ID: 1162945255

View in Genome Browser
Species Human (GRCh38)
Location 19:14039528-14039550
Sequence CTGTGGCAGTGGCAGCCGGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 296}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162945250_1162945255 -8 Left 1162945250 19:14039513-14039535 CCAACAAAACCCAGACTGTGGCA 0: 1
1: 1
2: 1
3: 15
4: 224
Right 1162945255 19:14039528-14039550 CTGTGGCAGTGGCAGCCGGACGG 0: 1
1: 0
2: 3
3: 33
4: 296
1162945245_1162945255 15 Left 1162945245 19:14039490-14039512 CCGCCTCTCTCCTCACAGCCGTT 0: 1
1: 0
2: 0
3: 31
4: 345
Right 1162945255 19:14039528-14039550 CTGTGGCAGTGGCAGCCGGACGG 0: 1
1: 0
2: 3
3: 33
4: 296
1162945248_1162945255 -3 Left 1162945248 19:14039508-14039530 CCGTTCCAACAAAACCCAGACTG 0: 1
1: 0
2: 0
3: 16
4: 175
Right 1162945255 19:14039528-14039550 CTGTGGCAGTGGCAGCCGGACGG 0: 1
1: 0
2: 3
3: 33
4: 296
1162945246_1162945255 12 Left 1162945246 19:14039493-14039515 CCTCTCTCCTCACAGCCGTTCCA 0: 1
1: 0
2: 1
3: 20
4: 318
Right 1162945255 19:14039528-14039550 CTGTGGCAGTGGCAGCCGGACGG 0: 1
1: 0
2: 3
3: 33
4: 296
1162945244_1162945255 16 Left 1162945244 19:14039489-14039511 CCCGCCTCTCTCCTCACAGCCGT 0: 1
1: 0
2: 2
3: 41
4: 391
Right 1162945255 19:14039528-14039550 CTGTGGCAGTGGCAGCCGGACGG 0: 1
1: 0
2: 3
3: 33
4: 296
1162945247_1162945255 5 Left 1162945247 19:14039500-14039522 CCTCACAGCCGTTCCAACAAAAC 0: 1
1: 0
2: 0
3: 3
4: 104
Right 1162945255 19:14039528-14039550 CTGTGGCAGTGGCAGCCGGACGG 0: 1
1: 0
2: 3
3: 33
4: 296
1162945243_1162945255 17 Left 1162945243 19:14039488-14039510 CCCCGCCTCTCTCCTCACAGCCG 0: 1
1: 0
2: 2
3: 28
4: 341
Right 1162945255 19:14039528-14039550 CTGTGGCAGTGGCAGCCGGACGG 0: 1
1: 0
2: 3
3: 33
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162945255 Original CRISPR CTGTGGCAGTGGCAGCCGGA CGG Exonic
900310567 1:2031432-2031454 CCGTGGCAGTGGCAGCAGGTGGG - Intergenic
901057504 1:6455478-6455500 CTGAGGCAGCGGCAGGCGGTGGG + Intronic
902107476 1:14049878-14049900 CTGTGACAGTGTCACCCAGAGGG + Intergenic
904344940 1:29861602-29861624 ATGGGGCAGTGGCAGAGGGATGG + Intergenic
905265679 1:36753032-36753054 ATGGGGCAGGGGCAGCCAGAGGG + Intergenic
908070549 1:60455173-60455195 CAGTGACAGTGGCAGCAGGCAGG - Intergenic
908614804 1:65907960-65907982 CTGAGGCAGAGGCAGCCAGATGG + Intronic
911151642 1:94602067-94602089 CTGTGGCAGATGCAGCAGGAAGG + Intergenic
912963083 1:114213403-114213425 TTAAGGCAGTGGCAGCAGGAAGG + Intergenic
914707072 1:150179156-150179178 CTGGGGCAGAGGCAGTGGGAAGG - Intergenic
915099597 1:153489810-153489832 CTGTGGTAGTGGCAGCGGAGTGG + Intergenic
917067667 1:171114301-171114323 CTGTGGGAATGGCAGCCCCAAGG - Exonic
917968717 1:180194159-180194181 CTGTGGGGCTGGCAGCCTGAAGG + Intronic
920162720 1:204011654-204011676 CTGAGGCAGGGGGAGCAGGAGGG + Intergenic
920971740 1:210748912-210748934 CTGGGGCAGTGGGAGCAGGTAGG - Intronic
921271666 1:213475606-213475628 CTGAGGGAGAGGCAGCGGGAGGG - Intergenic
922560858 1:226568666-226568688 CTGGGACAGTGGCTGCCAGAGGG - Intronic
922731469 1:227950614-227950636 CTGTGGCTGAGGCAGCAGGTAGG - Intergenic
