ID: 1162954360

View in Genome Browser
Species Human (GRCh38)
Location 19:14090209-14090231
Sequence GCGCGCGTGCGCTCCGGCTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 117}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162954355_1162954360 18 Left 1162954355 19:14090168-14090190 CCCGGAGCACGGCGCGCTGCTGG 0: 1
1: 0
2: 0
3: 25
4: 201
Right 1162954360 19:14090209-14090231 GCGCGCGTGCGCTCCGGCTCCGG 0: 1
1: 0
2: 2
3: 10
4: 117
1162954357_1162954360 17 Left 1162954357 19:14090169-14090191 CCGGAGCACGGCGCGCTGCTGGA 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1162954360 19:14090209-14090231 GCGCGCGTGCGCTCCGGCTCCGG 0: 1
1: 0
2: 2
3: 10
4: 117
1162954353_1162954360 30 Left 1162954353 19:14090156-14090178 CCTTGTAGCTGACCCGGAGCACG 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1162954360 19:14090209-14090231 GCGCGCGTGCGCTCCGGCTCCGG 0: 1
1: 0
2: 2
3: 10
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162954360 Original CRISPR GCGCGCGTGCGCTCCGGCTC CGG Exonic
900100839 1:961294-961316 GGCCGCGTGCGCTCTGCCTCGGG - Exonic
902079905 1:13813782-13813804 GCGCGCCTCCTCCCCGGCTCAGG - Intronic
904252716 1:29236538-29236560 GCGCCGCTCCGCTCCGGCTCGGG + Exonic
904794773 1:33051091-33051113 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
906436877 1:45803817-45803839 GCGCGGCTGCGCTGCGGCCCGGG + Exonic
906486604 1:46240252-46240274 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
908501233 1:64745270-64745292 GCCCTCGTGCGCTTCGGCTGAGG - Exonic
908703855 1:66930135-66930157 CCGCGCGCGCGCCCCTGCTCCGG + Intronic
910183171 1:84506728-84506750 CCGCGCCTGCTCTCCGCCTCGGG - Intergenic
915517514 1:156421768-156421790 GCCCCGGCGCGCTCCGGCTCCGG + Intronic
1066022876 10:31319942-31319964 GCGCGCGTGTGCGCGGGCGCCGG + Intronic
1067769868 10:49115431-49115453 GCTGGCGCGGGCTCCGGCTCCGG - Exonic
1069651685 10:70053659-70053681 GCGGGCGTGCGCCCCGGGGCCGG + Intronic
1069662495 10:70132743-70132765 GCGCCCGCGCGCTCTCGCTCCGG + Exonic
1072950172 10:99840350-99840372 GCGCGGCTGCGCTGCGGCCCGGG - Intronic
1078318030 11:10307903-10307925 GCCCGCGGGCGCTCAGGCCCGGG - Intergenic
1080418484 11:32091026-32091048 GCGCCCCTCTGCTCCGGCTCGGG + Exonic
1087634406 11:100687046-100687068 CCGCGCTTGCGCTCCGGCCTTGG - Intergenic
1089713670 11:120336319-120336341 GCGCGCGCGGGTTCCGGTTCCGG - Intergenic
1095439296 12:42226950-42226972 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1101680009 12:106955784-106955806 GCGCGCGTGCGCGTCGGAACTGG + Exonic
1102453513 12:113057524-113057546 GCGCGCCTGGACTGCGGCTCCGG - Intronic
1104701744 12:130909950-130909972 GCGCCAGTGCACTCCGGCTTGGG - Intergenic
1104961570 12:132490588-132490610 GCGCGCGCGAGCGCCGGCTCGGG - Exonic
1122964070 14:105112920-105112942 GCGCGGCTGCGCTGCGGCCCGGG - Intergenic
1127813560 15:62585902-62585924 GCTCCCTTGCGCTCCAGCTCAGG - Intronic
1128280160 15:66387473-66387495 GCGCTCCTGCTCCCCGGCTCGGG - Intronic
1132552811 16:560357-560379 GCGCGCGTGCGCCTGGGCTCCGG - Intergenic
1133090498 16:3400719-3400741 GGGCGCCGGCGCTCAGGCTCGGG + Intronic
1134509276 16:14833706-14833728 GCGCGCGTGCGCGGCGGCTCTGG + Exonic
1134974861 16:18562164-18562186 GCGCGCGTGCGCGGCGGCTCTGG - Intronic
1136399821 16:30011141-30011163 GCTCGCGTGCGCTCCCGAGCGGG - Intronic
1138327941 16:56191244-56191266 GCGCGTGTGCGCGCCGCCGCCGG + Intergenic
1139448726 16:67014238-67014260 CCGCACGTCCGCCCCGGCTCTGG - Intergenic
