ID: 1162954188

View in Genome Browser
Species Human (GRCh38)
Location 19:14089485-14089507
Sequence TTACGCATTCACTCCGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 147}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162954184_1162954188 12 Left 1162954184 19:14089450-14089472 CCGATTCCACCTTTAAGAACAAT 0: 1
1: 0
2: 1
3: 23
4: 239
Right 1162954188 19:14089485-14089507 TTACGCATTCACTCCGTGCCAGG 0: 1
1: 0
2: 0
3: 11
4: 147
1162954186_1162954188 6 Left 1162954186 19:14089456-14089478 CCACCTTTAAGAACAATACGGAC 0: 1
1: 0
2: 0
3: 0
4: 53
Right 1162954188 19:14089485-14089507 TTACGCATTCACTCCGTGCCAGG 0: 1
1: 0
2: 0
3: 11
4: 147
1162954187_1162954188 3 Left 1162954187 19:14089459-14089481 CCTTTAAGAACAATACGGACTAA 0: 1
1: 0
2: 0
3: 3
4: 85
Right 1162954188 19:14089485-14089507 TTACGCATTCACTCCGTGCCAGG 0: 1
1: 0
2: 0
3: 11
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162954188 Original CRISPR TTACGCATTCACTCCGTGCC AGG Intronic
900761729 1:4477135-4477157 TTAGGCATGCACTCTGAGCCTGG + Intergenic
902703853 1:18191149-18191171 TTAAGCACCCACTCAGTGCCAGG + Intronic
903366654 1:22809517-22809539 TTTAGCATTCACTGTGTGCCAGG + Intronic
905012360 1:34755984-34756006 TGAAGCATTCATGCCGTGCCAGG - Intronic
905505839 1:38478387-38478409 TTATGCATCTACTCTGTGCCAGG + Intergenic
906509240 1:46401420-46401442 TTACACATTCATTCTGTGTCCGG - Intronic
907395402 1:54186151-54186173 TTAAACATTTACTCTGTGCCAGG - Intronic
907990013 1:59571333-59571355 TAGAGCATTCACTCTGTGCCAGG + Intronic
910235085 1:85027107-85027129 TTATGCATTCACTATGTGTCAGG + Intronic
912162318 1:107000568-107000590 TTCCCCATTCACCCGGTGCCAGG - Intergenic
916656150 1:166876791-166876813 TTAAGCATCCACTATGTGCCAGG - Intergenic
917054411 1:170964069-170964091 TTAAGCATTGACTCCATGTCAGG + Intronic
919989652 1:202700364-202700386 CTAAGCATTCACTGTGTGCCCGG + Intronic
920432626 1:205928451-205928473 TGAAGCATCCACTCTGTGCCAGG - Intronic
920538758 1:206761185-206761207 TTAAGTATTTACTCTGTGCCGGG + Intergenic
924691296 1:246353810-246353832 TTAGGCATCCACTGTGTGCCAGG - Intronic
1063877382 10:10494111-10494133 TGAAGCATTCATTCCGTGCCAGG - Intergenic
1072430269 10:95365055-95365077 TCAGGCATTTACTACGTGCCAGG - Intronic
1074297270 10:112201909-112201931 TTGAGCATTTACTCTGTGCCAGG + Intronic
1076178249 10:128385342-128385364 TTACGTAGACACTCCGTGTCCGG - Intergenic
1076219832 10:128724142-128724164 TTAAGCATTTACCACGTGCCAGG - Intergenic
1078389667 11:10926071-10926093 TTGAGCATTCACTGTGTGCCAGG - Intergenic
1080196436 11:29615046-29615068 TTAAGCACTTACTCCTTGCCAGG - Intergenic
1085146753 11:74206896-74206918 TTAAACATTTACTCTGTGCCAGG + Intronic
1085156770 11:74302735-74302757 TTAAGCATCCACCCTGTGCCAGG - Intronic
1086433503 11:86758895-86758917 GGACACATTCACTCTGTGCCAGG - Intergenic
1089442663 11:118530249-118530271 TTAAGCATCCACTATGTGCCAGG - Intronic
1089991389 11:122864407-122864429 TTGGGCATTTACTCTGTGCCTGG - Intronic
1090160705 11:124491730-124491752 TTAAGCAGTCACTGTGTGCCAGG - Intergenic
