ID: 1162940827

View in Genome Browser
Species Human (GRCh38)
Location 19:14007970-14007992
Sequence AGGTAGGCCCTAGAACAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162940822_1162940827 6 Left 1162940822 19:14007941-14007963 CCTTCTCTTAAATTTTGCATTCT No data
Right 1162940827 19:14007970-14007992 AGGTAGGCCCTAGAACAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162940827 Original CRISPR AGGTAGGCCCTAGAACAGCA AGG Intergenic