922767924 1:228165730-228165752 CCCTGGCGGTGGCCGCCGGAGGG - Intergenic
1062853020 10:759899-759921 CTGTGGTAGTAGCAGCAGGGTGG - Intergenic
1062903141 10:1160793-1160815 CTGTGGAAGTGCCAGCCAGCAGG - Intergenic
1063646601 10:7889966-7889988 CTGTTGCTCTGGCAGCAGGATGG - Intronic
1064315658 10:14253678-14253700 GTGTGGCAGTGACAGGCAGAGGG + Intronic
1065041805 10:21705259-21705281 CTGTGGCAGTAGCAGCAGGGTGG + Intronic
1065303088 10:24342053-24342075 CTGTGGCCTTTGCAGCCAGAGGG + Intronic
1065877198 10:30007745-30007767 CTGGGGCAGGGGCAGCTGGTGGG - Intergenic
1066745933 10:38604252-38604274 CAGTGGGAGTGGCTGCCTGAGGG + Intergenic
1067537701 10:47126707-47126729 TTGTAGCAGTGGCAGAAGGAAGG - Intergenic
1069172775 10:65254405-65254427 CGGTGGCAGTGGCAGCCCAAGGG - Intergenic
1069345264 10:67462124-67462146 CTGGGGCAGTGGAAGCCAGAAGG - Intronic
1070377175 10:75843985-75844007 CTGTGGTAGTGGCAGCAGAAAGG + Intronic
1070677115 10:78419691-78419713 ATGTGGCAGTGACACCCTGAAGG + Intergenic
1070781348 10:79139226-79139248 CTTTGGAAGTGGCTGCCGGCCGG + Intronic
1071547049 10:86536856-86536878 CTGTGCCAGTTTCTGCCGGATGG - Intergenic
1073149703 10:101303380-101303402 GGGTGGCAGTGGCTGCCGGTGGG + Intergenic
1073816537 10:107213974-107213996 GTGTGCCAGTAGCAGCCGGGTGG + Intergenic
1073904207 10:108258580-108258602 CTGTGGCATTGGCTCCCAGAAGG - Intergenic
1075070770 10:119318662-119318684 CTGTGGCAGTGTCAGCCCAGTGG - Intronic
1075241184 10:120780549-120780571 CAGTGGGAGAGGCAGTCGGAGGG - Intergenic
1076093692 10:127712990-127713012 CTGTCGCAGTGGCAGGTGCATGG - Intergenic
1076531278 10:131146958-131146980 CTGAGGCAGTGACAGCTGGTGGG - Intronic
1076822407 10:132945972-132945994 CTGTGAGAGTGTCAGCAGGAGGG + Intergenic
1076922256 10:133460095-133460117 CTGTGGCAGTGCCCGTCGGCGGG + Intergenic
1077059622 11:612289-612311 GTGCAGCAGTGGCAGCCTGAGGG + Intergenic
1077253746 11:1571787-1571809 CTGGGGCAGCGGCACCCGGTGGG - Intronic
1078421399 11:11215996-11216018 CAGTGGCAATGGCAGCAGGGTGG - Intergenic
1078514982 11:12014315-12014337 CTGTTGCAGGGGCAGACAGAGGG + Intergenic
1078740280 11:14059736-14059758 CTGTGGCAGCGGCTGCTGGGGGG - Intronic
1079472318 11:20790105-20790127 CTGTGGCACTGGCAGCCATCAGG + Intronic
1081670844 11:44941706-44941728 ATGTGGCAGTGGCACCAGGATGG + Intronic
1081845771 11:46239228-46239250 CGGGGGCGGAGGCAGCCGGAGGG + Intergenic
1082128402 11:48457593-48457615 CAGTGGCAGTAGCAGCCTCAGGG + Intergenic
1082561947 11:54628518-54628540 CAGTGGCAGTGGCAGCCTCAGGG + Intergenic
1083622708 11:64056908-64056930 CTGTGGCAGTGTCAGCCCGATGG - Intronic
1083674568 11:64318289-64318311 CTGCGGCAGCGGCAGCAAGACGG + Exonic
1083775185 11:64891166-64891188 CTATGGAATTGGCAGCCAGAGGG + Intergenic
1084108541 11:66997538-66997560 CTGTGGCGGTGGCAGCCCCTAGG - Intergenic
1084274293 11:68043806-68043828 ACGTGGCAGTGGAAGCTGGAGGG - Exonic
1084402938 11:68955767-68955789 CTGGGGCTGTGGGAGCCGGTTGG + Intergenic
1084556529 11:69879316-69879338 CAGTGGCAGTGGCGGCCCCAGGG + Intergenic
1084703809 11:70804351-70804373 CGGTGCCACTGGCAGCAGGAAGG + Intronic
1084885214 11:72200014-72200036 CTGAGGCAGTAGAAGCCGGGAGG - Intergenic
