ID: 1162955716

View in Genome Browser
Species Human (GRCh38)
Location 19:14096885-14096907
Sequence CTGAGGGTTCAGATGAGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 296}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162955716_1162955729 14 Left 1162955716 19:14096885-14096907 CCACCCCTCATCTGAACCCTCAG 0: 1
1: 0
2: 0
3: 35
4: 296
Right 1162955729 19:14096922-14096944 GGGTTTGGGAGAGGAAGCATGGG 0: 1
1: 0
2: 1
3: 38
4: 427
1162955716_1162955725 -1 Left 1162955716 19:14096885-14096907 CCACCCCTCATCTGAACCCTCAG 0: 1
1: 0
2: 0
3: 35
4: 296
Right 1162955725 19:14096907-14096929 GAGTTAGGCAAGTCTGGGTTTGG 0: 1
1: 0
2: 0
3: 15
4: 174
1162955716_1162955722 -7 Left 1162955716 19:14096885-14096907 CCACCCCTCATCTGAACCCTCAG 0: 1
1: 0
2: 0
3: 35
4: 296
Right 1162955722 19:14096901-14096923 CCCTCAGAGTTAGGCAAGTCTGG 0: 1
1: 0
2: 1
3: 11
4: 142
1162955716_1162955728 13 Left 1162955716 19:14096885-14096907 CCACCCCTCATCTGAACCCTCAG 0: 1
1: 0
2: 0
3: 35
4: 296
Right 1162955728 19:14096921-14096943 TGGGTTTGGGAGAGGAAGCATGG 0: 1
1: 0
2: 4
3: 61
4: 690
1162955716_1162955724 -6 Left 1162955716 19:14096885-14096907 CCACCCCTCATCTGAACCCTCAG 0: 1
1: 0
2: 0
3: 35
4: 296
Right 1162955724 19:14096902-14096924 CCTCAGAGTTAGGCAAGTCTGGG 0: 1
1: 0
2: 0
3: 12
4: 202
1162955716_1162955726 0 Left 1162955716 19:14096885-14096907 CCACCCCTCATCTGAACCCTCAG 0: 1
1: 0
2: 0
3: 35
4: 296
Right 1162955726 19:14096908-14096930 AGTTAGGCAAGTCTGGGTTTGGG 0: 1
1: 0
2: 1
3: 15
4: 289
1162955716_1162955727 5 Left 1162955716 19:14096885-14096907 CCACCCCTCATCTGAACCCTCAG 0: 1
1: 0
2: 0
3: 35
4: 296
Right 1162955727 19:14096913-14096935 GGCAAGTCTGGGTTTGGGAGAGG 0: 1
1: 0
2: 1
3: 43
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162955716 Original CRISPR CTGAGGGTTCAGATGAGGGG TGG (reversed) Intronic
900383039 1:2394782-2394804 CCGAGGGAGCAGATGGGGGGTGG + Intronic
901329006 1:8390168-8390190 CTCTGGGTTCAGATGTGGCGTGG - Intronic
901391905 1:8951591-8951613 CTGAGGGCCCAGAAGAGGGAAGG + Intronic
901580066 1:10234954-10234976 CAGAGGTTTCAGATCAGGAGTGG - Intronic
903168623 1:21538461-21538483 CAGAGGGCTCAGATCAGAGGAGG - Intronic
903429204 1:23279360-23279382 GTGGGGGTTCAGATGAGGTAGGG - Intergenic
903847484 1:26287131-26287153 CTGATGGTGCAGATGGGTGGGGG - Intronic
903954100 1:27012928-27012950 CGGAGCGTTCAGAGGCGGGGCGG - Intergenic
904030815 1:27532422-27532444 CTGAGGGCTCAGAGGAGTGGCGG - Intergenic
904046067 1:27609229-27609251 CTGAGGGTGCAGATGAGGCATGG - Intergenic
904433382 1:30479334-30479356 GTGAGGGGTCAGCTGTGGGGAGG - Intergenic
904565074 1:31423982-31424004 CTGAGGTTGGAAATGAGGGGAGG + Intronic
904581971 1:31550425-31550447 CTGAGAGTTCAGAGGTTGGGGGG + Intergenic
904785216 1:32977522-32977544 CCGAGGGTTCTGGGGAGGGGTGG + Intergenic
905138832 1:35824228-35824250 GTGAGGGTGCAGATAAGTGGTGG - Intronic
905247204 1:36623498-36623520 CTGAGGGAGCAGGTGAGGAGGGG + Intergenic
905389168 1:37625285-37625307 CAGAGGCTTGAGATGAGGGGTGG + Intronic
906949647 1:50323783-50323805 GTGAGGGCTCAGAAGAGGGAGGG - Intergenic
907518945 1:55010754-55010776 CTGAGTCTTCGGATGAGGTGAGG + Exonic
