ID: 1162953535

View in Genome Browser
Species Human (GRCh38)
Location 19:14085743-14085765
Sequence CCGGAGCCGCGCCGCCGCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 243}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162953518_1162953535 22 Left 1162953518 19:14085698-14085720 CCCCGCCCCGGGAGCCTCCGACT 0: 1
1: 0
2: 1
3: 13
4: 159
Right 1162953535 19:14085743-14085765 CCGGAGCCGCGCCGCCGCGCCGG 0: 1
1: 0
2: 3
3: 30
4: 243
1162953528_1162953535 -4 Left 1162953528 19:14085724-14085746 CCCTGCCTTGACCTCTCCACCGG 0: 1
1: 0
2: 3
3: 12
4: 167
Right 1162953535 19:14085743-14085765 CCGGAGCCGCGCCGCCGCGCCGG 0: 1
1: 0
2: 3
3: 30
4: 243
1162953526_1162953535 5 Left 1162953526 19:14085715-14085737 CCGACTGGCCCCTGCCTTGACCT 0: 1
1: 0
2: 5
3: 45
4: 504
Right 1162953535 19:14085743-14085765 CCGGAGCCGCGCCGCCGCGCCGG 0: 1
1: 0
2: 3
3: 30
4: 243
1162953531_1162953535 -9 Left 1162953531 19:14085729-14085751 CCTTGACCTCTCCACCGGAGCCG 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1162953535 19:14085743-14085765 CCGGAGCCGCGCCGCCGCGCCGG 0: 1
1: 0
2: 3
3: 30
4: 243
1162953524_1162953535 15 Left 1162953524 19:14085705-14085727 CCGGGAGCCTCCGACTGGCCCCT 0: 1
1: 0
2: 2
3: 21
4: 221
Right 1162953535 19:14085743-14085765 CCGGAGCCGCGCCGCCGCGCCGG 0: 1
1: 0
2: 3
3: 30
4: 243
1162953527_1162953535 -3 Left 1162953527 19:14085723-14085745 CCCCTGCCTTGACCTCTCCACCG 0: 1
1: 0
2: 2
3: 29
4: 296
Right 1162953535 19:14085743-14085765 CCGGAGCCGCGCCGCCGCGCCGG 0: 1
1: 0
2: 3
3: 30
4: 243
1162953530_1162953535 -5 Left 1162953530 19:14085725-14085747 CCTGCCTTGACCTCTCCACCGGA 0: 1
1: 0
2: 0
3: 15
4: 172
Right 1162953535 19:14085743-14085765 CCGGAGCCGCGCCGCCGCGCCGG 0: 1
1: 0
2: 3
3: 30
4: 243
1162953525_1162953535 8 Left 1162953525 19:14085712-14085734 CCTCCGACTGGCCCCTGCCTTGA 0: 1
1: 0
2: 1
3: 14
4: 260
Right 1162953535 19:14085743-14085765 CCGGAGCCGCGCCGCCGCGCCGG 0: 1
1: 0
2: 3
3: 30
4: 243
1162953520_1162953535 20 Left 1162953520 19:14085700-14085722 CCGCCCCGGGAGCCTCCGACTGG 0: 1
1: 0
2: 2
3: 9
4: 140
Right 1162953535 19:14085743-14085765 CCGGAGCCGCGCCGCCGCGCCGG 0: 1
1: 0
2: 3
3: 30
4: 243
1162953519_1162953535 21 Left 1162953519 19:14085699-14085721 CCCGCCCCGGGAGCCTCCGACTG 0: 1
1: 0
2: 2
3: 21
4: 195
Right 1162953535 19:14085743-14085765 CCGGAGCCGCGCCGCCGCGCCGG 0: 1
1: 0
2: 3
3: 30
4: 243
1162953522_1162953535 17 Left 1162953522 19:14085703-14085725 CCCCGGGAGCCTCCGACTGGCCC 0: 1
1: 0
2: 2
3: 16
4: 139
Right 1162953535 19:14085743-14085765 CCGGAGCCGCGCCGCCGCGCCGG 0: 1
1: 0
2: 3
3: 30
4: 243
1162953523_1162953535 16 Left 1162953523 19:14085704-14085726 CCCGGGAGCCTCCGACTGGCCCC 0: 1
1: 0
2: 1
3: 26
4: 221
Right 1162953535 19:14085743-14085765 CCGGAGCCGCGCCGCCGCGCCGG 0: 1