1139451204 16:67029252-67029274 GCCCGCGTGGGCTCCCGTTCCGG - Exonic
1142154640 16:88527515-88527537 GCGCGTGAGCGGGCCGGCTCAGG + Intronic
1143016369 17:3893057-3893079 GCCCGCGGGCGCCGCGGCTCCGG + Intronic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1144764333 17:17724652-17724674 CCGCGCGTCCGATCCTGCTCCGG + Intronic
1145243522 17:21253049-21253071 GCGCGCCCGCGGCCCGGCTCCGG - Intronic
1146355203 17:32127632-32127654 GCTCACGTGGGCTCCGGCACGGG - Intergenic
1146403689 17:32519566-32519588 GTGCGCTGGCGCTCGGGCTCGGG - Intronic
1147168673 17:38605953-38605975 GCGCGCGCGCGGGCCGGCGCGGG + Intergenic
1147741036 17:42671073-42671095 GCGCGAATGCGTTGCGGCTCCGG + Exonic
1147963136 17:44179794-44179816 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
1149347295 17:55751340-55751362 GGGCGCGTCTTCTCCGGCTCAGG + Intronic
1152212485 17:79009773-79009795 GCGCGCGCTCGCCCCGCCTCTGG + Exonic
1160364310 18:78311516-78311538 GGAGGCGTGGGCTCCGGCTCTGG - Intergenic
1161006831 19:1941305-1941327 GCCCCCTCGCGCTCCGGCTCCGG - Exonic
1161264907 19:3359637-3359659 GAGCGCGCTCGCTCCGGCGCCGG + Intronic
1161925338 19:7294915-7294937 CCGCGAGTGCGCCCCGGCCCAGG + Intergenic
1162022456 19:7874074-7874096 CCGGGCGTGCGCTCCGGGTCTGG - Intronic
1162886642 19:13702551-13702573 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
1162954360 19:14090209-14090231 GCGCGCGTGCGCTCCGGCTCCGG + Exonic
1163012244 19:14433445-14433467 GCGCGCGTGCGCCCCGGGCGTGG - Intronic
1163631294 19:18419274-18419296 GCGCGTGCGCGCTCCGGCGGCGG + Intronic
1164191861 19:22925298-22925320 GCGCGGCTGCGCTGCGGCCCAGG + Intergenic
1164653388 19:29901926-29901948 GCGCGGCTGCGCTGCGGCCCGGG - Intergenic
1164835148 19:31350974-31350996 GCGCCCGGGCGCGCCGGCTGGGG + Intergenic
1166096719 19:40544183-40544205 GCGCCATTGCGCTCCGGCTTTGG - Intronic
1166139661 19:40799306-40799328 TCGCGCCGGCGCCCCGGCTCCGG - Intronic
1166261380 19:41643977-41643999 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1166893679 19:46009840-46009862 GCGCGCGTTTGCTCTGTCTCAGG + Intronic
1167000267 19:46741641-46741663 GAGCGCATGCTCTGCGGCTCTGG - Intronic
1168721037 19:58555162-58555184 GCGCGCGTGCGCCCGTGCCCCGG + Intergenic
924987692 2:287357-287379 GCGCGCGTGAGCTGCGGCGCGGG - Intronic
929190922 2:39138757-39138779 GCGCGAGTGCGCTCCAGCCTGGG - Intergenic
929313570 2:40452149-40452171 GCGCGCGCGCGCCCGGGCCCCGG - Intronic
933782249 2:85810893-85810915 GCGGGCCTGGGCTCCGTCTCTGG - Intergenic
933893309 2:86789953-86789975 TGGCTCCTGCGCTCCGGCTCTGG - Intronic
934534426 2:95121553-95121575 GCGCGCGTCCTCTCCCTCTCTGG - Intronic
934688105 2:96336066-96336088 GCCCGCGCGCTCTCCGACTCCGG - Intronic
947741714 2:232487775-232487797 GCTCGGCTGCGCTGCGGCTCAGG - Exonic
948467499 2:238159239-238159261 GCGCCCGCACGCCCCGGCTCGGG + Intronic
1171010706 20:21507940-21507962 GCGCGCGGGCGCTTCGGGGCCGG + Intergenic
1172489224 20:35321286-35321308 GCGCGCGCGCGCGCACGCTCAGG + Intronic
1180951705 22:19723421-19723443 GCGCGCGTCCGCGCGGCCTCTGG + Exonic
1182325208 22:29507402-29507424 ACGCTCCTGCGCTCCGGCTTGGG - Exonic
1183191071 22:36322399-36322421 GCGCGGCGGCGCCCCGGCTCTGG - Intronic
1185055281 22:48575910-48575932 GCCCGCGCTCGCTCCGGCCCGGG - Intronic
1203252528 22_KI270733v1_random:124856-124878 CCGCGCGTGCGTCCCGGCTGCGG + Intergenic
950168143 3:10816688-10816710 GTGCGCGTGCGCACTGGCACAGG - Intronic
