ID: 1162950036

View in Genome Browser
Species Human (GRCh38)
Location 19:14065839-14065861
Sequence AAGAAGAAGAAGAAGAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5205
Summary {0: 13, 1: 55, 2: 313, 3: 900, 4: 3924}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162950031_1162950036 24 Left 1162950031 19:14065792-14065814 CCACTGCACTCTAGCCTGGGTGA 0: 5242
1: 93352
2: 181621
3: 207317
4: 174563
Right 1162950036 19:14065839-14065861 AAGAAGAAGAAGAAGAAGGCTGG 0: 13
1: 55
2: 313
3: 900
4: 3924
1162950032_1162950036 10 Left 1162950032 19:14065806-14065828 CCTGGGTGACAAAGCGAGACTCC 0: 492
1: 14761
2: 69982
3: 117596
4: 147951
Right 1162950036 19:14065839-14065861 AAGAAGAAGAAGAAGAAGGCTGG 0: 13
1: 55
2: 313
3: 900
4: 3924

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162950036 Original CRISPR AAGAAGAAGAAGAAGAAGGC TGG Intergenic
Too many off-targets to display for this crispr