907566332 1:55437810-55437832 CTGAGGGGGTAGAAGAGGGGTGG - Intergenic
908298137 1:62733696-62733718 CTGAGGGTGGAGATAAGAGGAGG - Intergenic
908990594 1:70083521-70083543 CTGAGAGGTCAGATGAGATGAGG - Intronic
909735732 1:78958988-78959010 CTGAAGGTTCAGATAATTGGTGG + Intronic
913299881 1:117359446-117359468 CAGATGGTTCAGTTGAGGGCAGG - Intergenic
914716243 1:150257349-150257371 CTCAGGGTGCAGGGGAGGGGTGG - Exonic
914756198 1:150562738-150562760 CTGAGAATTGAGATGAGGGTGGG + Intergenic
915196816 1:154195595-154195617 CTGTGGGTTCAGATGAACAGAGG + Intergenic
915516022 1:156413186-156413208 CGGAGGGTGCAGATGGAGGGTGG + Intronic
915523850 1:156464400-156464422 CTGAGTGTGCTGTTGAGGGGGGG + Exonic
916551246 1:165851739-165851761 CTGGGGGTAGGGATGAGGGGAGG - Intronic
916988848 1:170220315-170220337 CAGAGGGGTCAAATGAGGTGAGG - Intergenic
919894232 1:201998812-201998834 CTGAGGGAACAGTGGAGGGGTGG - Intronic
920251433 1:204624772-204624794 CTGAGGGTCCAGAGGGAGGGTGG + Intronic
920496317 1:206457402-206457424 CTGAAGGTACAGAGGAGGGAGGG + Intronic
920505824 1:206514392-206514414 CTGAGGGTCTATAAGAGGGGTGG + Intronic
920580337 1:207100908-207100930 ATGAGAGCTCAGATGAGAGGAGG + Intergenic
921681597 1:218039488-218039510 CTGAGGGATCAGATGGAGGTTGG + Intergenic
922067753 1:222160275-222160297 TTGAGGGTGCAGATGACTGGAGG - Intergenic
922595393 1:226809152-226809174 CAGATGGTGCAGATGAGGGAGGG + Intergenic
923470414 1:234285336-234285358 CGCAGGGTTCAGATGAGGCCAGG + Intronic
1063097434 10:2920852-2920874 GTGTGTGGTCAGATGAGGGGTGG - Intergenic
1064390731 10:14939698-14939720 TTGAGGGTATAGCTGAGGGGTGG + Intronic
1066061932 10:31731723-31731745 GTGGGGGTTCAGATGAGGAGTGG + Intergenic
1070327996 10:75400375-75400397 CTGCGGGGTCAGACGATGGGGGG + Intronic
1070754618 10:78984351-78984373 CTGGGGGTGCATATGAGGGATGG + Intergenic
1070969309 10:80550221-80550243 CTGAGGGGTCAGATAAGCTGAGG - Intronic
1071105723 10:82092365-82092387 GTGTGGGTTCAGTTGAGGGTGGG - Intronic
1074472890 10:113743590-113743612 CCAAGGGTGAAGATGAGGGGAGG - Intergenic
1074862400 10:117520747-117520769 CTGAGGGTCCAGCAGAGGGTTGG + Intergenic
1075453247 10:122568041-122568063 CTGAGGATTCAGCTGGGAGGAGG + Intronic
1075738451 10:124678717-124678739 CTGTGGATACAGATGAGGGCAGG + Intronic
1076138654 10:128062801-128062823 AGCAGGGTTCAGATGAGGGCTGG - Intronic
1077039832 11:515137-515159 CTGTGGGTGCACATGTGGGGAGG + Intergenic
1077102405 11:828020-828042 CTGTGGGCTCAGTTGTGGGGAGG + Intronic
1078317479 11:10305246-10305268 CTGCGGGTTAAGAGGTGGGGTGG + Exonic
1079136541 11:17778858-17778880 CTGAGTGATTAGATGGGGGGTGG + Intronic
1081602167 11:44503026-44503048 CTGAGGGTTCATAGGAGGAGGGG + Intergenic
1082006111 11:47420016-47420038 CTGTGCCTTCAGATGAGGGGTGG + Intronic
1082009739 11:47441977-47441999 CAGAGGGGTCTGTTGAGGGGAGG - Intronic
1083911681 11:65713491-65713513 CTGAGGGTACCGTTGAGCGGTGG - Exonic
1084938444 11:72599764-72599786 CTGAGGGCTGAGATGAGCAGAGG + Intronic
1084970441 11:72768491-72768513 CTGAGGGTTCAGGGGAAGAGGGG + Intronic
1085616908 11:78007208-78007230 GTGAAGGTTCAGATGATGGTTGG + Intergenic
1087180129 11:95133817-95133839 CTGAAGGTACAGATGAGGGTTGG + Intergenic
