ID: 1162947859

View in Genome Browser
Species Human (GRCh38)
Location 19:14054586-14054608
Sequence CACTCTCTCCACCCAAATGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 152}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162947852_1162947859 11 Left 1162947852 19:14054552-14054574 CCACCAGCAGCTCCTCCCACTCT 0: 1
1: 1
2: 6
3: 75
4: 684
Right 1162947859 19:14054586-14054608 CACTCTCTCCACCCAAATGAAGG 0: 1
1: 0
2: 1
3: 13
4: 152
1162947848_1162947859 20 Left 1162947848 19:14054543-14054565 CCAACCCCTCCACCAGCAGCTCC 0: 1
1: 0
2: 7
3: 102
4: 1082
Right 1162947859 19:14054586-14054608 CACTCTCTCCACCCAAATGAAGG 0: 1
1: 0
2: 1
3: 13
4: 152
1162947846_1162947859 25 Left 1162947846 19:14054538-14054560 CCCTTCCAACCCCTCCACCAGCA 0: 1
1: 0
2: 3
3: 50
4: 579
Right 1162947859 19:14054586-14054608 CACTCTCTCCACCCAAATGAAGG 0: 1
1: 0
2: 1
3: 13
4: 152
1162947847_1162947859 24 Left 1162947847 19:14054539-14054561 CCTTCCAACCCCTCCACCAGCAG 0: 1
1: 0
2: 3
3: 67
4: 553
Right 1162947859 19:14054586-14054608 CACTCTCTCCACCCAAATGAAGG 0: 1
1: 0
2: 1
3: 13
4: 152
1162947850_1162947859 15 Left 1162947850 19:14054548-14054570 CCCTCCACCAGCAGCTCCTCCCA 0: 1
1: 0
2: 3
3: 85
4: 821
Right 1162947859 19:14054586-14054608 CACTCTCTCCACCCAAATGAAGG 0: 1
1: 0
2: 1
3: 13
4: 152
1162947856_1162947859 -1 Left 1162947856 19:14054564-14054586 CCTCCCACTCTTCACTGAGGGTC 0: 1
1: 0
2: 1
3: 10
4: 191
Right 1162947859 19:14054586-14054608 CACTCTCTCCACCCAAATGAAGG 0: 1
1: 0
2: 1
3: 13
4: 152
1162947857_1162947859 -4 Left 1162947857 19:14054567-14054589 CCCACTCTTCACTGAGGGTCACT 0: 1
1: 0
2: 1
3: 20
4: 151
Right 1162947859 19:14054586-14054608 CACTCTCTCCACCCAAATGAAGG 0: 1
1: 0
2: 1
3: 13
4: 152
1162947851_1162947859 14 Left 1162947851 19:14054549-14054571 CCTCCACCAGCAGCTCCTCCCAC 0: 1
1: 0
2: 11
3: 138
4: 1050
Right 1162947859 19:14054586-14054608 CACTCTCTCCACCCAAATGAAGG 0: 1
1: 0
2: 1
3: 13
4: 152
1162947858_1162947859 -5 Left 1162947858 19:14054568-14054590 CCACTCTTCACTGAGGGTCACTC 0: 1
1: 0
2: 2
3: 19
4: 162
Right 1162947859 19:14054586-14054608 CACTCTCTCCACCCAAATGAAGG 0: 1
1: 0
2: 1
3: 13
4: 152
1162947853_1162947859 8 Left 1162947853 19:14054555-14054577 CCAGCAGCTCCTCCCACTCTTCA 0: 1
1: 0
2: 3
3: 44
4: 533
Right 1162947859 19:14054586-14054608 CACTCTCTCCACCCAAATGAAGG 0: 1
1: 0
2: 1
3: 13
4: 152
1162947849_1162947859 16 Left 1162947849 19:14054547-14054569 CCCCTCCACCAGCAGCTCCTCCC 0: 1
1: 0
2: 10
3: 125
4: 1153
Right 1162947859 19:14054586-14054608 CACTCTCTCCACCCAAATGAAGG 0: 1
1: 0
2: 1
3: 13
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162947859 Original CRISPR CACTCTCTCCACCCAAATGA AGG Exonic
907643185 1:56213362-56213384 CTCTCTCTCCCCCTTAATGAAGG + Intergenic
908648882 1:66310391-66310413 CACTCTCTCAATGCAAATGGAGG + Intronic
909848422 1:80428793-80428815 CCCACTCTCCACCCAAAACAAGG - Intergenic