1085122075 11:73973690-73973712 CTGGGGCAGGGGCAGGTGGAGGG + Intergenic
1085395850 11:76206725-76206747 CTCTGGCCGGGGCAGCCGGAAGG + Intronic
1085514565 11:77104836-77104858 CTGTGGCTGGGGCTGCCGGGAGG + Intronic
1086243132 11:84720408-84720430 CTGCGGCAGTGGCAGCTCGCTGG + Intronic
1087428205 11:98016965-98016987 CTGTGTCAGTGGTAGCTTGATGG - Intergenic
1088425078 11:109693563-109693585 TGGTGGCAGTGGCAGCAGGAAGG - Intergenic
1088654148 11:111983263-111983285 GTGTGGCTCTGGCAGCCGGCAGG + Intronic
1089353139 11:117832655-117832677 CCATGTCAGTGGCATCCGGAAGG - Intronic
1089454970 11:118620845-118620867 TTGTTACAGTGGCAGCCTGAGGG + Intronic
1089836662 11:121376387-121376409 TTGTGGCAATGGCAGCAGTAGGG + Intergenic
1090078071 11:123591886-123591908 CTGTAGCAGTGGCAGGGAGAGGG - Intronic
1090997002 11:131875891-131875913 CTGCAGCAGTGGCATCCTGAAGG + Intronic
1094162096 12:27402133-27402155 CTGTAGCTGTGTCAGCCTGAAGG + Intronic
1097552854 12:61098218-61098240 CAGTGGCAGCGGCAGCTGCAAGG - Intergenic
1098152698 12:67564076-67564098 GTATGGCAATGGCAGCTGGAGGG - Intergenic
1098209494 12:68148771-68148793 CTGTGGCTCTGGCAGGGGGAGGG - Intergenic
1100353366 12:93806011-93806033 CGTTGGCAGTGGCAGCAGGCTGG + Intronic
1101471230 12:104999089-104999111 CAGTGGCAGTGGCAGCATGGTGG + Intronic
1103912586 12:124360558-124360580 GTGTGGCAGGGGCTGCTGGAGGG - Intronic
1103947358 12:124533754-124533776 CTGTGGCTGTGGGAGCACGATGG + Intronic
1104932685 12:132348101-132348123 CTGGGGCTGTGGCAGCCGTGAGG - Intergenic
1106190737 13:27450413-27450435 CTGTGGAGGAGGCACCCGGAAGG - Intronic
1109989955 13:70041603-70041625 CTGTGTCAGTGGATGCCAGATGG - Intronic
1110606374 13:77437601-77437623 CTGTGGCAGTGGTAACCTCATGG + Intergenic
1110630173 13:77698159-77698181 CGGTGGCCGTGGCGGCCGGGGGG - Intronic
1113602998 13:111584320-111584342 CTGGGGCGGTGGCAGCGGGGTGG - Intergenic
1113923780 13:113929260-113929282 CTGAGGAGGTGGCAGACGGAAGG - Intergenic
1114692822 14:24600919-24600941 CAGTGGTGGTGGCAGCCGAATGG + Intergenic
1117501434 14:56356648-56356670 CTGTGTCTGTGGCAGCCTCATGG - Intergenic
1118812510 14:69285645-69285667 CTGGGGCTGTGGCAGTCGCATGG + Intronic
1119404453 14:74388897-74388919 CTGTGGGTGTGGCTGCCAGATGG - Intergenic
1121674160 14:95738952-95738974 CAAAGGCAGTGGCAGCCGGGAGG + Intergenic
1122233391 14:100318493-100318515 CTGTCGGAGGGGCAGCCGGCTGG + Intergenic
1122288690 14:100667954-100667976 CTGTGGCAGTGCCAGGCAGCTGG + Intergenic
1122365833 14:101194420-101194442 GTGTGGCATTGGCTGCCGGAAGG + Intergenic
1122616704 14:103022900-103022922 CTGGTGCAGTGGGAGCCTGAGGG - Intronic
1122919511 14:104874267-104874289 CAGTGGCAGTCTCTGCCGGAGGG - Intronic
1122970858 14:105151661-105151683 CAGTGGCATTCGAAGCCGGACGG + Exonic
1202853474 14_GL000225v1_random:36252-36274 CTGTGGCAGGTGCAGCCAGGAGG - Intergenic
1202860860 14_GL000225v1_random:80147-80169 CTGTGGCAGGTGCAGCCAGGAGG + Intergenic
1125599243 15:40906572-40906594 CTGGGGGTGTGGCCGCCGGAGGG + Intergenic
1125742882 15:41979524-41979546 CTGTTACAGTGGCAGCAGCATGG - Intergenic
1126653887 15:50955633-50955655 GTGTGTCAGTGGAAGCCTGATGG - Intronic