1087705587 11:101487520-101487542 GTGGGGGCTCAGAAGAGGGGAGG - Intronic
1089809722 11:121121686-121121708 CTGAGGGTTGTGATGGTGGGGGG + Intronic
1090076966 11:123585616-123585638 CTGTGGCGTCAGAAGAGGGGAGG + Intronic
1091685748 12:2560990-2561012 CTGAGGGTGGAGGTGAGGAGCGG - Intronic
1092291429 12:7161690-7161712 CTGAGGGTGAAGAGGAGGGCCGG - Intergenic
1092883462 12:12905963-12905985 ATGAGGCATCTGATGAGGGGAGG + Intronic
1095516090 12:43007115-43007137 CTGAGAGTGAAGATGAGGGAGGG - Intergenic
1096749703 12:53751214-53751236 CGCAGGGCTCAGAGGAGGGGCGG - Intergenic
1100258472 12:92908310-92908332 CAGTGGGTTCAGGGGAGGGGAGG + Intronic
1100785323 12:98072222-98072244 CTGATGGTGGGGATGAGGGGAGG + Intergenic
1103795429 12:123499844-123499866 CTGAGTGGTCAGAGGAAGGGAGG - Intronic
1103934376 12:124467590-124467612 ATGAGGATGAAGATGAGGGGAGG - Intronic
1105761370 13:23517779-23517801 CTCAGGGTTCCTGTGAGGGGTGG + Intergenic
1105997427 13:25685889-25685911 CTGATGGTCCAGGTGAGGGAGGG + Intronic
1106027755 13:25971495-25971517 CTGAAAGATCAGATGAGGGTAGG - Intronic
1106286303 13:28320866-28320888 CTGAGGGTTAAGGAGAAGGGAGG + Intronic
1108322690 13:49303256-49303278 CTGAGGGGTCAGATGAGCACAGG + Intergenic
1109389057 13:61669899-61669921 CTGAAGGTTCAAATAAGTGGTGG - Intergenic
1110174853 13:72543843-72543865 CTGTGGGTTCAGTTGGGGTGGGG + Intergenic
1110232745 13:73183563-73183585 ATGAGGGGTCAGGTGAGGTGGGG + Intergenic
1114131690 14:19800206-19800228 CTGAGTGTTCAGGTGAGAGTGGG - Intronic
1114354213 14:21889541-21889563 CTGAGGCTGGAGATGAGGTGAGG - Intergenic
1114656631 14:24319603-24319625 CTGGGGGATCAGAGGAGGTGAGG + Intronic
1117300833 14:54425467-54425489 CTGTGGGTTCAGCTGAGGCATGG - Exonic
1118889606 14:69897139-69897161 ATGTGGGTTGAGAGGAGGGGGGG - Intronic
1118901968 14:69993732-69993754 CTGGGGGGTCAGGTGAGGGATGG + Intronic
1119233035 14:72996035-72996057 CTCAGGGATCAGATCATGGGTGG - Intronic
1121530666 14:94650422-94650444 CTCAGGGCTCAGAAGAGGTGTGG - Intergenic
1122129232 14:99595595-99595617 CTGGGAGCTCAGAGGAGGGGTGG - Intronic
1122397134 14:101441663-101441685 CTGTGGGGTCAGACGAGGGTGGG - Intergenic
1122600329 14:102918132-102918154 CAGAGTCTGCAGATGAGGGGTGG + Intergenic
1124797401 15:32795230-32795252 CTGGGGGTTCAGGTGAGGCAAGG + Intronic
1126423231 15:48498051-48498073 GTGAGGGTACAGAAGAGGGAGGG - Intronic
1126639950 15:50814232-50814254 CTGGGAGTTGAGATGGGGGGCGG + Intergenic
1128810578 15:70569009-70569031 CAGAGGGTTCAGAGGAGGGTTGG + Intergenic
1129321112 15:74775505-74775527 CTGAGTGCTCAGGTGAGGAGAGG + Intergenic
1129740789 15:77988644-77988666 CTGGGGGTTCAGATCGGGGGAGG + Intronic
1130537801 15:84799463-84799485 CTGAGGTTTAAGAGGAGGGGTGG + Intronic
1130940963 15:88508681-88508703 CTGCAGTTTCAGAGGAGGGGTGG + Intergenic
1132396211 15:101476688-101476710 ATCAGGGATCGGATGAGGGGAGG + Intronic
1132644206 16:991375-991397 ATGAGTGTTCAGATGTGGAGGGG + Intergenic
1132935215 16:2476524-2476546 CTGAGTGTTCAGATTAGATGAGG - Intronic
1132957973 16:2606411-2606433 CTGAGGAATCTGAGGAGGGGGGG + Intergenic
1132970449 16:2685659-2685681 CTGAGGAATCTGAGGAGGGGGGG + Intronic