1090599936 11:128359437-128359459 TTAGGCATTCAGTAGGTGCCTGG + Intergenic
1091353422 11:134915578-134915600 TTGAGCTTTCACTCTGTGCCAGG - Intergenic
1091887344 12:4026174-4026196 TAAAGCATTGACGCCGTGCCAGG - Intergenic
1093379897 12:18479565-18479587 TCAAGCATTTACTCTGTGCCAGG - Intronic
1097976918 12:65696443-65696465 TTAATCATTGACTCTGTGCCAGG + Intergenic
1098056928 12:66517025-66517047 TTAAGCATTTACTACGTGCTAGG - Intronic
1099301947 12:80907142-80907164 TTAAGCATTCACTGTGTGCCAGG - Intronic
1100490058 12:95070719-95070741 TTATGCATTCACAAGGTGCCTGG + Intronic
1102302039 12:111778100-111778122 TTGGGCATTCACTCCATGCTTGG + Intronic
1111106970 13:83658472-83658494 TTGAGCATTTACTCTGTGCCTGG - Intergenic
1112271120 13:97970937-97970959 TTAAGCATTTACTCTGTGCCCGG + Intronic
1113339497 13:109408386-109408408 TTAAGCATCTACTACGTGCCAGG + Intergenic
1117491131 14:56249217-56249239 TTGAGCATTTACTCTGTGCCAGG + Intronic
1117649763 14:57891270-57891292 TTAAGCATCTACTCGGTGCCTGG + Intronic
1118133880 14:62999960-62999982 TTACACATAGACTCAGTGCCTGG - Intronic
1119852834 14:77878400-77878422 TTGAGCATTCAGTCCGTGCAGGG + Intronic
1120192109 14:81448946-81448968 TTAAGCATTCCCTAAGTGCCAGG - Intergenic
1121465105 14:94110885-94110907 TTAAGCATCCACTCTCTGCCCGG + Intronic
1126104449 15:45138426-45138448 ATACGCATTCACACACTGCCCGG - Intronic
1129277112 15:74453243-74453265 CTAAGCATTTACTCCATGCCTGG + Intronic
1131295174 15:91141647-91141669 TTAAGCATTCACTGTGTGCCAGG - Intronic
1135586160 16:23672727-23672749 TTAAGCATTTACTATGTGCCAGG - Exonic
1137021410 16:35432023-35432045 TTCAGCATTCACTCTGTGCTAGG - Intergenic
1137329982 16:47483873-47483895 TTAAGCACTCACTATGTGCCAGG + Intronic
1137554169 16:49460235-49460257 TTAAGTCTTCACTCTGTGCCAGG + Intergenic
1137752829 16:50879554-50879576 TTAAGCACTCATTCTGTGCCAGG - Intergenic
1138946371 16:61855528-61855550 ATACACATTCACTGTGTGCCAGG - Intronic
1139319467 16:66101750-66101772 TTAAGCAATCACTCTGGGCCAGG - Intergenic
1140091904 16:71845933-71845955 TGACGCAATCTCTCCGCGCCGGG + Intergenic
1141139475 16:81487775-81487797 TTGAGCCTTTACTCCGTGCCAGG - Intronic
1141254083 16:82384787-82384809 TAACGCATTTACTACGTGACAGG + Intergenic
1144004866 17:11090724-11090746 CTGAGCATTCACTCCATGCCAGG + Intergenic
1146827404 17:36034911-36034933 TTAAGCATTTATTCTGTGCCAGG + Intergenic
1147526192 17:41226192-41226214 TGATGCATTGAATCCGTGCCCGG - Intronic
1150976137 17:70089199-70089221 TTACGTATCAACTCTGTGCCAGG + Intronic
1151317727 17:73334083-73334105 TATGGCATTCACTCTGTGCCAGG - Intergenic
1157896011 18:51468040-51468062 TTTAGCATTTACTCTGTGCCAGG + Intergenic
1160441056 18:78892859-78892881 TTCCTCCTTCACTCCCTGCCCGG - Intergenic
1161872196 19:6878749-6878771 TTAAGCATTTAATCTGTGCCAGG + Intergenic
1162954188 19:14089485-14089507 TTACGCATTCACTCCGTGCCAGG + Intronic
1165721655 19:38083165-38083187 TCATTCATTCACTCTGTGCCAGG + Intronic
1165769115 19:38368127-38368149 CTACGCACTCACTCGATGCCTGG - Exonic
1165805220 19:38576493-38576515 TTGAGTATTCACTCTGTGCCAGG - Intronic