1128067837 15:64775529-64775551 GGGAGGCAGTGGGAGCCGGAGGG + Exonic
1128357271 15:66936896-66936918 CCATGGCAGGGGCAGCCGGATGG - Intergenic
1128389369 15:67172893-67172915 CTGTGGCTGTGGCTCCCGGGGGG + Intronic
1128639764 15:69327701-69327723 CAGTGGCAGTGGCTGCAGGGAGG + Intronic
1129230656 15:74195400-74195422 CCGTGGCACAGGCAGCCAGAGGG + Exonic
1129583621 15:76838840-76838862 TTGTGGGTGTGGCTGCCGGAAGG - Intronic
1129656506 15:77528452-77528474 CTGTGGCAGAGGCCCCCAGAAGG + Intergenic
1129889976 15:79065531-79065553 CTGGGGCATTGGCAGGAGGAAGG + Intronic
1131832235 15:96361282-96361304 CTGTGACAGTGGCACCTGGAAGG - Intergenic
1132556402 16:574636-574658 CTGAGCCACTGGCAGTCGGAGGG + Exonic
1132691050 16:1182113-1182135 CTGTGGCAGGGGCAGGAGCAGGG + Intronic
1133098622 16:3465484-3465506 TTGTGGTGGGGGCAGCCGGAAGG - Intronic
1133241411 16:4416396-4416418 CAGGGGGAGGGGCAGCCGGACGG + Intronic
1133270758 16:4609866-4609888 CGGTGGCAGCGGCAGCCCGATGG - Exonic
1134070296 16:11256170-11256192 CTGCGGCCGTGGCAGCTGCACGG - Exonic
1134817603 16:17218909-17218931 CTGGGGCAGTGGCAGGGGGCAGG + Intronic
1136737131 16:32475392-32475414 CAGTGGGAGTGGCTGCCTGAGGG - Intergenic
1138729770 16:59182283-59182305 CTGTGCCAGTGGCAGTAGGGTGG + Intergenic
1139504715 16:67393161-67393183 CTGTCCCAGTGGGAGCGGGACGG - Intronic
1139685032 16:68596878-68596900 GTGTGGCAGAGGCAGCAGGTGGG - Intergenic
1140339979 16:74148317-74148339 CTGTGGGAGAGGCAGGTGGATGG - Intergenic
1140404668 16:74700765-74700787 CTGAGGCAGTGGCCTCCGGAGGG - Exonic
1141172583 16:81700688-81700710 CTGGGGAAGAGGCAGCGGGAAGG + Intronic
1142000338 16:87660680-87660702 CTGTGGAAGAGGCAGCTGGTGGG - Intronic
1142204740 16:88777568-88777590 CTGAGGCAGGGGCAGTGGGATGG + Intronic
1203015940 16_KI270728v1_random:354185-354207 CAGTGGGAGTGGCTGCCTGAGGG + Intergenic
1203034275 16_KI270728v1_random:627343-627365 CAGTGGGAGTGGCTGCCTGAGGG + Intergenic
1143013484 17:3879245-3879267 TTAAGGCAGTGGCAGCAGGATGG - Intronic
1147907330 17:43831849-43831871 CTGTGGCAGGTCCAGCCGGGGGG + Intronic
1147962861 17:44178320-44178342 CGGGGGCAGTGGCAGCCGGGTGG - Exonic
1149599133 17:57881968-57881990 TTGTGGCGGTGGCAGTGGGAGGG - Intronic
1150251248 17:63705922-63705944 CGGTGGTAGGGGCAGCTGGAGGG - Intronic
1150641811 17:66954364-66954386 CTGTGGCAGAGCCAGCCAAATGG + Intergenic
1151400234 17:73851112-73851134 TTGTGGCAGGGGCAGCCTCAAGG - Intergenic
1152644258 17:81461510-81461532 CTGTGGCAGTCGCTGTCGTAGGG - Exonic
1155225879 18:23728558-23728580 CAAAGGCAGTGGCAGCAGGAGGG - Intronic
1155687552 18:28574190-28574212 CTCTGGCAGTGGCAGCTTCATGG - Intergenic
1156232900 18:35172236-35172258 CTGGGGCAGTGGCAGGAGCATGG - Intergenic
1159034898 18:63267367-63267389 CTAAGGCAGTGGCAGCAGGCAGG + Intronic
1160837503 19:1131755-1131777 CAGTGGCAGTGGCTGTCGGGAGG - Intronic
1162066206 19:8126737-8126759 ATGTGGCCCTGGCAGCCGGCTGG - Exonic
1162945255 19:14039528-14039550 CTGTGGCAGTGGCAGCCGGACGG + Exonic
1167293272 19:48635875-48635897 CTGGGGCAGTGGTGGGCGGAGGG - Exonic
1167633476 19:50639751-50639773 CTGGGGCTGTGGCAGGAGGAGGG + Intronic
1168141575 19:54391499-54391521 GTGTGGCAGTTGCAGACAGAGGG + Intergenic