1: 0
2: 3
3: 30
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162953535 Original CRISPR CCGGAGCCGCGCCGCCGCGC CGG Exonic
900102138 1:966449-966471 CCGGAGCCCCGCCTGCCCGCGGG + Intergenic
900166675 1:1246769-1246791 CCTGGGCCTCGCCCCCGCGCGGG - Intergenic
900218371 1:1494420-1494442 CCGGAGCCGCACCGCCACTGTGG - Intronic
900225728 1:1532897-1532919 CCGGAGCCGCACCGCCACTGTGG - Intronic
900513054 1:3069412-3069434 CCCGGGCCGCGCGGCCGAGCCGG - Intronic
900557362 1:3287261-3287283 CTGGAGGCGCCCCGCCACGCGGG + Intronic
900557375 1:3287308-3287330 CTGGAGCCGCCCCGCCACGCGGG + Intronic
900557389 1:3287355-3287377 CTGGAGCCGCCCCGCCACGCGGG + Intronic
900557403 1:3287402-3287424 CTGGAGCCGCCCCGCCACGCGGG + Intronic
900557431 1:3287497-3287519 CTGGAGCCGCCCCGCCACGCGGG + Intronic
900557525 1:3287834-3287856 CTGCAGCCGCCCCGCCACGCGGG + Intronic
901556126 1:10032815-10032837 CCCGTCCCGCGCAGCCGCGCCGG - Intronic
902067444 1:13700142-13700164 CCGGAGCCCCCCAGCCCCGCAGG + Intergenic
903925232 1:26826926-26826948 CCGCCCCCGCCCCGCCGCGCTGG + Exonic
903950661 1:26994236-26994258 CCTGCGCCACGCCGCCGCTCAGG - Exonic
904237341 1:29123856-29123878 CTGGCGCCGCAGCGCCGCGCGGG + Intronic
904500185 1:30908717-30908739 GCGGAGCCGGGCGGCCGAGCCGG - Exonic
906717974 1:47984407-47984429 CCCGAGCCGCGCCGCCTCTCTGG - Intronic
907136257 1:52142166-52142188 CCGGAGGAGCGCCGCCGAGCCGG - Exonic
907261332 1:53220675-53220697 CCGGGGCCGGGCCGCGGGGCAGG + Intergenic
915127988 1:153679112-153679134 CCGGGGCCCCGGCGCCCCGCTGG + Exonic
920218515 1:204378216-204378238 GCGGAGCCGCGCCGCCGCCTCGG + Intergenic
920409694 1:205749726-205749748 CCGGAGCCCTGCAGCGGCGCGGG + Intronic
920920257 1:210292540-210292562 CCGGAGCCGCGCGGGGGCCCGGG + Intergenic
922648614 1:227318111-227318133 CCCGCACCGGGCCGCCGCGCCGG + Exonic
923126682 1:231039986-231040008 CCCGGGCCCCGCCGCCGCCCGGG + Exonic
1065099549 10:22320702-22320724 CAGGTTCCGCGCCGCGGCGCCGG + Intronic
1065102025 10:22340776-22340798 CTGGAGCCGCACTGCCGCTCGGG - Intergenic
1066080805 10:31928850-31928872 CGTGAGCCCCGCCCCCGCGCCGG - Intronic
1066464491 10:35640748-35640770 AGGGAGCCGCGCCGCCGCCAGGG + Exonic
1067669510 10:48306580-48306602 CCGGGGCTGCCCCGCCCCGCCGG + Intergenic
1070660701 10:78303394-78303416 CCCGCCCCGCGCCCCCGCGCTGG - Intergenic
1072638907 10:97196305-97196327 GCAGAGCCGCGCCTCCGCGCCGG - Intronic
1072699910 10:97633241-97633263 GTGGAGCCGCGCCCCCGAGCCGG + Intronic
1074121640 10:110497961-110497983 GCGGAGTTGCGCCGCCGCTCGGG + Exonic
1077360987 11:2139980-2140002 CCGGTGCCGCGCCGGAGCCCCGG + Intronic
1078246051 11:9573958-9573980 CCGCCGCCACCCCGCCGCGCCGG + Exonic
1079297008 11:19242370-19242392 CCGAGGCAGCGCCGCCGCCCCGG - Intergenic