926015071 2:9444109-9444131 TTAAGCATTTACTATGTGCCAGG - Intronic
928247117 2:29640194-29640216 TTAAGCATTTACTATGTGCCGGG + Intronic
928258688 2:29747608-29747630 TTGAGCATTCACTCTGTGCTAGG - Intronic
929915071 2:46128365-46128387 TTAAGCACCCACTCTGTGCCAGG + Intronic
937163357 2:119787593-119787615 TTAAGCATCCACTCTGTTCCAGG - Intronic
938767556 2:134470407-134470429 TATAGCATTCACTCTGTGCCGGG - Intronic
939511574 2:143112607-143112629 TTAGGCATTTACTACATGCCAGG + Intronic
943065035 2:183076831-183076853 TTAAGCATTCACTGCATGCTAGG - Intergenic
1171956449 20:31467545-31467567 TTGAGCATTTACTACGTGCCAGG - Intronic
1173298065 20:41776930-41776952 TTGGGCATTTACTCTGTGCCAGG + Intergenic
1179606208 21:42517139-42517161 TTGCGCATTTACTACGTACCAGG + Intronic
1179611217 21:42552534-42552556 TTAAGCATCAACTCTGTGCCTGG - Intronic
1182584610 22:31337189-31337211 TTAAGCATTCATTGTGTGCCAGG + Intronic
1183518486 22:38282242-38282264 TTAAGCATTCATTACGTGGCAGG + Intergenic
1184283205 22:43450610-43450632 TTATGCATTTACCCCATGCCAGG - Intronic
1184292638 22:43506258-43506280 CTAGGCATTCACTCGGAGCCTGG + Exonic
1184726949 22:46352698-46352720 TTAATCATTCACACCATGCCGGG - Intronic
949590705 3:5491365-5491387 TTAGGCATTTACTATGTGCCCGG - Intergenic
950838939 3:15948184-15948206 TTAAGTATTCACAGCGTGCCAGG - Intergenic
951607614 3:24453213-24453235 TAAAGCATTCACTATGTGCCAGG + Intronic
951743266 3:25947770-25947792 TTCCACATTCAATCAGTGCCTGG + Intergenic
952167531 3:30767018-30767040 TCAAGCATTTACTCTGTGCCAGG + Intronic
953236918 3:41115010-41115032 TTAAGCAGTTACTACGTGCCAGG + Intergenic
954149864 3:48651977-48651999 CTCCGCATTCACTCGGTGGCTGG + Exonic
960334325 3:116397605-116397627 TTGAGCATTCACTTCTTGCCTGG - Intronic
962839770 3:139222811-139222833 TTGAGCATTTTCTCCGTGCCAGG - Intronic
962906915 3:139812036-139812058 TTAAGCATTTACTCCATGCTGGG - Intergenic
963337371 3:143991312-143991334 TTAAGCATCAACTCTGTGCCAGG + Exonic
963736711 3:149025510-149025532 TTAAGCATTTACTATGTGCCAGG - Intronic
964679419 3:159320924-159320946 TTAAGTAGTCACTCCATGCCAGG - Intronic
970177954 4:13358125-13358147 TTATGCATTCACTTCATGCCAGG + Intergenic
970427860 4:15962539-15962561 TTCCTCATTCCCTCCGGGCCTGG + Exonic
972994167 4:44859423-44859445 TTAAGCACTCACTCTGTGACAGG - Intergenic
973111467 4:46403122-46403144 TTGGCCCTTCACTCCGTGCCTGG + Intronic
975963870 4:79945442-79945464 TTATGCATTTACTCTATGCCAGG + Intronic
980494758 4:133576131-133576153 TTAAGCATTTGCTCCATGCCAGG - Intergenic
984675349 4:182540971-182540993 CTGAGCATTCACTCTGTGCCTGG + Intronic
985383197 4:189417263-189417285 TTATGCATTAACTCTGTGCCAGG - Intergenic
989204987 5:38801326-38801348 TTAGGCCTTCACTATGTGCCAGG + Intergenic
990774623 5:59291862-59291884 TTTAGCATTCACTGCATGCCTGG - Intronic
992654573 5:78895827-78895849 TTAAGCAATCACTCAGAGCCAGG + Intronic
996419441 5:123245969-123245991 CTAGGCCTTCACTCTGTGCCAGG + Intergenic
997349303 5:133218940-133218962 TTAAGCACTGACTCTGTGCCAGG - Intronic
998984621 5:147742443-147742465 TTAAGCATTTACTATGTGCCAGG + Intronic