925377760 2:3400461-3400483 CTGAGGCAGGGGCAGCTGGGGGG - Intronic
926696071 2:15770935-15770957 CTGGGGCAGCAGCAGCCTGAAGG + Intergenic
928103289 2:28452039-28452061 CTGTGGCCGTGGGAGCAGGCGGG + Intergenic
928169015 2:28991594-28991616 CTGTGGGAGCGGCAGCCCCAGGG + Intronic
929447453 2:42012329-42012351 GTGGGGCAGTGGCACCCAGAAGG - Intergenic
930778313 2:55197076-55197098 CTGTGGCAGTGCTATCCGTAGGG + Intronic
932740613 2:74287993-74288015 CTGAGCCAGTGGCAGCAGGCCGG - Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934188266 2:89764510-89764532 CAGTGGGAGTGGCTGCCTGAGGG - Intergenic
934308336 2:91843444-91843466 CAGTGGGAGTGGCTGCCTGAGGG + Intergenic
934575366 2:95397241-95397263 ATGTGGGAGGGGCAGCTGGAGGG + Intergenic
935206851 2:100903732-100903754 CTGTGGGAGTGGGAGGCTGAAGG - Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936244305 2:110813334-110813356 TTGTGGCAGTGGCAGCTGTGAGG + Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
937070888 2:119062098-119062120 CTGGGGTAGGGGCAGCCAGATGG - Intergenic
938094248 2:128451324-128451346 TTCTGGTAGTGGCAGCAGGAAGG + Intergenic
938646551 2:133336878-133336900 CTGTGGCAGTGAGACCCGGTAGG - Intronic
938889812 2:135692798-135692820 CTGTGGTAGTGGCAGTAGGAGGG + Intronic
939563927 2:143764636-143764658 CTATGGGAGTGGAAGCTGGAAGG - Intronic
940004583 2:148999059-148999081 CTGTGGCACTGCCACCAGGATGG + Intronic
940581464 2:155585123-155585145 CCTTGGCAGTGGCAGCAGCAAGG - Intergenic
940985699 2:160049953-160049975 CTGTGGCAGGGGCAGGGGAAGGG + Intronic
941718389 2:168787360-168787382 CTGTGGCAGTGTAAGCAGTATGG - Intronic
942834464 2:180277237-180277259 CTGTGGCAGTGGTGGCCACAGGG - Intergenic
943811489 2:192194637-192194659 CGGTGGCAGTGGCACCCGGCGGG + Exonic
944436579 2:199696260-199696282 ATGTGCCAGTGGCAGCAGGGTGG - Intergenic
944838034 2:203598907-203598929 CAGTGGCAGTGGCAGTGGCATGG - Intergenic
946173784 2:217910535-217910557 CTGGGGCAGTGGCAGCCTCAGGG - Intronic
946243131 2:218368846-218368868 CTGTGTCAGTGGGAACCGGGAGG - Intergenic
948284422 2:236772746-236772768 ATGTTGCAGTGTCAGCAGGAGGG - Intergenic
948318702 2:237051679-237051701 CTGAGGCAGAGGCAGCAGAATGG + Intergenic
1169224197 20:3846358-3846380 CTGTGGGAGTGGGAGCGGGCGGG - Intergenic
1170083698 20:12505556-12505578 CTGTAGCAGTGGAAGTAGGAGGG + Intergenic
1170482278 20:16778002-16778024 CTGTGGCAGTGCCATCCTAAAGG - Intergenic
1171424344 20:25040247-25040269 CTGTGTCTGTGGCAGCCGAATGG - Intronic
1172399775 20:34639939-34639961 CTGCAGCAGTGGTAGCAGGAAGG + Intronic
1172639484 20:36432209-36432231 CGGTGGCAATGGCAGCAAGAAGG + Exonic
1174665528 20:52254347-52254369 CTGTGGCTGGGGCAGAAGGATGG - Intergenic
1175078042 20:56392409-56392431 CTGTGGCAGTCCCAGCCCCAGGG + Exonic
1175735633 20:61385201-61385223 CTCTGGAAGTGGCAGGAGGAGGG + Intronic
1176119790 20:63449085-63449107 CTGGGGCACTGGCAGGAGGACGG + Intronic
1179101499 21:38358976-38358998 TGTTGGCAGTGGCAGACGGAAGG - Intergenic
1179725995 21:43341538-43341560 CTGGGGCAGTGGCAGCTGCCCGG - Intergenic
1180092676 21:45541105-45541127 CTGCAGCAGTGATAGCCGGAGGG - Intronic