1080230919 11:30017096-30017118 CTGCACCCGCCCCGCCGCGCCGG - Intergenic
1082817000 11:57515536-57515558 CCTGAGCCGCGCCGGCGCTGGGG + Exonic
1083258119 11:61508891-61508913 CCGGAGCCGCGCCGGCCCCCGGG - Exonic
1083670939 11:64299673-64299695 CCGGGGCCGCGGGGCCGCACGGG - Exonic
1084112506 11:67023255-67023277 CCGGAGCTGCGCCGCAGTCCGGG - Intronic
1084888508 11:72225059-72225081 CCTGAGCCGGGCGGCCGCGGAGG + Exonic
1085266732 11:75241832-75241854 CCTGCGCTGCGCCGCCCCGCGGG + Exonic
1085640287 11:78188923-78188945 CCGGGGCCGCGCCGCAGAGTCGG + Exonic
1086464297 11:87037752-87037774 ACCCAGCCGCGCCGCCGCGCGGG + Intergenic
1089694909 11:120211040-120211062 CCGGGGCCGCGGAGCCGGGCCGG + Exonic
1091759430 12:3077326-3077348 CCCGGGCCGCCCCGCCCCGCAGG + Intergenic
1094041111 12:26122617-26122639 CCGCCGCCGCGCCGCCCCCCGGG + Exonic
1094375384 12:29783684-29783706 CCGCAGCCCCGCCGCCGGGAGGG + Exonic
1094843230 12:34350609-34350631 CCGGAGCCGCTGGGCCCCGCAGG - Intergenic
1095687294 12:45050706-45050728 CCGGAGCTGCGCGCCCGCGGTGG + Exonic
1095958384 12:47819348-47819370 CCGGAGCACCGCCCCCTCGCCGG + Intronic
1096466164 12:51848603-51848625 CCCGGCCCGCGCCGCCGCCCCGG - Intergenic
1096786047 12:54017962-54017984 CCAGGGCCGGGCCGCCGAGCAGG + Intronic
1101466923 12:104958361-104958383 GCGCAGCCGCGCCGCCGCCGGGG + Intronic
1101948231 12:109154558-109154580 ACGGAGCCCCGCCCCCGGGCCGG - Intronic
1102136921 12:110583112-110583134 CCGCAGTCGCGCCGCCGCTGGGG + Exonic
1102884076 12:116508535-116508557 CCAGAGCCGCGGCGGCGCGGCGG - Intergenic
1103364069 12:120369462-120369484 CCGCGGCCGGGCCCCCGCGCCGG - Intergenic
1103415963 12:120741606-120741628 CAGGAGCAGCGCTGCCTCGCCGG - Intergenic
1104989671 12:132618651-132618673 CCGGCCCCGCCCCGCCCCGCAGG - Intergenic
1105472188 13:20704074-20704096 GCGCAGCCCCGCGGCCGCGCGGG - Exonic
1110630046 13:77697666-77697688 CCGGAGCCGCCGCGACGCCCAGG + Intergenic
1113895154 13:113759410-113759432 CCCGTGCCGCGTCTCCGCGCAGG - Intronic
1115119881 14:29927202-29927224 CCGGCGCCTCCCCGCGGCGCAGG - Intronic
1115235701 14:31207316-31207338 CGGGATCCGCGCCCCCACGCAGG + Exonic
1116849410 14:49893300-49893322 CCGGAGCCGCGCTGCCTCTCGGG + Exonic
1117547826 14:56807993-56808015 CCGCAGCCCCGCAGCCCCGCAGG + Intronic
1117549094 14:56816753-56816775 CTCGAGCTGCGCCGCCCCGCTGG + Intergenic
1117722178 14:58638418-58638440 CCGCACCCCCGGCGCCGCGCAGG - Exonic
1117913022 14:60652451-60652473 CCCGAGCCGCGCTGCAGCGAGGG - Intronic
1118285260 14:64465373-64465395 CCGGAGGCGCGGGGCGGCGCGGG - Intronic
1119318435 14:73714442-73714464 CCCGAGCAGCTCCGCCGCGGGGG - Intergenic
1121074944 14:91060279-91060301 CCTCAGGCGCGCCCCCGCGCCGG + Intronic
1121368149 14:93333068-93333090 CCGGCTCCGCAGCGCCGCGCAGG - Intronic
