ID: 1162950229

View in Genome Browser
Species Human (GRCh38)
Location 19:14067708-14067730
Sequence GTGTGGGCCTGCTACTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162950229_1162950238 21 Left 1162950229 19:14067708-14067730 CCTCCTGAGTAGCAGGCCCACAC No data
Right 1162950238 19:14067752-14067774 TTTGTATTTTTAGTAGAGACGGG 0: 164005
1: 210050
2: 126715
3: 67031
4: 60843
1162950229_1162950239 22 Left 1162950229 19:14067708-14067730 CCTCCTGAGTAGCAGGCCCACAC No data
Right 1162950239 19:14067753-14067775 TTGTATTTTTAGTAGAGACGGGG 0: 98173
1: 216399
2: 153384
3: 81062
4: 60801
1162950229_1162950237 20 Left 1162950229 19:14067708-14067730 CCTCCTGAGTAGCAGGCCCACAC No data
Right 1162950237 19:14067751-14067773 TTTTGTATTTTTAGTAGAGACGG 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162950229 Original CRISPR GTGTGGGCCTGCTACTCAGG AGG (reversed) Intergenic
No off target data available for this crispr