ID: 1162940822

View in Genome Browser
Species Human (GRCh38)
Location 19:14007941-14007963
Sequence AGAATGCAAAATTTAAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162940822_1162940829 8 Left 1162940822 19:14007941-14007963 CCTTCTCTTAAATTTTGCATTCT No data
Right 1162940829 19:14007972-14007994 GTAGGCCCTAGAACAGCAAGGGG No data
1162940822_1162940828 7 Left 1162940822 19:14007941-14007963 CCTTCTCTTAAATTTTGCATTCT No data
Right 1162940828 19:14007971-14007993 GGTAGGCCCTAGAACAGCAAGGG No data
1162940822_1162940824 -10 Left 1162940822 19:14007941-14007963 CCTTCTCTTAAATTTTGCATTCT No data
Right 1162940824 19:14007954-14007976 TTTGCATTCTCATCCCAGGTAGG No data
1162940822_1162940827 6 Left 1162940822 19:14007941-14007963 CCTTCTCTTAAATTTTGCATTCT No data
Right 1162940827 19:14007970-14007992 AGGTAGGCCCTAGAACAGCAAGG No data
1162940822_1162940832 21 Left 1162940822 19:14007941-14007963 CCTTCTCTTAAATTTTGCATTCT No data
Right 1162940832 19:14007985-14008007 CAGCAAGGGGAAAAGAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162940822 Original CRISPR AGAATGCAAAATTTAAGAGA AGG (reversed) Intergenic