1181003907 22:20000492-20000514 ATGTGGCGGTGGGAGCCAGATGG - Intronic
1181558175 22:23684092-23684114 CCCTGGCAGAGGCAGCCGGGTGG + Intergenic
1181784815 22:25219372-25219394 CCCTGGCCCTGGCAGCCGGACGG + Intergenic
1181967813 22:26668850-26668872 CTCTGGGAGGGGCAGCCAGAGGG + Intergenic
1182080719 22:27526904-27526926 CTGTGGCAGTGGCAGTGGGTGGG - Intergenic
1182089072 22:27581748-27581770 CTGAGGCAGTGGGACCCAGAGGG - Intergenic
1182483079 22:30622314-30622336 CTGTGGCAGTGGCATCCAGACGG + Intronic
1183356121 22:37360581-37360603 CTGTCCCTGTGCCAGCCGGATGG - Intergenic
1183412173 22:37661231-37661253 CTATGGGAGTGACAGCAGGATGG - Intronic
1184035821 22:41917649-41917671 CTGGGGCAGTGTCAGCTGAATGG - Intergenic
1184671013 22:46012402-46012424 GTGGGGAAGTGGCAGCGGGAGGG - Intergenic
1185233738 22:49699275-49699297 CCGTGGGGGTGGCAGACGGATGG + Intergenic
1185330539 22:50250280-50250302 CTCTGGCAGTGCCAGCAGGCAGG + Intronic
950199547 3:11033616-11033638 CTGTGACATTGGGAGCAGGAGGG - Intronic
950542128 3:13618979-13619001 CTGCGGCAGTGGCAGCGGGATGG - Exonic
951274678 3:20671030-20671052 CTGTGGAAGTGGCAGATGGTAGG + Intergenic
952566881 3:34669432-34669454 CTGTGGTAGTGGTAGCCACAGGG + Intergenic
952869510 3:37886004-37886026 CTGTGGCAGTGGGAAATGGAGGG - Intronic
953118749 3:40018626-40018648 AGGTGGCAGTGGAAGCAGGAAGG - Intronic
953248865 3:41224617-41224639 CTGTGGTAGTGGCACCAGAATGG - Exonic
961036078 3:123642521-123642543 CTGTGCCAGTGACAGCTGGAGGG + Intronic
961427743 3:126861495-126861517 CGGTGGCAGTGGCAGGGGCAGGG - Intronic
961582212 3:127892168-127892190 AGGTGGCAGTGGCCGCCTGAGGG - Intergenic
962212703 3:133492175-133492197 CTGGGGCACTGGCAGCCGTGGGG - Intergenic
964011878 3:151901402-151901424 CTGTGGCAGTGGGTGCAGGCAGG - Intergenic
968538872 4:1152121-1152143 CGGCGGCACTGGCAGCAGGAAGG - Intergenic
968983996 4:3865566-3865588 CTGTGGCTGTGACAGCTGGGTGG + Intergenic
969090539 4:4690766-4690788 CTCTGGCAGTGGCAGCTGGTGGG + Intergenic
970573442 4:17404901-17404923 CTGGGGCAGGGGCAGCTGCATGG - Intergenic
972541659 4:40044144-40044166 CTGTGGCGGTGGCTGCAGGAGGG + Intergenic
980503055 4:133682029-133682051 CTGTGGTGGTGGCAGCAGGGTGG + Intergenic
981353670 4:143762056-143762078 CAGTGGCACTGGCAGCCTGGTGG + Intergenic
981518300 4:145634328-145634350 CTGTGGCAGTGGCAGTCATGGGG - Intronic
985103674 4:186482066-186482088 CTGAGGCAGCGGCAGCTGGCAGG - Intronic
985663368 5:1168695-1168717 CTGTGTCAGGGCCAGCCTGATGG - Intergenic
986104211 5:4644290-4644312 CTGCGGAAGCGGCAGCAGGAAGG - Intergenic
986552580 5:8974652-8974674 CTGTGGCAATGGCTGCAGGCAGG + Intergenic
988737403 5:34036043-34036065 CTGTTACAGTAGCAGCAGGAAGG - Intronic
990595836 5:57311478-57311500 CTATGGCAGGGGCAGGCAGAGGG + Intergenic
991647400 5:68815036-68815058 CTGTGGCCTTGGCAGGGGGAGGG - Intergenic
995032624 5:107496568-107496590 CTGTGTCAGTGAGAGCAGGAAGG - Intronic
996722663 5:126645315-126645337 CTGAAACAGTGGCAGCCAGAAGG - Intergenic
997068354 5:130589943-130589965 CAGTGGCAGTGGCCGCAGGCAGG - Intergenic
997691228 5:135828815-135828837 CTGTAGGAGGGGCAGCTGGAAGG - Intergenic
998094538 5:139389836-139389858 CAGTGGCAGTGACAGCCTCATGG + Exonic