1122418279 14:101560665-101560687 CAGGAACCGCGGCGCCCCGCTGG + Intergenic
1122719653 14:103715224-103715246 CGGGAGCCCCGCCGCAGCTCGGG - Intronic
1122961137 14:105094018-105094040 CCGGAGCCGCGAAGCCGCGATGG + Intergenic
1122975305 14:105168466-105168488 CCGGCTCCCAGCCGCCGCGCCGG + Exonic
1125594199 15:40873892-40873914 CCGCAGCCACGCGGCCGCACGGG + Intronic
1125684976 15:41558840-41558862 CCGGCGCCCCGCCGGCACGCCGG - Intronic
1126134628 15:45378405-45378427 CGGGAGCCGCGGCGCCGAGGCGG - Exonic
1130224159 15:82045252-82045274 CCGGAGCCGCGCCGCTGCCCTGG - Intronic
1130370824 15:83284385-83284407 TCGGGGCCGCGCTGCCGCGCAGG + Intronic
1132947213 16:2538204-2538226 CCCGGGCCGCCCCGCCTCGCCGG - Intronic
1133156721 16:3880942-3880964 CCGGAGCCCAGGCGCCCCGCAGG - Intergenic
1134509368 16:14834037-14834059 CCGGCGCCGAGTCGCCGGGCCGG + Intronic
1134697073 16:16232852-16232874 CCGGCGCCGAGTCGCCGGGCCGG + Intronic
1134974770 16:18561833-18561855 CCGGCGCCGAGTCGCCGGGCCGG - Intronic
1136141631 16:28292515-28292537 GCGGAGCCGCGATGCCGCGATGG + Exonic
1136385982 16:29926211-29926233 CCGGCGCCGGGCAGCTGCGCAGG + Exonic
1136399793 16:30011067-30011089 CCCGTCCCCCGCCGCCGCGCCGG - Exonic
1136455614 16:30378266-30378288 CCGTAGCCCCGCCCCGGCGCTGG - Exonic
1137300587 16:47144211-47144233 CCCGTGCCCAGCCGCCGCGCAGG + Intergenic
1139364826 16:66427039-66427061 CGGGAGCCGCGCCGCCGCCGAGG + Intergenic
1139631894 16:68236212-68236234 CGGTAGCCGCCCCGCCCCGCGGG - Exonic
1140529041 16:75648255-75648277 CCGGAGCCGCAGCGGCACGCCGG + Exonic
1141620848 16:85235879-85235901 CCCGCGCCCCGCCCCCGCGCTGG + Intergenic
1141727559 16:85799769-85799791 CCGGTGCGGCGCCGCCAGGCCGG + Exonic
1142271791 16:89093787-89093809 CCGCCGCCACGGCGCCGCGCCGG + Exonic
1142610830 17:1108643-1108665 CCCGAGCCTCGCCGCCTCCCTGG - Intronic
1142683376 17:1562773-1562795 CCGGTTCCGCAGCGCCGCGCGGG + Exonic
1146058719 17:29593584-29593606 CCGGGGCCGCGGCGCCCGGCCGG - Exonic
1146208023 17:30921828-30921850 CCCGAGCTCCGCCGACGCGCGGG - Exonic
1146214940 17:30971402-30971424 CCGGGGCCTCGCGGCCGCGCTGG - Exonic
1147312937 17:39605810-39605832 CGTGCGCCGCGCCGCCGCCCAGG + Exonic
1148048717 17:44759082-44759104 CCGGCCCCGCGCCCCCGCCCCGG + Exonic
1148081059 17:44967921-44967943 CCGGCGCCGGGGCCCCGCGCGGG + Exonic
1148323683 17:46771640-46771662 CCGGGCCCGGGCCGCCGGGCCGG + Intronic
1149431334 17:56596954-56596976 CCGGAGCCGAGCCCCCTCCCCGG + Intergenic
1150236997 17:63601200-63601222 CCGGAGCGGCACCGCAGCCCCGG - Exonic
1150311057 17:64129899-64129921 CCGGCGCCGCGACGCTGCCCCGG + Intronic
1150311056 17:64129899-64129921 CCGGGGCAGCGTCGCGGCGCCGG - Intronic
1150373669 17:64662381-64662403 CCGGCCCCGCCCCGCCCCGCCGG - Intergenic
1150389353 17:64781507-64781529 CCGGAGCCGCGCGGTCGAGGAGG - Intergenic