1134186391 16:12088264-12088286 CTGCGGGGTCAGAGCAGGGGCGG + Intronic
1134908143 16:17999719-17999741 CTGGGGGTTAAGGTGGGGGGAGG + Intergenic
1135221874 16:20621240-20621262 GTGGGGGTTCAGGTGGGGGGAGG - Intronic
1136103290 16:28010963-28010985 CTGAGGGTAGAGCTGAGGAGGGG + Intronic
1136567501 16:31079053-31079075 CTGAGGGCTCAGAGGAGGAGGGG + Exonic
1139370987 16:66469362-66469384 CAGAGGCTTCAGAGGAGAGGAGG + Intronic
1140887937 16:79261024-79261046 ATGAGGCTTGAGATGAGGGCTGG + Intergenic
1140953912 16:79845008-79845030 ATGGGGGTTCAGTGGAGGGGAGG + Intergenic
1141289165 16:82701856-82701878 CTGTGTCTTCAGAAGAGGGGAGG - Intronic
1142199057 16:88752614-88752636 CTGAGGATGGAGATGAGGGAGGG + Intronic
1142258797 16:89032529-89032551 CTCAGAGTGCAGATCAGGGGAGG - Intergenic
1142352390 16:89586239-89586261 CTGAGGGGTCATAGCAGGGGTGG + Intronic
1142358711 16:89616168-89616190 CTGGGGGTTCAGGTGGGTGGGGG + Intronic
1143112934 17:4562919-4562941 TTGAGGGCTCAGAGTAGGGGTGG + Intergenic
1143614158 17:8039594-8039616 AGGAGGGTACAGGTGAGGGGCGG + Exonic
1143764621 17:9129333-9129355 CAGAGGGAACAGCTGAGGGGAGG + Intronic
1143996782 17:11013292-11013314 CGGAGGGTTCAGAGTAGAGGTGG - Intergenic
1144493107 17:15731503-15731525 CTGTGGGTGCTGATGCGGGGAGG + Intergenic
1144874207 17:18388685-18388707 CTGTGGGTGCTGATGAGGGGAGG + Intronic
1144907148 17:18645149-18645171 CTGTGGGTGCTGATGTGGGGAGG - Intronic
1145158017 17:20555733-20555755 CTGTGGGTGCTGATGAGGGGAGG - Intergenic
1145257996 17:21338025-21338047 CTGATGGTTCATATGGGAGGGGG + Intergenic
1145304870 17:21668275-21668297 CTGAATCTTCAGATGAGGGGAGG + Intergenic
1145305631 17:21673529-21673551 GTGAAGGTCCAGATGAGGTGGGG - Intergenic
1146636365 17:34508465-34508487 CTGGAGATTCAGATGTGGGGAGG - Intergenic
1146821691 17:35987979-35988001 CTGATGATTCAGATGAGGAGAGG - Intronic
1147905286 17:43818534-43818556 CTGAGCCTTCCGCTGAGGGGAGG - Intronic
1148534402 17:48427086-48427108 CTGAGAGTTTGGAGGAGGGGAGG - Intronic
1150479589 17:65499180-65499202 CTGAGGGTTGGGAGGAGGGTGGG - Intergenic
1150872864 17:68932799-68932821 TTGAAGCTTGAGATGAGGGGTGG - Intronic
1151923079 17:77172483-77172505 CTGAGTGTTCTGTTGTGGGGCGG + Intronic
1152799598 17:82324571-82324593 TGGAGGTTTCAGGTGAGGGGAGG - Exonic
1154208056 18:12354682-12354704 CTGTGGGTCCAGATGATAGGAGG - Intronic
1156094195 18:33509967-33509989 GTGCAGGTTGAGATGAGGGGAGG - Intergenic
1156474247 18:37395578-37395600 CTGAGGGGTCAGGTGAGTGAGGG + Intronic
1156510096 18:37629072-37629094 CTCATGGTTCAAATGAGGGAGGG - Intergenic
1157297602 18:46457454-46457476 CTGAGGGTTCAGCGGAGGTGAGG + Exonic
1158221915 18:55159342-55159364 CAGAGGGGTGAGATGGGGGGCGG - Intergenic
1158281977 18:55838451-55838473 CTGAGAGATAAGAAGAGGGGAGG + Intergenic
1159346448 18:67212864-67212886 CTGAGGGTGAAGATGGGAGGAGG - Intergenic
1159784172 18:72694087-72694109 CTGAAGGTTCAAACAAGGGGAGG + Intergenic
1159932814 18:74332052-74332074 ATGAGGGTTTAAATGAGGGTGGG - Intronic
1160209029 18:76860649-76860671 CTGAGGGTTTGGATGAGAGTAGG - Intronic
1160545300 18:79649004-79649026 CTGAGGGTGCTGGAGAGGGGAGG - Intergenic
1160545328 18:79649111-79649133 CTGAGGGTGCTGGGGAGGGGAGG - Intergenic