998188325 5:140000365-140000387 CTGCGGCAGGGGAAGCTGGAAGG - Intronic
999114418 5:149149953-149149975 CTGTGGCTGTGGCCCCAGGAAGG + Intronic
1001897871 5:175396989-175397011 CTGGGGCAGAGCCAGCGGGACGG + Intergenic
1002105702 5:176878577-176878599 CTGTGGGTGTGGCAGGTGGAGGG + Exonic
1002643171 5:180640217-180640239 ATGAGGCAGTCGCAGCCGGCCGG - Intronic
1004995782 6:21191595-21191617 CAGTGGCAGTGGCAGAAGAAAGG - Intronic
1006905329 6:37529462-37529484 CTGAGACAGCGGCAGCAGGAAGG - Intergenic
1007409385 6:41653216-41653238 CTGCGGCAGCGGCAGCAGCAGGG - Intronic
1009408768 6:63341237-63341259 CAGTGGCAGTGGCAGTGGGCAGG + Intergenic
1010333068 6:74646913-74646935 CAGTGGCAGTGGTAGCAGGTTGG - Intergenic
1010815712 6:80355837-80355859 CTGTGGCAGTAGCAGCCCTTAGG - Intergenic
1010851375 6:80782037-80782059 CAGTGGCAGTGGGAGCTGGTAGG + Intergenic
1014138841 6:117918072-117918094 CTGTGGCTGTGGCAACCACAGGG + Intronic
1014553878 6:122821974-122821996 CTGTGCCAGTGGCAGATAGAGGG + Intergenic
1014644161 6:123953575-123953597 CTGTGGTAGTAGCAGCGGGTTGG + Intronic
1015882295 6:137881394-137881416 CTGTTGCAGTGGCAGCTGAGGGG - Exonic
1018028785 6:159826030-159826052 CAGTTGCAGTGGCAGCAGCAAGG - Intergenic
1018650715 6:165989134-165989156 CTGCTGCAGGAGCAGCCGGATGG + Intergenic
1018683168 6:166281706-166281728 TGGAGGCAGTGGCAGCCCGAGGG + Intergenic
1019142679 6:169957928-169957950 GAGGGGCAGTGGCAGCCGGGAGG - Intergenic
1022630449 7:32079619-32079641 CTTTGGCAGGGACAGCTGGAAGG + Intronic
1024828228 7:53417811-53417833 ATGGAGCAGTGGCAGACGGAGGG - Intergenic
1026864075 7:73811789-73811811 CTGTGCTAGTGGCAGGTGGAGGG - Intronic
1029194754 7:98797428-98797450 CTGTGTCAGAGGCCGACGGAGGG + Intergenic
1030065261 7:105654500-105654522 CTGTAGCACTGGAAGCCAGAAGG + Intronic
1030345754 7:108431279-108431301 CTGTGGCAGTGGAAGTGGCACGG - Intronic
1030738305 7:113077617-113077639 CTGTGAAAGTGGGAGCAGGAAGG - Intergenic
1032781589 7:135168785-135168807 CAGTGCCAGTGGCAGCAGCAAGG - Exonic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1035321908 7:158035460-158035482 GTGTGGCAGTGGCAGGCAGGGGG + Intronic
1035680524 8:1484152-1484174 CTGTGGCCTTGGCACCTGGAGGG - Intergenic
1035690303 8:1555475-1555497 CTGTGGCAGTCGGGGCCGGGGGG - Intronic
1036065898 8:5380958-5380980 CTGTGGCTGTGGGAGACGCAGGG + Intergenic
1036369940 8:8154301-8154323 CGGTGGCAGCAGCAGCTGGAGGG - Intergenic
1036759336 8:11496568-11496590 CTGTGGCAGGGGCTGCAGGACGG + Intronic
1036880952 8:12511329-12511351 CGGTGGCAGCAGCAGCTGGAGGG + Intergenic
1039905946 8:41786456-41786478 CAGTGGCTGGGGCAGCCTGAAGG - Intronic
1040415233 8:47189208-47189230 ATGTGGCAGTGGAAGGCGCAGGG + Intergenic
1042785134 8:72537531-72537553 CTGTGGCGGCGGCAGGGGGATGG + Exonic
1043499369 8:80837847-80837869 CTGTGGCAGTGGCAGTCAGGGGG - Intronic
1045256807 8:100531969-100531991 CTAAGGCAGTGGCAGGCAGAAGG + Intronic
1045975109 8:108122963-108122985 CTGTGGCAGTGGGATCCGCTGGG + Intergenic
1046121063 8:109848233-109848255 CAGTGGCAATGGCAGCAGGCTGG + Intergenic
1046491115 8:114953715-114953737 ATGTGGCAGAGGCAGCAGGGAGG - Intergenic