956179087 3:66500933-66500955 GCGCGCGCGCGCGCAGCCTCGGG + Intronic
960628444 3:119703435-119703457 GCGCGGGTGCGCTCCGCTTCGGG + Intronic
960639144 3:119810206-119810228 GCGCGCGGGCGGGCCGGCGCCGG + Intronic
961666018 3:128493408-128493430 GCGCGTGTGCGCTCCGGAGAGGG - Intergenic
963335713 3:143971974-143971996 GTGCGCGTGCGCGCGGGCACGGG + Exonic
963799042 3:149658521-149658543 GCCCGGGTGCGCCCCGGCGCGGG + Intronic
966179191 3:177172216-177172238 GCGCCACTGCGCTCCAGCTCGGG + Intronic
968178193 3:196569054-196569076 GCGGGCGCGGGCTCGGGCTCTGG + Exonic
968820144 4:2843949-2843971 CCGCCCGTCGGCTCCGGCTCCGG - Exonic
977184353 4:93917808-93917830 GCGCGCGCGCGCTCTAGCTCTGG + Intergenic
977574090 4:98658739-98658761 GCGCGCGCGCGCACGGGGTCGGG + Intergenic
982616151 4:157637978-157638000 GCGCGGCTGCGCTGCGGCGCGGG - Intergenic
985264357 4:188144403-188144425 GCGCCCCTGCGCTCCAGCCCGGG - Intronic
985688396 5:1294134-1294156 ACGGGCGTCCGCTCCGGCTCAGG + Exonic
989230021 5:39074587-39074609 GCGGACGTGCCCTCCGGGTCCGG - Intergenic
992373664 5:76170851-76170873 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
993905604 5:93620655-93620677 CCGCGCGGGCGCTGCGGGTCCGG - Exonic
1000985194 5:167858621-167858643 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1002061975 5:176630485-176630507 GAGCTCGCGCGCTCCGGCTCCGG + Intronic
1002061976 5:176630491-176630513 GCGCGCTCCGGCTCCGGCTCCGG + Intronic
1002341468 5:178519027-178519049 GCGCGGCTGCGCTGCGGCCCGGG - Intronic
1002548167 5:179966419-179966441 GCGCTCGTGCTCTCCACCTCCGG - Intronic
1003645417 6:7910254-7910276 GGGCGCGGGCGCCGCGGCTCGGG - Intronic
1007674483 6:43581777-43581799 GCGCGGCTGCGCTGCGGCCCGGG - Intronic
1012452623 6:99369026-99369048 GCGCCACTGCGCTCCAGCTCGGG + Intergenic
1012986350 6:105880408-105880430 GGGCGCGTGTGCTCCGGCACAGG - Intergenic
1015476483 6:133664081-133664103 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
1016061076 6:139630747-139630769 GCGCCAGTGCACTCCAGCTCGGG + Intergenic
1016820658 6:148343116-148343138 GCGGGCTCGGGCTCCGGCTCGGG - Exonic
1018091132 6:160347908-160347930 GCGCGCGCGCGCCCCGGGTCCGG - Intergenic
1019571983 7:1717193-1717215 GCTCTCCTGAGCTCCGGCTCTGG - Intronic
1033927025 7:146474982-146475004 GCGCGTGCGCGCTCGTGCTCAGG - Intronic
1034513679 7:151556793-151556815 ACACGCGTGCGCCCCGGCTGCGG + Exonic
1035747551 8:1973489-1973511 CCGCGCGTGGGCGCGGGCTCGGG + Intergenic
1039936509 8:42051417-42051439 GCTCGCGGGCGCTCGGGTTCGGG - Intronic
1045277441 8:100721207-100721229 GCGCGGGTCCCCGCCGGCTCGGG + Intronic
1049574381 8:143383668-143383690 GGGGGCCTCCGCTCCGGCTCCGG - Exonic
1053457017 9:38241342-38241364 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
1059210809 9:112513502-112513524 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1060064729 9:120494855-120494877 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1060154879 9:121312668-121312690 GCGCCCCTGCACTCCAGCTCAGG - Intronic
1060643861 9:125261775-125261797 GCGCGCGTGCGCAGCGCCGCGGG - Intronic
1062160190 9:135075646-135075668 ACGCGGACGCGCTCCGGCTCTGG - Intronic
1062461902 9:136665793-136665815 GCGCGTGCGCGCCCCGGATCCGG + Intronic
1062659011 9:137618806-137618828 GCGGGCGCGCGTTCCGGTTCCGG + Exonic
1185505778 X:631415-631437 GCGCGCGTGGGCACCGACACGGG + Intronic
1186029984 X:5357368-5357390 GCGCCCCTGCGCTCCAGCCCGGG + Intergenic
1190285417 X:48957958-48957980 GCGCGCGTGCGCAGCGCCCCGGG - Intronic