1161545623 19:4878421-4878443 CTGGGGGTTCAGGTCAGGGAGGG + Intergenic
1161645478 19:5450958-5450980 CTTAGGGCTAAGATGAGGGAGGG - Intergenic
1162668007 19:12231356-12231378 CTGAGTGTTCAGTGGCGGGGAGG - Intronic
1162955716 19:14096885-14096907 CTGAGGGTTCAGATGAGGGGTGG - Intronic
1163126544 19:15247272-15247294 CTGTGGGTCCTGAGGAGGGGCGG - Intronic
1163236065 19:16031403-16031425 CTGTGAGTGCAGATGTGGGGAGG + Intergenic
1164465438 19:28483695-28483717 CTGAGGGTTCAGAGAGTGGGAGG - Intergenic
1164616193 19:29668145-29668167 TTGAGGGTTCAGAGGGGTGGGGG - Intronic
1164681756 19:30138982-30139004 CTTAGAGTTCAGAGCAGGGGAGG + Intergenic
1166106981 19:40602341-40602363 TTGGGGGTTCAGGTGAGGTGGGG + Intronic
1166738651 19:45101129-45101151 CTGAGGACTCAGATTAGGGAGGG + Intronic
1166801612 19:45461169-45461191 CTGAGGCTCCAGAGGAGGGGAGG - Intronic
1166894642 19:46015961-46015983 CTGAGGGTTCGGAGAAGGTGCGG + Intronic
1167322414 19:48805414-48805436 CTGAGGGCTCTGAGGAAGGGAGG - Intronic
1168182574 19:54672156-54672178 GTGATGGTTGGGATGAGGGGTGG + Intronic
1168309590 19:55453689-55453711 CTGAGGGCCCAGAAGAGGGATGG - Intronic
925768411 2:7259532-7259554 CTGCTGATCCAGATGAGGGGTGG - Intergenic
925872907 2:8286128-8286150 CAGTGGGGTCAGATGAGGTGAGG - Intergenic
927364549 2:22278857-22278879 CTGAGGCTTCAAAAGAGGGGAGG - Intergenic
929030971 2:37649610-37649632 CTGAGGGTGCAGGGGAGGGAGGG + Intronic
931196406 2:60056012-60056034 CTGTGGGTTCAGATGCAGGTAGG + Intergenic
931700017 2:64901917-64901939 CTGGGTGCACAGATGAGGGGAGG - Intergenic
931826902 2:66009970-66009992 CTGAGGGTGCAGGTGCAGGGTGG - Intergenic
932421719 2:71605226-71605248 CAGAGGGCTCAGAAGAGGCGGGG - Intronic
933105229 2:78316261-78316283 CTGATGGTTCACCTGAGGGCAGG + Intergenic
935530685 2:104229504-104229526 CTGATGGCTTAGATGAGTGGGGG - Intergenic
936372359 2:111912798-111912820 CTGAGGGTTGAACTGAGGGAAGG - Intronic
936947040 2:117940451-117940473 GTGAGGGTTCAGATCAGGAAAGG + Intronic
938137806 2:128773803-128773825 CTCAGGGGTCAGATGAGCAGCGG - Intergenic
939255078 2:139732871-139732893 CTGCAGGTTCAGATGAGGCTAGG - Intergenic
939592310 2:144081241-144081263 CTGAGGGTTAAGATAAGGTAAGG + Intronic
940104919 2:150088852-150088874 ATAAGGGTTCAGATGAAAGGCGG + Intergenic
940859956 2:158761186-158761208 CTGGGGGGTCAGGTGAGAGGAGG + Intergenic
941983668 2:171488606-171488628 CTGAGGTTTTAGATGAGGTAGGG - Intergenic
943769400 2:191699136-191699158 CTGAGGGGGCTGATGAGGGAGGG + Intergenic
944790522 2:203120421-203120443 GTGAGGGTACAAATGAGGAGTGG + Intronic
947556991 2:231101773-231101795 CTGAGGGCTCAGATGGTCGGTGG + Intronic
947918605 2:233850626-233850648 CTGAGGGTTCAGAGGACTTGGGG + Intronic
948060295 2:235038581-235038603 CTGAGGGATTTGATGAGGTGTGG + Intronic
948358411 2:237399096-237399118 CTGAGGGTTCATAAGATGAGAGG + Intronic
948588627 2:239036060-239036082 GTGAGGGTTCAGGGGAGGTGGGG + Intergenic
1168962818 20:1880587-1880609 CTGGAGGTTCAGAGCAGGGGAGG + Intergenic
1169558161 20:6770243-6770265 CAGAGGGCTGGGATGAGGGGCGG - Exonic
1171089627 20:22271648-22271670 CTGAGGGATGAGGGGAGGGGTGG - Intergenic
1171522379 20:25785715-25785737 CTGAATCTTCAGATGAGGGGAGG + Intronic
