ID: 1162945328

View in Genome Browser
Species Human (GRCh38)
Location 19:14039822-14039844
Sequence TCCATTGGGCCCCACCTACA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 84}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162945323_1162945328 -8 Left 1162945323 19:14039807-14039829 CCCTGGAGGCCACTGTCCATTGG 0: 1
1: 0
2: 2
3: 26
4: 170
Right 1162945328 19:14039822-14039844 TCCATTGGGCCCCACCTACATGG 0: 1
1: 0
2: 0
3: 4
4: 84
1162945325_1162945328 -9 Left 1162945325 19:14039808-14039830 CCTGGAGGCCACTGTCCATTGGG 0: 1
1: 0
2: 0
3: 13
4: 161
Right 1162945328 19:14039822-14039844 TCCATTGGGCCCCACCTACATGG 0: 1
1: 0
2: 0
3: 4
4: 84
1162945322_1162945328 -7 Left 1162945322 19:14039806-14039828 CCCCTGGAGGCCACTGTCCATTG 0: 1
1: 0
2: 2
3: 9
4: 185
Right 1162945328 19:14039822-14039844 TCCATTGGGCCCCACCTACATGG 0: 1
1: 0
2: 0
3: 4
4: 84
1162945317_1162945328 20 Left 1162945317 19:14039779-14039801 CCTGACGTGGACTTTTCCGAGGA 0: 1
1: 0
2: 0
3: 5
4: 42
Right 1162945328 19:14039822-14039844 TCCATTGGGCCCCACCTACATGG 0: 1
1: 0
2: 0
3: 4
4: 84
1162945314_1162945328 30 Left 1162945314 19:14039769-14039791 CCGGCTGGGCCCTGACGTGGACT 0: 1
1: 0
2: 1
3: 16
4: 151
Right 1162945328 19:14039822-14039844 TCCATTGGGCCCCACCTACATGG 0: 1
1: 0
2: 0
3: 4
4: 84
1162945321_1162945328 -6 Left 1162945321 19:14039805-14039827 CCCCCTGGAGGCCACTGTCCATT 0: 1
1: 0
2: 2
3: 25
4: 226
Right 1162945328 19:14039822-14039844 TCCATTGGGCCCCACCTACATGG 0: 1
1: 0
2: 0
3: 4
4: 84
1162945320_1162945328 4 Left 1162945320 19:14039795-14039817 CCGAGGATGACCCCCTGGAGGCC 0: 1
1: 0
2: 0
3: 24
4: 169
Right 1162945328 19:14039822-14039844 TCCATTGGGCCCCACCTACATGG 0: 1
1: 0
2: 0
3: 4
4: 84
1162945315_1162945328 21 Left 1162945315 19:14039778-14039800 CCCTGACGTGGACTTTTCCGAGG 0: 1
1: 0
2: 0
3: 2
4: 52
Right 1162945328 19:14039822-14039844 TCCATTGGGCCCCACCTACATGG 0: 1
1: 0
2: 0
3: 4
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162945328 Original CRISPR TCCATTGGGCCCCACCTACA TGG Exonic
903650811 1:24921029-24921051 ACCATTGGCCCCTACCCACAGGG - Intronic
908676598 1:66611489-66611511 ACCATGTGGCCTCACCTACATGG - Intronic
909374459 1:74924040-74924062 TTCTGTGGGCCCCACTTACAGGG + Intergenic
912763879 1:112391419-112391441 TCCAGTGGGCCACAGCTAGAAGG + Intergenic
912877070 1:113370843-113370865 GCTCATGGGCCCCACCTACAGGG - Intergenic
915625429 1:157111524-157111546 TGCATTGGGCCCCATCAGCATGG - Intergenic
920919840 1:210289442-210289464 GCCACTGGGCCCAGCCTACACGG + Intergenic
922538959 1:226404570-226404592 ACCATTGGGCAGCACCTCCAGGG - Intronic
1067296877 10:44979727-44979749 TCCACTGACCCCCTCCTACATGG - Intronic
1067555431 10:47266513-47266535 TCCATTGAGTCCCATCAACATGG - Intergenic