910644953 1:89504410-89504432 CATTCTCTTCACCTAAATAAAGG + Intergenic
912543357 1:110433504-110433526 CTCCCTCTCCACCCTAATGGAGG + Intergenic
913219242 1:116646060-116646082 CACTTCCTCTACCCTAATGAGGG + Intronic
914893182 1:151646439-151646461 TACTCTATCCATCCAAAAGAAGG - Intronic
916083247 1:161250077-161250099 AACTCACTCCAACAAAATGATGG - Intergenic
917705807 1:177633527-177633549 CAATCTCCAAACCCAAATGAGGG - Intergenic
920580030 1:207097861-207097883 CACTCTCCCCACCCAAAACCTGG + Intronic
920706976 1:208258639-208258661 CACTTTCTCCACCCACAGGCAGG - Intergenic
921361430 1:214334045-214334067 CACGCTCTCCACCCAAACCCTGG + Intronic
924431833 1:244004042-244004064 CAAATTCTCCACCCAAATCATGG + Intergenic
1063257046 10:4339980-4340002 CTCTCTCTCCTCCCATCTGAGGG - Intergenic
1065602285 10:27381444-27381466 CAGACTTTCCACCCAATTGATGG - Intergenic
1066336239 10:34481252-34481274 CCCTCTCTCCACCCTCATGTAGG + Intronic
1067694967 10:48528065-48528087 CATTCTCACCACCCAACTGTGGG - Intronic
1068707546 10:60093184-60093206 CACTCTCTTAAGCCAAATCATGG - Intronic
1069752100 10:70751475-70751497 CAGGCTCTCCCCCCAACTGAGGG + Exonic
1074929967 10:118114700-118114722 CACTGTCACTACCCAAAGGATGG - Intergenic
1075846534 10:125549412-125549434 CAGTCTCTCCACCTATAAGATGG - Intergenic
1076817319 10:132921312-132921334 CACTCTCTCCAGCCCAGTGCAGG - Intronic
1083297678 11:61723965-61723987 CAGTTTCTCCACCCATATTATGG - Intronic
1085099463 11:73788235-73788257 CACTCTCTCCACCCAGTTTCTGG + Intronic
1085190197 11:74613885-74613907 CACTCTATCCATCCAAAAGTGGG - Intronic
1085241487 11:75060113-75060135 CACACTCTCCACCTCAAGGATGG - Intergenic
1089128583 11:116194418-116194440 CACACTCCCCACCCAGAGGAAGG - Intergenic
1089357875 11:117867098-117867120 CAATTTCTCCACCTAAATGCAGG - Intronic
1090539146 11:127681067-127681089 CACTCACACCACCCCAATCATGG + Intergenic
1092084307 12:5743071-5743093 TTCTGTCTCCACCCAAGTGAAGG + Intronic
1092693387 12:11141784-11141806 CCCTCCCTCCACCCAAAACAAGG - Intronic
1098026925 12:66213805-66213827 GACTCTCTCCTCCCAGAGGAGGG + Intronic
1103166793 12:118776898-118776920 CACTCCCACCACCCAGATGATGG - Intergenic
1103426142 12:120836222-120836244 AACTTTCTCCAACCAAAAGACGG + Intronic
1104357875 12:128104295-128104317 CAATCTCTGCTCCAAAATGACGG - Intergenic
1104662303 12:130620168-130620190 CACCCTCTCCAGCCAAGGGATGG + Intronic
1112250379 13:97773798-97773820 GACTCTGTCCACCCAGATTAAGG + Intergenic
1112951735 13:105005920-105005942 CACAATCTACAGCCAAATGATGG + Intergenic
1114228870 14:20762644-20762666 CAATCTCTCCAGCTAACTGATGG + Intergenic
1118719997 14:68587164-68587186 CCCTCTGTCCACACAAAAGAGGG + Intronic
1120988997 14:90358490-90358512 CATTGTCTCCACCCTTATGAGGG - Intergenic
1121486540 14:94320878-94320900 CACTCCCCGCACCCAAATGATGG + Intronic
1121491211 14:94362294-94362316 CATTCTCTCCACTCCAGTGAGGG + Intergenic