1171523151 20:25791019-25791041 GTGAAGGTCCAGATGAGGTGAGG - Intronic
1171530128 20:25847660-25847682 CTGAATCTTCAGATGAGGGGAGG + Intronic
1171553675 20:26064864-26064886 GTGAAGGTCCAGATGAGGTGAGG + Intergenic
1171554448 20:26070168-26070190 CTGAATCTTCAGATGAGGGGAGG - Intergenic
1172663413 20:36582926-36582948 ATGATGGTTTAGATGAGGGTAGG - Intronic
1174315495 20:49697378-49697400 CTGAGGGTTCAAATGAAGGATGG + Intronic
1174353429 20:49983470-49983492 CAGAGGGTTGAGGGGAGGGGTGG + Intronic
1175837966 20:62008450-62008472 CTGTGGGTTAAGGAGAGGGGAGG + Intronic
1176071530 20:63229226-63229248 CTGAGGTTTCAGGGAAGGGGTGG - Intergenic
1176084373 20:63289391-63289413 CTGAGTGCTCCGAGGAGGGGTGG + Intronic
1176128626 20:63487033-63487055 CTGAGGATGCAGAGGAGGGTGGG - Intergenic
1176128640 20:63487076-63487098 CTGAGGATGCAGAGGAGGGTGGG - Intergenic
1176128654 20:63487119-63487141 CTGAGGATGCAGAGGAGGGTTGG - Intergenic
1180067656 21:45420693-45420715 CAGAAGGTTCTGAGGAGGGGAGG - Intronic
1180984613 22:19897054-19897076 CAGAGCCTTCAGATGTGGGGAGG - Intronic
1183195181 22:36348847-36348869 CTGAGGGCTCCGAGGTGGGGGGG - Intronic
1183499344 22:38169095-38169117 CTGAGGGGTCTGGAGAGGGGTGG - Intronic
1183587653 22:38762399-38762421 CTGAGGGAGCTGAGGAGGGGTGG - Intronic
1184297996 22:43538237-43538259 CTGAGGGATCAGATGTGGGATGG - Intronic
1184430551 22:44439587-44439609 CTGAAGGCTCCGGTGAGGGGAGG + Intergenic
1184489008 22:44798624-44798646 TTGAGGGTGCAGATTAGGTGTGG - Intronic
1184651360 22:45920720-45920742 ATGAGGGATGAGATGAGGGATGG + Exonic
1184721915 22:46319588-46319610 CTTAGGCTGCAGCTGAGGGGTGG + Intronic
1185173784 22:49307709-49307731 CTGAGGGTGAAGATGGGGAGGGG + Intergenic
1185265539 22:49900711-49900733 CTCAGGGTGGAGATGGGGGGTGG + Exonic
949805466 3:7951017-7951039 CTGTGGTTTCAGATGACAGGTGG + Intergenic
950038445 3:9903752-9903774 GTGAGGGATCAGTTAAGGGGAGG - Intronic
952497575 3:33929298-33929320 CTGAGGCTTCAAAAAAGGGGTGG - Intergenic
952851146 3:37730578-37730600 CTCAGAGTTCAGAAGAGGTGGGG - Intronic
954693905 3:52410282-52410304 CTGAGGCTCGAGAGGAGGGGCGG + Exonic
956877372 3:73476828-73476850 CTGAAGGCTCAGCTGAGGGTCGG - Intronic
957574300 3:81988236-81988258 CTGAAGGTTCAAAGAAGGGGTGG + Intergenic
959598629 3:108154291-108154313 CAGAGGGATCTGGTGAGGGGAGG - Intergenic
961193377 3:124981181-124981203 CTGTGGGGACAGATGAGGGGAGG - Intronic
962330336 3:134472577-134472599 CAGAGGGTTCAGTTGAGCTGAGG + Intergenic
964452866 3:156828407-156828429 CTTATGTTTCAGATGAGAGGTGG - Intronic
966275103 3:178155923-178155945 CTGATGGTTAAGCTGTGGGGAGG + Intergenic
966632548 3:182094723-182094745 CTGACAGATCAGATGTGGGGTGG - Intergenic
966809562 3:183831453-183831475 CTGGAGTTTCAGATGAGGGCTGG - Intronic
966958453 3:184908857-184908879 CTGTGGGCTCAGAATAGGGGAGG + Intronic
968407289 4:351861-351883 GTGAGGGTTTGGATGAGAGGAGG + Intronic
968498897 4:935287-935309 CTGAGAGTTCAGATGAGATATGG - Intronic
968864672 4:3200531-3200553 CTGAGGATTCAGCTGGGCGGGGG - Intronic
969307763 4:6335564-6335586 CTGAGGGTTCAGAGACAGGGAGG + Intronic
969488439 4:7485452-7485474 CTGGGGCTCCAGGTGAGGGGTGG - Intronic