1150624895 17:66835321-66835343 CCGGTGCTGGGCCGCGGCGCCGG + Intronic
1150764635 17:67993577-67993599 CCGGCCGCGCGCCGCCGCGCTGG - Intronic
1152463816 17:80454878-80454900 GCACAGGCGCGCCGCCGCGCTGG - Intergenic
1152544114 17:80992177-80992199 CGGCAGCCACGGCGCCGCGCAGG - Intronic
1152663163 17:81552304-81552326 GCGGACCCGCGGCGCGGCGCCGG + Exonic
1156171748 18:34494000-34494022 CCGGGGGCGCGGGGCCGCGCAGG + Intronic
1157753012 18:50194986-50195008 CCGTAGCTGCGCCGCCGCGGCGG - Exonic
1160453599 18:78980679-78980701 CCGCCGCCGCGCCGCCCCCCAGG + Intronic
1160930324 19:1567176-1567198 GGGGAGCCGCGCCGCAGCCCAGG - Intronic
1161005995 19:1937146-1937168 CCGGAGCCGCTACGCCAGGCGGG - Intergenic
1161960930 19:7522760-7522782 CCTGAGCCGCGCGGACCCGCCGG - Exonic
1162953535 19:14085743-14085765 CCGGAGCCGCGCCGCCGCGCCGG + Exonic
1164958236 19:32405378-32405400 CCGGAGCAGCGGCTCCGCGGTGG - Intergenic
926268164 2:11344618-11344640 CCGGAGACGGGCGGCCGCGCGGG - Intronic
927606576 2:24491529-24491551 CCGGGGCGGCGCCGCCGCCACGG + Intergenic
927606608 2:24491650-24491672 CACGAGCCGCGCGGCCGCGGAGG + Intergenic
929188694 2:39120705-39120727 CCGGGGCGGCGCCGGCGGGCCGG - Intronic
929452819 2:42048151-42048173 CCGGGGCCGGGGAGCCGCGCGGG + Exonic
930700611 2:54456046-54456068 CCGGAGCCCCGCAGCCGCCCAGG - Intergenic
931348867 2:61470922-61470944 CCGGAGGGGCGCCGAGGCGCCGG + Intergenic
932288135 2:70553828-70553850 GCGGAGCGGCGCCGCGGTGCGGG + Exonic
932566829 2:72916102-72916124 CCGGAACGGCGTCGGCGCGCGGG + Intergenic
933655201 2:84881115-84881137 CCGGAGGCGCCCCGCGGCCCCGG - Exonic
933858582 2:86441904-86441926 CCGGGGCCGCGTCCTCGCGCGGG + Intronic
934296834 2:91749089-91749111 CCGGGGCGCCGCCGCGGCGCTGG - Intergenic
935196639 2:100820231-100820253 CCGGAGACCCGCAGCCGCGGCGG + Exonic
935196682 2:100820381-100820403 CCGGAGCGGCCCCGCGGGGCCGG - Exonic
935692628 2:105744915-105744937 CCGGAGCCGCGCGGCCGAGCGGG + Exonic
937221308 2:120344568-120344590 CCGCCTCCCCGCCGCCGCGCAGG - Intergenic
937933006 2:127220060-127220082 CCGGAGCCTCGCCGCCATGCCGG - Intronic
938035097 2:128028415-128028437 CCCGCGCCGCGCCTCCCCGCGGG - Intergenic
938073175 2:128318876-128318898 GCGGAGACGCGGCGGCGCGCGGG - Intergenic
938381054 2:130836894-130836916 TACGAGCCGCGCCGCCGAGCCGG - Intronic
938406328 2:131035112-131035134 CGGGCGCCGCGGGGCCGCGCCGG - Intronic
940293468 2:152099121-152099143 CAGGACCCGCGCCGGCGCCCAGG + Intergenic
945245256 2:207711710-207711732 CCGGGGCCGGGCCGCGGGGCGGG + Intronic
946327673 2:218993155-218993177 CATGAGCAGCGCCCCCGCGCCGG - Exonic
948046831 2:234951874-234951896 CCGAAGCCCCGCCCCGGCGCGGG + Intergenic
1169213026 20:3778151-3778173 CCAGAGCCCCGACGCCGCGCCGG - Exonic
1170204691 20:13785296-13785318 CCGCCGCCCCGCCGCCCCGCGGG - Intronic
