925 AAGGAGACTTTGGAGGTGTGTGG + Intergenic