ID: 1162954360

View in Genome Browser
Species Human (GRCh38)
Location 19:14090209-14090231
Sequence GCGCGCGTGCGCTCCGGCTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 117}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162954353_1162954360 30 Left 1162954353 19:14090156-14090178 CCTTGTAGCTGACCCGGAGCACG 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1162954360 19:14090209-14090231 GCGCGCGTGCGCTCCGGCTCCGG 0: 1
1: 0
2: 2
3: 10
4: 117
1162954357_1162954360 17 Left 1162954357 19:14090169-14090191 CCGGAGCACGGCGCGCTGCTGGA 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1162954360 19:14090209-14090231 GCGCGCGTGCGCTCCGGCTCCGG 0: 1
1: 0
2: 2
3: 10
4: 117
1162954355_1162954360 18 Left 1162954355 19:14090168-14090190 CCCGGAGCACGGCGCGCTGCTGG 0: 1
1: 0
2: 0
3: 25
4: 201
Right 1162954360 19:14090209-14090231 GCGCGCGTGCGCTCCGGCTCCGG 0: 1
1: 0
2: 2
3: 10
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162954360 Original CRISPR GCGCGCGTGCGCTCCGGCTC CGG Exonic