1072419063 10:95274138-95274160 CCCACTGGGCTCCAGCTACAGGG + Intronic
1084153624 11:67302520-67302542 TCCACAGCGCCCCACCTTCAGGG - Intergenic
1092996476 12:13955882-13955904 TCCAGGGGGCCCCAGCTGCATGG + Intronic
1097259963 12:57713532-57713554 TCCACTCAGCCCCACCCACAGGG - Intronic
1116160670 14:41263829-41263851 TCCAATGGGCTCCGCCTACCAGG - Intergenic
1119723712 14:76909022-76909044 TTCATTGGGCTCCTCCTCCAAGG - Intergenic
1120948001 14:90015976-90015998 TCCCTTGGGGCCCACCTAATTGG - Intronic
1122972670 14:105158742-105158764 TCCTCTGGGCCCCACCTGGAAGG - Intronic
1129269329 15:74411181-74411203 TCCTGTGGGCCCCAGGTACATGG - Intronic
1131919579 15:97309628-97309650 GCCATTTGGCCCCACCTAAGAGG - Intergenic
1133839678 16:9396196-9396218 TCCTCTGGGCCCCACCTGCCAGG + Intergenic
1136498915 16:30659970-30659992 CCCATTAGGCCCCACCTGCAAGG - Exonic
1137432175 16:48427282-48427304 TCCATAGGACCCTACCTAGATGG + Intronic
1138346650 16:56324412-56324434 TTCTTTGGGCCCTACCTTCATGG - Intronic
1138477396 16:57279905-57279927 TCCATTTTGCCCCACCTCCTGGG - Intronic
1139891254 16:70254461-70254483 TCCATGGGGTCCCTGCTACAAGG + Intronic
1141079481 16:81037491-81037513 ACAATTCGGCCCCACCTGCACGG - Intronic
1143731559 17:8885390-8885412 TCCCCAGGGCCCCACCTACCAGG + Intronic
1144313524 17:14036831-14036853 CCCATCAGGCCCCACCTCCAAGG + Intergenic
1148783807 17:50135516-50135538 TCCACTGGGCCCTGCCCACAGGG + Intronic
1152542207 17:80982066-80982088 TCCGCTGGGCCCCACCGACGCGG + Intergenic
1153948483 18:10037463-10037485 TCCACTGGGGCCCAGCTTCATGG - Intergenic
1162482379 19:10935701-10935723 GACATTGGGCCCTCCCTACATGG - Intergenic
1162945328 19:14039822-14039844 TCCATTGGGCCCCACCTACATGG + Exonic
1167586784 19:50379872-50379894 TCCCCTGGGCCCTACCTGCACGG - Exonic
1168262208 19:55202093-55202115 TCCATTCTTCCCCACCCACACGG + Exonic
928216130 2:29362909-29362931 TCCATTGGTTCCCATTTACATGG + Intronic
928618128 2:33059477-33059499 TCCACTGGGCACCACGGACATGG - Intronic
943931835 2:193864561-193864583 TCCATAGGGCTCCACCAATATGG - Intergenic
947601868 2:231456375-231456397 TCCACTGGGCCCCACCTGCTTGG - Intronic
1170475946 20:16714579-16714601 TCCACAGCTCCCCACCTACAGGG - Intergenic
1172872043 20:38142012-38142034 TCCATGGGGCCCTCCCTACTGGG + Intronic
1176252915 20:64134141-64134163 TCCACTGGGCCACCCCCACATGG - Intergenic
1177930667 21:27279036-27279058 TCCCTTGGGCCCCATTTATAAGG + Intergenic
1182271837 22:29158695-29158717 TCCAGATGGCCCCACCTCCAGGG + Intronic
1184565440 22:45289003-45289025 TCCTGTGAGCCCCACCCACAGGG - Intronic
949961082 3:9313050-9313072 CCCATTGCTCCCCATCTACAAGG + Intronic
950161633 3:10764851-10764873 TACATTGGGCCTCAACTCCAGGG - Intergenic
952366250 3:32677501-32677523 ACCACTGTGCCCGACCTACAAGG - Intergenic
952776743 3:37053800-37053822 TCCTTGGGGCCCTACCTAGAGGG - Exonic