1170630022 20:18057767-18057789 CCTGGGCCGCGCCGCGGCGGGGG - Exonic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1172474484 20:35226750-35226772 CCGGGGCGGCCGCGCCGCGCCGG + Exonic
1172474483 20:35226750-35226772 CCGGCGCGGCGCGGCCGCCCCGG - Exonic
1173322257 20:41998695-41998717 CCAGGGCTGCGGCGCCGCGCAGG - Intergenic
1173821146 20:46021627-46021649 CGCGAGACGCGGCGCCGCGCAGG - Intergenic
1174386574 20:50191193-50191215 CCCGGGCCGCGCCCCCCCGCCGG + Exonic
1174607035 20:51768453-51768475 CCGGCGCCGCGCCGCCCCGGGGG + Exonic
1175267415 20:57710708-57710730 CCGCAGCCGCGCCCCCCAGCCGG - Intronic
1176198020 20:63846530-63846552 CTGGAGCCGGGCCGGCGGGCCGG + Intergenic
1178561541 21:33643015-33643037 CCGCGGCCCCGCCGCCGAGCGGG + Intronic
1179495130 21:41766704-41766726 TCGGAGCCCCGCGGCCTCGCCGG + Intronic
1181085488 22:20437702-20437724 CCGGCTCCCCGGCGCCGCGCCGG + Exonic
1181510778 22:23387912-23387934 CTGGAGCCGGGCTGCAGCGCAGG - Intergenic
1181956359 22:26590135-26590157 CCGCGGCCCCGCCCCCGCGCGGG - Exonic
1182547551 22:31084871-31084893 CGGGGGCCGGGCCGGCGCGCGGG - Intronic
1183683769 22:39350209-39350231 CCGCCGCCGCGCCGCCGCCGGGG - Intronic
1183702235 22:39457288-39457310 CCGGGCCCCCGCCGCCGCCCCGG + Intergenic
1184037635 22:41926246-41926268 CAGGGGCAGCGCCGCCTCGCCGG + Exonic
1184698258 22:46151271-46151293 CCGGGGTCGCCCCGCCGCGTTGG - Intronic
1185055156 22:48575530-48575552 CCGGAGCAGCGGCGTCCCGCGGG + Intronic
1185395218 22:50583192-50583214 CCGCCGCCCCGCCGCCCCGCCGG - Intronic
950036605 3:9890616-9890638 ACGGAGCCGCGCGGCTGCGGGGG + Exonic
950119845 3:10474531-10474553 CCGGAGCCACGCAGCCACCCTGG + Intronic
950168028 3:10816215-10816237 CCGGCTCTGCGCCGCCGCCCCGG - Exonic
950710582 3:14810644-14810666 CCGGGGCGGGGCCGCCGGGCGGG - Intergenic
954110339 3:48429724-48429746 CCAGAGCCGCCCCGCCCCGTCGG + Intronic
954367704 3:50155172-50155194 CCCGGGCCGGGCGGCCGCGCTGG - Exonic
955769303 3:62372802-62372824 CCGGCGACGCTCCGGCGCGCGGG + Exonic
955769595 3:62374073-62374095 CGGGGGCCTCGGCGCCGCGCAGG + Intronic
961213310 3:125141836-125141858 CCGGAGCCCTTCCTCCGCGCTGG - Intronic
961359427 3:126357568-126357590 CGGGAGCCGCGCGGGCGGGCCGG - Intergenic
962277487 3:134027287-134027309 CCGGAGCCGCACCCTAGCGCTGG + Intronic
964786151 3:160399007-160399029 CCGGAGCCCCGCTGCCGCCAGGG + Intronic
968372809 4:11224-11246 CCTGCGCCGCGCCCCCGCCCCGG - Intergenic
968372880 4:11611-11633 CCTGCGCCTCGCCCCCGCGCTGG - Intergenic
968434129 4:576254-576276 CCGCCGCCGCGACCCCGCGCCGG + Intergenic
968478747 4:824949-824971 CTGGAGCGGCGCCTCCGCGGTGG + Intronic
968506426 4:973305-973327 CCCGGGCCCCGCTGCCGCGCCGG - Exonic
968549368 4:1214368-1214390 CCGGATCCGCGGCGCGGCCCTGG - Exonic
968701333 4:2059485-2059507 CCGCTGCCGCGCCGCCCGGCCGG + Intergenic