1123207150 14:106724620-106724642 TACTCTCTCCACAGAACTGACGG - Intergenic
1123212175 14:106771623-106771645 TACTCTCTCCACAGAACTGACGG - Intergenic
1125148834 15:36507226-36507248 CACTCTTTCCACAGAAATGATGG - Intergenic
1128246029 15:66133418-66133440 CTCTTTCTCCACCCACATGCCGG - Intronic
1129853528 15:78809444-78809466 CACTCTCTCCAACCTAATCTGGG - Intronic
1131443835 15:92479241-92479263 GTCTCTCACCACCCAAAAGAGGG + Intronic
1131619713 15:94054783-94054805 CACTCTCTCCTCCCCAGGGAGGG - Intergenic
1133799063 16:9070173-9070195 CTCCCTCTCTGCCCAAATGAGGG - Intergenic
1137553847 16:49457875-49457897 CCCTCTCTCAGCCCAAATAAGGG + Intergenic
1139466317 16:67155893-67155915 CGCTCTCACGCCCCAAATGAGGG + Intronic
1140772479 16:78217556-78217578 CACTCTCTTCTCCCAGATGCTGG + Intronic
1142782574 17:2192571-2192593 CACTGTCTCCTCCCAAAGAAAGG + Intronic
1147805118 17:43125736-43125758 CACTCTTTCCGCCCTAATGGAGG + Intergenic
1147811124 17:43170577-43170599 CACTCTTTCCGCCCTAATGGAGG + Exonic
1152096030 17:78272106-78272128 AATTCTCTCCACCCCAAAGAAGG + Intergenic
1152125296 17:78443122-78443144 CACTCTGGCCACCTAAAAGAAGG - Intronic
1155102757 18:22629218-22629240 CGCTCCCTCCACCCAACAGAAGG + Intergenic
1155184557 18:23375939-23375961 CACTCTCTCCTCCTAAAAGAAGG + Intronic
1158012652 18:52747120-52747142 CTCTCTCTCCCTCCAAATGTTGG - Intronic
1160031809 18:75268572-75268594 CACTCTGACCACCTAAATCAGGG + Intronic
1161301219 19:3544035-3544057 CTGTCTCTGCACCCAGATGAGGG + Intronic
1161838081 19:6661310-6661332 AATTCTCTCCACCCCAAAGAAGG + Intronic
1162947859 19:14054586-14054608 CACTCTCTCCACCCAAATGAAGG + Exonic
1163355736 19:16809499-16809521 CACTCTCTTCACCCTAATCCTGG + Intronic
1166867400 19:45848207-45848229 CACTCTCTGCATCCCCATGAGGG - Intronic
1167425410 19:49427581-49427603 CACTCGCTCCACCACGATGATGG - Exonic
926797779 2:16632959-16632981 CACACCCTCCACCCCAATGAGGG + Intronic
928060884 2:28111876-28111898 CAGTATCAGCACCCAAATGAGGG - Intronic
928465331 2:31518041-31518063 CACACTCTGCAGCCAAATGCTGG + Intergenic
932137087 2:69240982-69241004 CAATATCTCCAGCTAAATGAAGG - Intronic
932236767 2:70126703-70126725 GACTGTCTTCACCCAAGTGAAGG + Intergenic
932321779 2:70827651-70827673 CACACACCCCACCCAAATAATGG + Intergenic
932996139 2:76855792-76855814 CCCACCCTCCACCCAACTGAGGG - Intronic
934896068 2:98121367-98121389 CAGTTTCTCAACCCAACTGATGG - Exonic
935134387 2:100286835-100286857 CAAGCTCTCCACCAGAATGATGG + Intronic
935559313 2:104544160-104544182 GAGTCTCTCTACCCAAATGTGGG - Intergenic
936860895 2:117019254-117019276 CTCTCTCTCCTCCCATAAGAGGG - Intergenic
937635864 2:124154551-124154573 CACTCTGTCCTGCCACATGATGG + Intronic
939009143 2:136825323-136825345 CACTCACTGCACCAAAATCAAGG + Intronic
944312688 2:198251791-198251813 CAATCTCTTCACACAAATGAGGG + Intronic
944398670 2:199300110-199300132 CACTCTTTACACCTAAAAGAAGG - Intronic
946498038 2:220215918-220215940 CACACTCTCCACGTAGATGAAGG + Intergenic