969589294 4:8112523-8112545 TGGAGGGGTCAGATCAGGGGTGG + Intronic
971301589 4:25446550-25446572 CTGAGGGTGCAGATGAGGCAGGG + Intergenic
972311899 4:37890480-37890502 AGGAGGGTGCAGATGAGGCGAGG + Intergenic
974282865 4:59822057-59822079 CTGAGTGTTCAGCTGAAGGGAGG - Intergenic
976030202 4:80742608-80742630 CTGAGGGGTCAGATAATGGATGG + Intronic
976717241 4:88136023-88136045 TTGAGGGTTCAGATGAGAATTGG + Intronic
983533265 4:168832543-168832565 CTGAGGGGTCAGACCTGGGGTGG + Intronic
983534010 4:168838344-168838366 CTGGGGGCACAGATGAGGGCTGG + Intronic
984631877 4:182069818-182069840 CTAAGGCTACAGATGAAGGGAGG + Intergenic
985670592 5:1204644-1204666 CTGAGGGGCCAGCTGTGGGGTGG - Intronic
985704147 5:1390986-1391008 CTGAGGGAGCAGGTGAGGGAGGG - Intergenic
986253529 5:6082642-6082664 CTGTGGGGTGAGGTGAGGGGTGG - Intergenic
986670501 5:10139256-10139278 AGGAGGGTTCAGGTCAGGGGCGG - Intergenic
987471165 5:18330266-18330288 CTCAGGGTTCAGATGGGAAGAGG - Intergenic
990287213 5:54311662-54311684 CTGAGGGTGGGGATGGGGGGGGG - Intergenic
996124488 5:119708371-119708393 CAGAGTGTTCAGGTGAGGGGTGG + Intergenic
996391556 5:122967912-122967934 CTGAAGGGTCAGATTAAGGGAGG - Intronic
996643231 5:125783459-125783481 CTGAAGGTTCAGATGATTGGTGG + Intergenic
996741088 5:126799588-126799610 CTGAGGGTCCAGAAGAAGGAAGG + Intronic
997211472 5:132079541-132079563 GTGGGGGTTCAGATGAGGTGGGG - Intergenic
997361464 5:133297900-133297922 CTGCTGGTCCAGATGAGGGATGG - Intronic
997878706 5:137571183-137571205 CTAGAGGCTCAGATGAGGGGTGG - Intronic
998685784 5:144522780-144522802 CACAGGGTTCAGATGAGGCCAGG + Intergenic
1000119104 5:158179730-158179752 CCTAGGGTTCAGCTGATGGGAGG + Intergenic
1000209102 5:159095199-159095221 CTGAGGGGGCGGAGGAGGGGTGG - Intronic
1000222056 5:159223726-159223748 CTAAGGGTACAGCTGAGGGCTGG - Intergenic
1000971532 5:167719981-167720003 CTGTGGGTTAAAAAGAGGGGGGG + Intronic
1001656041 5:173351016-173351038 CTGAAGGTTCAGATGATTGCTGG + Intergenic
1003034693 6:2632628-2632650 TTGAGGGATGAGATGAGGGCTGG + Intronic
1005399400 6:25415971-25415993 GAGAGGGGTCAGAGGAGGGGTGG + Intronic
1007369553 6:41417367-41417389 CTGAGGGTCCTGGAGAGGGGTGG - Intergenic
1008216189 6:48792706-48792728 GTGAGGGATGTGATGAGGGGAGG + Intergenic
1014113273 6:117645221-117645243 ATGAGGGTTAAGATGAGATGGGG + Intergenic
1014205690 6:118652317-118652339 CTAAGGGTTCAGGTGAAGGGTGG - Intronic
1017642466 6:156507627-156507649 CTGAGGTTTCAGGTGAGGCAGGG - Intergenic
1018688634 6:166324399-166324421 CTGCAGGGTCAGAGGAGGGGAGG - Intronic
1019452867 7:1108516-1108538 CTGGGGGTTCCCATGAGGCGGGG + Intronic
1021765459 7:23943982-23944004 CAGAGTGCTCAGGTGAGGGGTGG - Intergenic
1022690225 7:32642893-32642915 CTGAAGGTTCAGATGATCGTTGG + Intergenic
1023320993 7:38997478-38997500 CTAAGGATTCAGATGAGGCCAGG - Intronic
1024177484 7:46856014-46856036 CTGAGGCATCTGATGAGGGAAGG - Intergenic
1024255868 7:47539644-47539666 CTGGGAGGTCAGATGGGGGGCGG - Intronic
1025282866 7:57640892-57640914 CTGAATCTTCAGATGAGGGGAGG + Intergenic
1025283583 7:57645934-57645956 GTGAAGGTCCAGATGAGGTGGGG - Intergenic
1025301849 7:57824526-57824548 CTGAATCTTCAGATGAGGGGAGG - Intergenic