960505287 3:118486423-118486445 TCCTTTGAGCACCAGCTACAAGG - Intergenic
961145857 3:124592703-124592725 ACCCGTGGGCCTCACCTACAAGG - Intronic
964894445 3:161578558-161578580 TACATTGGACACCAGCTACACGG - Intergenic
965370163 3:167852262-167852284 TGCATTGGGCCCCATTTTCAAGG + Intergenic
965627718 3:170698344-170698366 TCCTCTGGGCCCCACCTGCTGGG - Intronic
967933539 3:194708167-194708189 TCCAAGGGGCCCCACTCACAAGG + Intergenic
968948386 4:3677443-3677465 TCCACGAAGCCCCACCTACATGG - Intergenic
969015147 4:4098913-4098935 TCTATTCGGCCCCAGCTAGAAGG - Intergenic
970825599 4:20269705-20269727 TCCATTAGCCCCCACCTGGATGG + Intronic
974586291 4:63882987-63883009 TCATGTGGGCCCCACCTTCATGG - Intergenic
977169545 4:93743753-93743775 CCCATTAGGCCCCACCTAATGGG + Intronic
978672467 4:111267098-111267120 TTCAGTGGGCCCCACCTCCCAGG + Intergenic
980992153 4:139747405-139747427 GCCACTGTGCCCGACCTACAAGG - Intronic
986055625 5:4134021-4134043 TCCATGGGCCTCCACCCACAGGG + Intergenic
986634591 5:9808889-9808911 TCCATGGGGACCCACCCACAAGG - Intergenic
987332184 5:16866992-16867014 TCCCTCGGGCTCCACATACAAGG + Intronic
1002192281 5:177484532-177484554 TCCAGTGGGGCCCACCCCCAAGG + Intronic
1006373595 6:33659688-33659710 TCCACAGGGCCCCACCCACATGG + Intronic
1006514047 6:34536296-34536318 TCCATGGGACCCCACCCTCAGGG - Intergenic
1007695724 6:43733320-43733342 TCCACTGTGCCCCTCCTCCAGGG + Intergenic
1012843634 6:104362098-104362120 ACAAATGTGCCCCACCTACATGG + Intergenic
1022283445 7:28933320-28933342 TCGAATGGGCCCCATCTCCAAGG - Intergenic
1030600299 7:111584437-111584459 CCCACTGGGCCCTGCCTACATGG + Intergenic
1037906464 8:22718617-22718639 TCCAAAGGGCCCCACCCACCTGG - Intronic
1042760587 8:72267911-72267933 TCCATTGGGCATTTCCTACAGGG + Intergenic
1045595578 8:103650905-103650927 TTCTGTGGGCCCCACTTACATGG - Intronic
1046443968 8:114291139-114291161 GCCATTGTGTCCCACCTAAAGGG - Intergenic
1057929425 9:99180779-99180801 TCCATTGGCAGGCACCTACATGG + Intergenic
1058955968 9:109949075-109949097 CCCTTTGGGCCACACCTGCAAGG - Intronic
1060406712 9:123376439-123376461 TCCACTGGGGCCCACCTGCGGGG - Intronic
1185454377 X:301134-301156 TCCCTGGAGCCCCAGCTACACGG - Exonic
1187151450 X:16685363-16685385 TCCACTGGGTCACACCTACCAGG + Intronic
1187479060 X:19638502-19638524 TCAACTGGGCCCCACCCCCAGGG + Intronic
1189379981 X:40495770-40495792 TCAAGATGGCCCCACCTACAAGG - Intergenic
1190411661 X:50142097-50142119 TCCATTTGGCCTCACCTCTAAGG - Intergenic
1190485477 X:50919325-50919347 ACCATTTCTCCCCACCTACATGG - Intergenic
1198816845 X:140600500-140600522 TCCATTGGGCCACTGCAACAAGG + Intergenic
1200141740 X:153905953-153905975 TCCAGTGAGCCCCACTTCCATGG - Exonic
1200838483 Y:7755978-7756000 TGCACTGGGCCCCAGCAACAGGG - Intergenic