947399636 2:229718226-229718248 CACTGTCTACAGGCAAATGAAGG - Intergenic
947992007 2:234495836-234495858 GAATCTCTGCACCCAAATGCAGG - Exonic
948265419 2:236632245-236632267 CACTCTTACCAGCCACATGATGG - Intergenic
948823014 2:240559639-240559661 CACTTCCTCCACCCTAAGGAAGG - Intronic
1169263828 20:4155804-4155826 CAGTCACTACACCCAAAAGAAGG + Intronic
1170622075 20:18004623-18004645 CAGTCTCTCCACACATATGGTGG - Intronic
1170624418 20:18020507-18020529 CGCTCTCTCCACTCAATTCAGGG + Intronic
1172690445 20:36786041-36786063 CAGTGTCTCCTCCCAAATGAAGG + Exonic
1172834462 20:37864058-37864080 CACCCTCTCCACCCAAGTGAGGG - Intronic
1172922127 20:38492968-38492990 CAGTCTCTCCATCCAATGGAAGG - Exonic
1175394105 20:58646985-58647007 CACTGTCTCTACCCAAATTCTGG - Intergenic
1175486904 20:59353402-59353424 CACTCTCCCCACCCAGCTGTGGG + Intergenic
1182626331 22:31649393-31649415 CCCTCTCTCCAGCCAACTAAGGG - Intronic
1184292598 22:43506075-43506097 CTTTCTCTCCTCCCAAGTGAGGG + Exonic
1184647549 22:45904267-45904289 CACGCCCTCCACCCACAGGAGGG - Intergenic
949141012 3:632958-632980 CACTCTCTACACACACATAAAGG + Intergenic
950041797 3:9924384-9924406 CACAGTCTCCACCTCAATGAAGG - Intronic
957275103 3:78080900-78080922 TACTCTATCCACACAAATTAAGG - Intergenic
958986332 3:100783338-100783360 CTTTCTCTACACCCTAATGAGGG - Intronic
960002054 3:112742945-112742967 CAACCTCTCCACCCAATTGTGGG - Intergenic
963792679 3:149600510-149600532 CACTCACTCCACTCACCTGAAGG + Intronic
964391874 3:156206240-156206262 CTCACACTCAACCCAAATGATGG + Intronic
965367515 3:167818708-167818730 CACTTGCCCCACCAAAATGATGG - Intronic
965790214 3:172379378-172379400 GACTCTCTACTCCCACATGAAGG + Intronic
966195006 3:177304263-177304285 CACACTCTCACCCCAAGTGAAGG - Intergenic
967155258 3:186685876-186685898 CAGTCTCTCCTCCCATGTGATGG - Intergenic
969170442 4:5358178-5358200 AACACTCTCCACCCAATTGCGGG - Intronic
969940334 4:10725351-10725373 TTCACACTCCACCCAAATGAAGG - Intergenic
972796595 4:42427473-42427495 CTCTCACTCCACCAAACTGATGG - Intronic
976272889 4:83248360-83248382 TACTCTCTCCACCCAACCCATGG + Intergenic
977263257 4:94823472-94823494 CACTGGCTCCTCCAAAATGAGGG - Intronic
978391987 4:108236634-108236656 CAGTTTCTTCATCCAAATGAGGG - Intergenic
981180097 4:141731469-141731491 CACTCTTTCCACCAATAAGATGG - Intronic
981448092 4:144864126-144864148 CCCTCCCTCCACCCTAAAGAAGG - Intergenic
990554478 5:56917557-56917579 CTCTCTCTCCACCCACTGGAGGG + Intergenic
992060015 5:73035127-73035149 CACTGTGCCCAGCCAAATGATGG - Intronic
992833175 5:80615255-80615277 CTCTCTCTCTACCCAAATCCAGG + Intergenic
994647063 5:102483469-102483491 CACTCTCTCTTCCAAAATGAAGG - Intronic
997371259 5:133362456-133362478 CAGTCACTCCTCCCAAAAGAGGG + Intronic
997374540 5:133387804-133387826 CACTCTAGCCACCGAGATGAAGG + Intronic
997743662 5:136279662-136279684 AACTCTCTCCACCCCACTGGAGG + Intronic