1047325073 8:123828250-123828272 CTGTGGGAGTGACAGACGAAGGG - Intergenic
1047508379 8:125497581-125497603 GTGTGGGAGAGGCAGCCAGAAGG + Intergenic
1048863433 8:138740899-138740921 CTGTGGCTGTGGCTACAGGAAGG - Intronic
1049009388 8:139877218-139877240 CAGTGGAAGAGGCAGGCGGAGGG + Intronic
1049100893 8:140578173-140578195 TCGTGGCTGTGGCAGCAGGATGG + Intronic
1049794038 8:144488386-144488408 CTGGGGCTGTGGGAGCAGGAGGG + Intronic
1050774798 9:9246486-9246508 CTGTGGGAGTGGAGGCAGGAAGG - Intronic
1051306771 9:15718213-15718235 CTGTGGCAGTGGTGGCCAGGGGG + Intronic
1052203696 9:25812598-25812620 CTGTGGGAGTGACAGCAAGAAGG - Intergenic
1052386702 9:27831258-27831280 CTGTGGGAGTGGCAGGGGGAGGG - Intergenic
1052707556 9:32011120-32011142 CTGTGGGACTGGCAGCCAGCTGG - Intergenic
1055166447 9:73201251-73201273 CTGTGGCAGTTGCAGCTGATCGG - Intergenic
1056767203 9:89452123-89452145 GTGTGCCAGAGGCAGCTGGATGG + Intronic
1057598261 9:96435197-96435219 CTCTGGCAGTTGCAGTCAGATGG + Intergenic
1059679973 9:116576525-116576547 CTGTGGCAGTGCCAGCCTGTAGG - Intronic
1060483049 9:124029210-124029232 CTGTGGCAGTGCATGCTGGAGGG + Intronic
1061012831 9:127965563-127965585 CTGAGGGAGGGGCAGACGGATGG - Intronic
1061968330 9:134029054-134029076 CTGTGGGAGTGTCAGCCGGCGGG - Intergenic
1062056901 9:134473526-134473548 CAGTGGCAGGGGTAGCCCGAGGG - Intergenic
1062496783 9:136835684-136835706 CTGGGGCACTCGCAGCAGGAAGG + Intronic
1062580199 9:137226009-137226031 CTGTGGCAGCGGCAGAAGGGGGG - Exonic
1186602099 X:11049319-11049341 CTGGGGCAGTGACAGCCACAGGG - Intergenic
1187933103 X:24311732-24311754 CTGTGGCGGCGGCGGCCGGTGGG - Intergenic
1189444382 X:41067148-41067170 CTGTGGGAGTGGCAGCTTGCAGG + Intergenic
1192304379 X:69943940-69943962 CTGAGGCAGTGGTAGCCACAGGG - Intronic
1193291370 X:79777106-79777128 ATGTGCCAGTGGCAGCAGGGTGG + Intergenic
1193671808 X:84396732-84396754 CTGTGGCAGTATCAGCAGGGTGG + Intronic
1194113991 X:89873465-89873487 CAGTAGCAGTGGCAGCTGCAAGG + Intergenic
1195923157 X:110002575-110002597 CAGTGGCGGTGGCAGCGGGGAGG + Intergenic
1195924912 X:110015676-110015698 CAGTAGCAGTGGCAGCCCAAGGG - Intronic
1196283950 X:113857910-113857932 CTGTTGGAGTGGCAGGGGGAGGG - Intergenic
1196515439 X:116605769-116605791 CAGTGGCAGTGGCAGAGGGCGGG + Intergenic
1197422683 X:126258123-126258145 CAGTGGCAGTGGCAGTGTGAAGG + Intergenic
1198299163 X:135317650-135317672 CTGTGGTAGAGGCAGCTGGGTGG + Intronic
1198745055 X:139881455-139881477 ATGTGGCAGTGGTAGGCGGCCGG + Intronic
1199000643 X:142632521-142632543 CAATGGCAGTGGCAGCACGACGG + Intergenic
1199490098 X:148388020-148388042 CAATGGCAGTGGCAGCAGTAAGG - Intergenic
1200064899 X:153499648-153499670 CTGTGGGAGTGGCTGCCTGAGGG - Intronic
1200066113 X:153504821-153504843 AGGTGGCAGTGGCAGCCGAAAGG - Exonic
1200111553 X:153743375-153743397 CGGTGGGAGTGGCTGCCTGAGGG + Intronic
1200338126 X:155373977-155373999 CAGTGACAGTGGCAGCCGCCAGG + Intergenic
1200348343 X:155466715-155466737 CAGTGACAGTGGCAGCCGCCAGG - Intergenic
1200466731 Y:3528821-3528843 CTGTGGCTGTGGCAGCTGCAAGG + Intergenic
1201316525 Y:12652733-12652755 GTGTGGCAGTGGCATAAGGATGG - Intergenic