1031282959 7:119828126-119828148 CTGAGGGATAGGATGAGGGTAGG + Intergenic
1032860644 7:135876085-135876107 CTGAGAGGTCAGATGAAGGCAGG - Intergenic
1034207409 7:149329969-149329991 CTGGAGGTTCAGGTGTGGGGAGG + Intergenic
1034411057 7:150942403-150942425 CTGGGAGCCCAGATGAGGGGAGG + Intergenic
1035664954 8:1373999-1374021 CTGAGGTTTAAGCTGAGGGGTGG + Intergenic
1035736040 8:1888271-1888293 CTGTAGGTTCTGAGGAGGGGTGG + Intronic
1039041617 8:33414027-33414049 CTGAGGGTGGAGGTGAAGGGGGG - Intronic
1039194979 8:35021002-35021024 CTGAAGGTTCAATTGAAGGGAGG + Intergenic
1039764022 8:40608830-40608852 CTGATGGTCCAGATCATGGGAGG - Intronic
1045149770 8:99391392-99391414 CTGTGGGGACAGATGAGGGAGGG + Intronic
1047778495 8:128092656-128092678 AGCAGGGTTCAGATGAGGGCTGG + Intergenic
1047928443 8:129703147-129703169 CTGAGGGTTGAGAGGAGAGCTGG - Intergenic
1048250737 8:132864800-132864822 GTGAGGATGCAGAGGAGGGGAGG + Intergenic
1048351632 8:133621246-133621268 CTGAGGGCTCAGATGGGAGCAGG - Intergenic
1048915754 8:139181444-139181466 TAGAGGGTTCAGAAGATGGGAGG + Intergenic
1049178816 8:141209939-141209961 CTGGGCCTTCAGATGAGGGTGGG + Intronic
1049494638 8:142923982-142924004 CTGTGGGTGCAGCTGAGGTGTGG + Intergenic
1051231211 9:14957507-14957529 CTGTGGGGTCAAATGGGGGGTGG - Intergenic
1051967924 9:22851709-22851731 CTAAGTGTTCAAATGAAGGGAGG - Intergenic
1052040376 9:23731884-23731906 GAGAGGGCTCAGATGATGGGGGG - Intronic
1052865010 9:33459583-33459605 CTGAGGGGCCAGGGGAGGGGAGG - Intergenic
1053443196 9:38132362-38132384 CTGAGGTTTCAGAGGTGGGGAGG - Intergenic
1054745245 9:68847515-68847537 CTGAGGGTTTCTTTGAGGGGAGG + Intronic
1056177595 9:84050447-84050469 CTGAGGGTTCTGGAGTGGGGAGG + Intergenic
1056657230 9:88519501-88519523 TTGGGGGCTCAGATGTGGGGCGG + Intergenic
1057528054 9:95819811-95819833 CTCAGGTGTCAGAAGAGGGGAGG + Intergenic
1057814543 9:98284983-98285005 CAGGGGTTTCAGATGTGGGGTGG + Intergenic
1057900148 9:98942432-98942454 GTGAGGGCTCAGAGGAGGGATGG - Intergenic
1059342917 9:113609653-113609675 TTCAGGGTTCAGAGGTGGGGCGG - Intergenic
1060234886 9:121855634-121855656 ATGGGCGTTCAGAGGAGGGGAGG + Intronic
1060491942 9:124091550-124091572 CTGAGGTTTCTGATGGGAGGAGG + Intergenic
1061084352 9:128390429-128390451 CTGGGGGTAGAGATGAGGGGAGG + Exonic
1189371946 X:40435641-40435663 CTGAGGGTGCAGCTGTGGGCGGG + Intergenic
1190053980 X:47171330-47171352 CTGAGGTTGCAGGTGAGGGAGGG - Intronic
1190490780 X:50980610-50980632 CTGAGGGTTCAAACAAGTGGTGG + Intergenic
1190562003 X:51695393-51695415 ATGAGGGTTCAGAAGGAGGGAGG + Intergenic
1192230711 X:69263121-69263143 CTGAAGGGTAAGATGGGGGGAGG - Intergenic
1193740088 X:85206488-85206510 CTGAGGGATCAAATCAGAGGAGG + Intergenic
1194058172 X:89163634-89163656 CTGAGGCTCCAGGGGAGGGGTGG - Intergenic
1194267357 X:91771420-91771442 CTCAGGGTCCTGAGGAGGGGAGG - Intergenic
1195370461 X:104167256-104167278 CGTAGGGTACAGATGGGGGGAGG - Intronic
1195446417 X:104957455-104957477 CTGGGGGTTCAGAGGGAGGGAGG + Intronic
1195786298 X:108527597-108527619 TGGAGTGTTCAGGTGAGGGGTGG - Intronic
1197055593 X:122114376-122114398 CTGAAGGTCCAGATGACAGGAGG - Intergenic