998403048 5:141858079-141858101 CACTGCCTCCTTCCAAATGAGGG + Intronic
998711545 5:144831577-144831599 CACCCTCTCAAGCCAACTGATGG + Intergenic
999445417 5:151634822-151634844 TAATCTCACCACCCTAATGATGG - Intergenic
999771672 5:154780667-154780689 CACCCTCTCCACTCCAATAATGG + Intronic
1001198560 5:169695317-169695339 CACTACCTCAACCCAACTGATGG + Intronic
1003158634 6:3617522-3617544 CACCATCTCTTCCCAAATGAGGG - Intergenic
1003977784 6:11360217-11360239 CACCCTCTTCACCCTAATGGGGG - Intronic
1007880405 6:45159066-45159088 CATTCTCTCCTCCCCACTGAAGG + Intronic
1008174207 6:48246656-48246678 CACTCCCTCCTCCCAATGGAGGG - Intergenic
1012244384 6:96910172-96910194 CACTCCCTGTTCCCAAATGAAGG - Intergenic
1015145247 6:129977942-129977964 CACCATCTCCCCCAAAATGAAGG - Intergenic
1015506614 6:133994930-133994952 CACTATCTCCAGTCAAATGCTGG + Intronic
1016334022 6:142984390-142984412 CTGGCTCTCCACCCAAATTACGG + Intergenic
1016891707 6:149014204-149014226 CACTTGCTTCACCCACATGAGGG - Intronic
1021716881 7:23469384-23469406 CACTCTCTCCTCCCACAGGGTGG + Intronic
1022627757 7:32055595-32055617 CATTCTGTCCACCAAAATGCAGG + Intronic
1023101367 7:36721766-36721788 GACCCTCTCCATCAAAATGAAGG + Intronic
1026816136 7:73513783-73513805 CACTTTGTCCTCCCAAATGCTGG - Intronic
1032416013 7:131736254-131736276 TACTCTCTCCAGCAAAATCATGG - Intergenic
1033061140 7:138109367-138109389 CTTTCTCTCCACCCACATGGTGG + Intronic
1037573046 8:20174726-20174748 CATTCTGTCCACTGAAATGAGGG + Intronic
1038433375 8:27517650-27517672 CACTCTCTTCAAACAAATGGTGG + Intronic
1043645472 8:82512141-82512163 CTCTCTCTCCACCAATAGGACGG + Intergenic
1046462593 8:114560488-114560510 TCCTCTTACCACCCAAATGATGG + Intergenic
1046870355 8:119198741-119198763 AACTCTCTCCACCTAAATGGTGG + Intronic
1047201731 8:122772939-122772961 CTCTCTCTTCTCCCAAATGAAGG + Intergenic
1047885245 8:129243198-129243220 CACCATTTCCACCCAAATTATGG - Intergenic
1049781165 8:144429598-144429620 CAGTCTCCCCACCCATAAGAAGG + Intronic
1049958844 9:718914-718936 CACTCTTTAAGCCCAAATGATGG - Intronic
1051349207 9:16183203-16183225 CAGTCTCTCAGCTCAAATGAAGG - Intergenic
1051474080 9:17483595-17483617 CACTCTGTCCAACCAAATTAAGG + Intronic
1053020762 9:34692174-34692196 CCCTCTCTCCATCCAAAAGAGGG - Intergenic
1059573463 9:115465588-115465610 CACCCCCTCCACCCATATCATGG - Intergenic
1186619910 X:11228535-11228557 CACTTTCTTCACCAAAAAGAGGG - Intronic
1186794862 X:13036175-13036197 GACTCTCTTCACCAAAAAGAGGG + Exonic
1187852685 X:23606629-23606651 CATTTTCTCCACCAACATGAGGG + Intergenic
1189120668 X:38391048-38391070 CACTCTCTCCATGAAAAGGATGG - Intronic
1189380650 X:40500179-40500201 CACTCTCACCTCCCAACAGAGGG + Intergenic
1191697868 X:64007667-64007689 CTCTTTCACCACCCAGATGAAGG - Intergenic
1197305835 X:124841191-124841213 CACTTTTTCCACCCAACTGAAGG - Intronic
1199890655 X:152075963-152075985 TCCTCTCTCCACCCAAATCCTGG - Intergenic