999247555 5:150163300-150163322 TTAAGCATTTACTAAGTGCCAGG - Intergenic
1000100730 5:158013837-158013859 TTGAGCATTCACTATGTGCCAGG - Intergenic
1003914116 6:10769629-10769651 TTAAGCTTTCACCCTGTGCCAGG + Intronic
1004241863 6:13930739-13930761 TTAAGCATTTACTTGGTGCCAGG + Intronic
1005649458 6:27873378-27873400 TAACGCCTCCACGCCGTGCCAGG + Exonic
1006749968 6:36371005-36371027 TTGAGCATTCACTATGTGCCAGG - Intronic
1007222612 6:40291033-40291055 TTGAGCATTCACCACGTGCCAGG + Intergenic
1009389309 6:63126560-63126582 TTAGGCACTCACTTCATGCCAGG - Intergenic
1013651405 6:112198823-112198845 TTGAGCATTTACTCAGTGCCAGG + Intronic
1013658211 6:112267380-112267402 TTAAGCATTCTCTATGTGCCAGG - Intergenic
1013705153 6:112824471-112824493 TTATGCATTCACTCTGTACCAGG - Intergenic
1023673793 7:42608159-42608181 TTCCCCTTTCACTCAGTGCCAGG - Intergenic
1023775662 7:43604096-43604118 TTAAGCATTCACTATGTGCCAGG + Intronic
1024633541 7:51268508-51268530 CTAAGCATTCACTCTGTGCAAGG + Intronic
1028835194 7:95366864-95366886 TTAAGCATTGACTATGTGCCAGG - Intronic
1028879923 7:95868580-95868602 AGACGCATGCACTCCATGCCTGG + Intronic
1029587434 7:101484177-101484199 CTAAGCATTCACACTGTGCCTGG + Intronic
1030831103 7:114222516-114222538 TTGGGCATTTACTACGTGCCTGG + Intronic
1031532946 7:122898753-122898775 TTAAGAATTCACTCTGAGCCAGG + Intergenic
1037926191 8:22845876-22845898 TCGCGCATTCATTCTGTGCCGGG - Intronic
1042617087 8:70661451-70661473 TTGAGCATTTACTCTGTGCCAGG - Exonic
1044917763 8:97134199-97134221 TTAAGCATCCACTAAGTGCCAGG + Intronic
1045408043 8:101887142-101887164 GTATGCAGTCACTCAGTGCCTGG + Intronic
1045749803 8:105469903-105469925 TTGAGCATTTACTCTGTGCCAGG - Intronic
1047435968 8:124835617-124835639 TTGAGCACTCACTCTGTGCCAGG - Intergenic
1047783964 8:128135649-128135671 TTACCCACTCACTCTTTGCCAGG + Intergenic
1048628769 8:136217233-136217255 TTACACATTAATTCCTTGCCTGG - Intergenic
1059335129 9:113564365-113564387 TTGAGCATGAACTCCGTGCCAGG - Intronic
1059640824 9:116214971-116214993 TTAGGCATTCACTATATGCCAGG + Intronic
1187397817 X:18933436-18933458 TTGAGCAGCCACTCCGTGCCAGG - Intronic
1189146841 X:38664268-38664290 GTAAGCATTTACTCTGTGCCTGG + Intronic
1189493198 X:41485836-41485858 TTACACATTGACTACCTGCCTGG - Intergenic
1189514136 X:41694174-41694196 TTAAGCAGTCACTATGTGCCAGG + Intronic
1190626930 X:52345661-52345683 TTAAACATTCACTCCTGGCCAGG + Intergenic
1191978635 X:66901547-66901569 TTAGGCATTAACTCAGTGCCTGG - Intergenic
1192249641 X:69401108-69401130 TTAAGCACTGACTCTGTGCCAGG - Intergenic
1192542792 X:71989402-71989424 TTAAGCATTTACTATGTGCCAGG + Intergenic
1193810702 X:86047583-86047605 TTAGGCATTCCCTCCGTGGAAGG + Intergenic
1197718367 X:129726867-129726889 TTACGCATTTGCTGTGTGCCAGG + Intergenic
1197917436 X:131551623-131551645 TTATGCATGCACTCTGTGCCAGG - Intergenic
1198952866 X:142092637-142092659 TTACGCAGTCACTCTCTGCTGGG + Intergenic
1199484716 X:148335038-148335060 TTGAGCATTCACTATGTGCCAGG - Intergenic
1199780136 X:151050997-151051019 TTAGGTATTCACTCTGTGCCAGG - Intergenic