968965230 4:3766192-3766214 CCGGAGCCCAGCCGGGGCGCAGG - Intergenic
969362688 4:6674574-6674596 CCAGACCCGCGCGGCCTCGCCGG - Intergenic
973552617 4:52051284-52051306 ACTGAGACGCGCAGCCGCGCGGG - Intergenic
973758959 4:54100143-54100165 CCCGAGCCGGGGCGCCGGGCGGG + Exonic
976053092 4:81031253-81031275 CGGGAGCCGACGCGCCGCGCGGG + Exonic
976445683 4:85127968-85127990 CCGGAGCTGCGCCACCAAGCAGG - Intergenic
977616119 4:99088889-99088911 CCGGCGCCGTGCAGCCTCGCCGG - Intergenic
978189659 4:105896438-105896460 CCGGAGCGGCCCCGGAGCGCGGG - Intronic
978385703 4:108173350-108173372 CAAAGGCCGCGCCGCCGCGCGGG - Intergenic
980930011 4:139176525-139176547 CCGGAGCCGGACCCCCGCCCTGG + Intronic
981331347 4:143513774-143513796 CCTGCGCCGCGCCTCCGCGACGG - Exonic
982745595 4:159102630-159102652 CTGGCGCCACGCCGCCGCCCAGG - Intergenic
984167520 4:176320274-176320296 CCGAAGCCGGGCCGCCGCGCCGG + Intronic
985462516 4:190120956-190120978 CCTGCGCCTCGCCCCCGCGCTGG + Intergenic
985462577 4:190121306-190121328 CCTGCGCCGCGCCCCCGCCCCGG + Intergenic
985462587 4:190121343-190121365 CCTGCGCCGCGCCCCCGCCCCGG + Intergenic
985462598 4:190121380-190121402 CCGGAGCGGGGGCGCGGCGCAGG - Intergenic
985462599 4:190121380-190121402 CCTGCGCCGCGCCCCCGCTCCGG + Intergenic
985769389 5:1799503-1799525 CCGGAGCCGGCCCTGCGCGCGGG + Intronic
992104202 5:73436807-73436829 CCGGAGCCTCTCCGCCCCGCCGG + Intergenic
992866279 5:80960389-80960411 CGGGAGCCGAGCCCCCGCGGCGG - Intergenic
993898771 5:93570755-93570777 CCCGGGCCCCTCCGCCGCGCGGG + Intergenic
994175123 5:96702728-96702750 CCGGGGCGGGGCCGCCGGGCAGG + Intronic
994366966 5:98928303-98928325 CCGGGGCAGGGCCGCCGGGCCGG + Intronic
996091447 5:119355840-119355862 CCGGAGCCGCGCGCTCGGGCCGG - Intronic
996404879 5:123095051-123095073 CAGGAGCTGGGCCGCCCCGCAGG + Intronic
997583981 5:135034037-135034059 CCGGGGCTGCGGCGCCGGGCGGG + Exonic
1001529998 5:172454702-172454724 CCGGTGCTGAGCCGCCGCGCCGG + Intergenic
1002526145 5:179817080-179817102 CCGGAGCCGCGCCGGGGGCCGGG + Intronic
1003624301 6:7727853-7727875 CCGGAGCCCCGCGGCCCGGCCGG - Intronic
1004140531 6:13013747-13013769 CCCGACCCGCCCCGCCGCGGCGG + Intronic
1005928908 6:30466345-30466367 CCGGAGGAGCGCCGCGGAGCAGG - Intergenic
1007371243 6:41428085-41428107 CCCGAGCCGCCCTGGCGCGCTGG - Intergenic
1011128729 6:84033683-84033705 CCGGAGCAGGGCTGCAGCGCGGG - Intergenic
1012916880 6:105179997-105180019 CCGGAGCGGCGCGGCGGCGCGGG + Intergenic
1013619307 6:111872967-111872989 CCGGAGCCTCAGCGCCGCGCAGG - Exonic
1015328459 6:131950922-131950944 CCGGCGCCGCGCTGCCCGGCGGG - Exonic
1016010660 6:139135164-139135186 CCCGAGGCTCGCAGCCGCGCGGG - Exonic
1016714116 6:147204139-147204161 TCTGCGCCGCGCCGCCGCCCCGG - Intergenic
1017738230 6:157381966-157381988 CAGGAGCCCCCCGGCCGCGCGGG - Exonic
1017793637 6:157823069-157823091 CCGGGGCGGCGGCGCGGCGCGGG + Intronic
1017793636 6:157823069-157823091 CCCGCGCCGCGCCGCCGCCCCGG - Intronic
1018330975 6:162727485-162727507 CCGGACCCGCGTCGCTGAGCTGG + Intronic
1019381651 7:727278-727300 CTGCAGCTGCGCCGCCGCCCTGG + Exonic
1022363357 7:29685001-29685023 CCGCCGCGGCGCCGCCGGGCTGG + Intergenic
1026665289 7:72336269-72336291 TCGGAGCCGCACCGCAGCCCAGG - Intronic
1027774089 7:82443592-82443614 CCCGAGGCGCGGAGCCGCGCGGG + Exonic
1029640581 7:101816871-101816893 CCCGGGCCGCGCCGCCGCTCCGG + Intronic
1029640580 7:101816871-101816893 CCGGAGCGGCGGCGCGGCCCGGG - Intronic
1030138855 7:106285051-106285073 CGGGAGCCGTGACGCGGCGCGGG + Exonic
1033300125 7:140177521-140177543 CCGGAGCTGCGGCCCCGCACCGG + Intergenic
1034979528 7:155467223-155467245 CCGGCGCCGGGCCTCCGGGCGGG + Intergenic
1034997490 7:155587293-155587315 CCGCAGCCGCGTCGCCCTGCGGG + Intergenic
1036195275 8:6708505-6708527 CATGGGCCGCGCCGCCGCCCGGG - Exonic
1037450800 8:19014009-19014031 CCGCAGCCGCGCGCCCGCCCTGG + Intronic
1038612834 8:29070646-29070668 CCTGTGCTGCGCCGCCGCACAGG + Exonic
1039476561 8:37841947-37841969 CCCCCGCCGCGCCCCCGCGCAGG - Exonic
1039949007 8:42153262-42153284 CCGCAGCCGCGGCGCCGGGAAGG - Intronic
1043873825 8:85463784-85463806 CCGGAGCCCCGGAGCCCCGCCGG + Intergenic
1045111861 8:98944367-98944389 CGGGCGTCCCGCCGCCGCGCGGG - Intergenic
1045443616 8:102239003-102239025 CCGGCCCCGCCCCGCCGCGCCGG + Exonic
1049237257 8:141518556-141518578 CCTGAGCTGCGCCCGCGCGCGGG + Exonic
1049649928 8:143761155-143761177 CCGGAGCCGCGCGCCCGAGAAGG + Intergenic
1049784608 8:144444442-144444464 GCGGGGCCGCGGCGCAGCGCGGG - Exonic
1050151582 9:2622864-2622886 CCGGAGAGGCGGCCCCGCGCCGG - Intronic
1051774498 9:20620509-20620531 CCGGGTGCGCGGCGCCGCGCGGG - Intronic
1055574451 9:77647813-77647835 CCGGGGCCGCGTCGCCCCGTCGG - Exonic
1056532493 9:87498845-87498867 CCGGAGCTGCCCCTCCTCGCGGG - Intronic
1057708059 9:97412105-97412127 CCGGAGCCGCCCCGCGGCTTGGG - Exonic
1057786071 9:98088046-98088068 CCGGGGGCGGGGCGCCGCGCTGG - Intronic
1057869809 9:98709036-98709058 CCGGTGCGGGGCGGCCGCGCTGG - Exonic
1057921968 9:99105095-99105117 CCGGAGCGAGGCCGCCGCGGCGG + Exonic
1060770111 9:126326615-126326637 CCGAGCCCGCGCCGCCGCCCCGG - Intergenic
1060842607 9:126805385-126805407 GCGGAGCTCCGCCGCCGCGAGGG - Intronic
1061089957 9:128420888-128420910 CTGGAGCAGCGGCGCGGCGCGGG - Exonic
1187226133 X:17376401-17376423 CCGGAGCGGCGCCGCGGGGCTGG - Intronic
1190285301 X:48957467-48957489 CCGGCGCCGCGGCGCGGCGGAGG - Exonic
1190285302 X:48957467-48957489 CCTCCGCCGCGCCGCGGCGCCGG + Exonic
1199772561 X:150983926-150983948 CCGGCGCCGCGCGGGCCCGCAGG + Intronic