ID: 1162958708

View in Genome Browser
Species Human (GRCh38)
Location 19:14113856-14113878
Sequence GCTGAACCCCAACACTGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 1, 2: 1, 3: 17, 4: 140}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162958702_1162958708 11 Left 1162958702 19:14113822-14113844 CCCCAACACTGGGATGGCTCATC 0: 1
1: 0
2: 1
3: 13
4: 101
Right 1162958708 19:14113856-14113878 GCTGAACCCCAACACTGGGATGG 0: 1
1: 1
2: 1
3: 17
4: 140
1162958697_1162958708 27 Left 1162958697 19:14113806-14113828 CCCATTCTGAGCTGGACCCCAAC 0: 1
1: 0
2: 0
3: 10
4: 92
Right 1162958708 19:14113856-14113878 GCTGAACCCCAACACTGGGATGG 0: 1
1: 1
2: 1
3: 17
4: 140
1162958703_1162958708 10 Left 1162958703 19:14113823-14113845 CCCAACACTGGGATGGCTCATCC 0: 1
1: 0
2: 0
3: 11
4: 129
Right 1162958708 19:14113856-14113878 GCTGAACCCCAACACTGGGATGG 0: 1
1: 1
2: 1
3: 17
4: 140
1162958704_1162958708 9 Left 1162958704 19:14113824-14113846 CCAACACTGGGATGGCTCATCCT 0: 1
1: 0
2: 0
3: 10
4: 143
Right 1162958708 19:14113856-14113878 GCTGAACCCCAACACTGGGATGG 0: 1
1: 1
2: 1
3: 17
4: 140
1162958695_1162958708 29 Left 1162958695 19:14113804-14113826 CCCCCATTCTGAGCTGGACCCCA 0: 1
1: 0
2: 3
3: 18
4: 204
Right 1162958708 19:14113856-14113878 GCTGAACCCCAACACTGGGATGG 0: 1
1: 1
2: 1
3: 17
4: 140
1162958698_1162958708 26 Left 1162958698 19:14113807-14113829 CCATTCTGAGCTGGACCCCAACA 0: 1
1: 0
2: 1
3: 9
4: 139
Right 1162958708 19:14113856-14113878 GCTGAACCCCAACACTGGGATGG 0: 1
1: 1
2: 1
3: 17
4: 140
1162958696_1162958708 28 Left 1162958696 19:14113805-14113827 CCCCATTCTGAGCTGGACCCCAA 0: 1
1: 0
2: 2
3: 18
4: 151
Right 1162958708 19:14113856-14113878 GCTGAACCCCAACACTGGGATGG 0: 1
1: 1
2: 1
3: 17
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162958708 Original CRISPR GCTGAACCCCAACACTGGGA TGG Intronic
900565013 1:3327881-3327903 GCTGAACCCCATCTGTGGAATGG - Intronic
900754083 1:4421509-4421531 CCTGCCCCCCAACACTGGGATGG + Intergenic
901040327 1:6359498-6359520 GCTGAGCCCCAAGACAGGCATGG - Intronic
904035086 1:27554628-27554650 AATGGACCCCAACACTGTGAGGG + Intronic
904121760 1:28203038-28203060 GCTGCCCCCCAAAACTTGGATGG + Intronic
904999882 1:34659744-34659766 TCTGAACCCCAACACTGACAAGG - Intergenic
909536858 1:76746701-76746723 CATGAACCCCTACACTGGGTTGG + Intergenic
909944942 1:81653524-81653546 GCTGCTTCCCAACACTGGAAAGG + Intronic
914438233 1:147679791-147679813 GATAAAACCCAGCACTGGGAAGG + Intergenic
919510441 1:198456610-198456632 GCTGAACTCCTACTCTGTGAAGG - Intergenic
920053470 1:203176956-203176978 GCTGTCCCTCAACAGTGGGATGG + Intergenic
920170014 1:204066066-204066088 GCTGAACCCACACACTGAGTGGG + Intergenic
920579437 1:207091584-207091606 GCTGAAGCCCAACACAGCAAAGG - Intronic
920877053 1:209846348-209846370 GCTGTGACCCATCACTGGGAGGG - Intronic
922797306 1:228346770-228346792 GCTGAGCCCCACCACAGGCAGGG - Intronic
923703725 1:236325815-236325837 GATTAACCCCAAATCTGGGAAGG + Intergenic
1064227997 10:13504350-13504372 TCTGAACCCTAACCCGGGGAGGG + Intronic
1064995155 10:21290260-21290282 TCTGAGCCCCAACATTGAGATGG - Intergenic
1067684555 10:48458745-48458767 ACTGAGCGTCAACACTGGGATGG + Intronic
1070584205 10:77748785-77748807 CCTGAAACCCAGCAGTGGGATGG - Intergenic
1075393999 10:122113584-122113606 GCGGGACCCCAACCCTGGCAGGG - Intronic
1078740704 11:14063785-14063807 GCTGATTCCCAACATTGTGAAGG + Intronic
1079451894 11:20605154-20605176 GCGGCACCCAAACGCTGGGAGGG - Intronic
1080448462 11:32358842-32358864 GCTGAACTCCAGCACTTGAAGGG - Intergenic
1080890654 11:36406211-36406233 CCCTAACCCCAACACTGGAAAGG - Intronic
1081596579 11:44463617-44463639 TCTGTACCCCACCACAGGGAGGG - Intergenic
1082103730 11:48197310-48197332 TCAGTACCCCAACACTGGTAAGG + Intergenic
1083603919 11:63965676-63965698 CCTGAGCCCCAACACAGGCAAGG - Intergenic
1083921937 11:65786083-65786105 GCTGAACCTCAGCCCTGGGCAGG + Intergenic
1084210037 11:67616629-67616651 GCTGAGCCCCAGCGCTAGGAAGG - Intergenic
1087010362 11:93508237-93508259 ACTGGTCTCCAACACTGGGATGG + Intronic
1088686659 11:112289906-112289928 TCGGATCCCCAAGACTGGGAAGG + Intergenic
1091778666 12:3200470-3200492 GCTGAGCCCCACCACTTGGCCGG - Intronic
1092780160 12:11978782-11978804 GCTGCAGCCCAGCCCTGGGATGG - Intergenic
1096679761 12:53247820-53247842 GCTGAAGCCCAGGACTGGGCTGG + Intergenic
1097049910 12:56216428-56216450 CCTGCCCCCCAACACTTGGAAGG - Exonic
1097181303 12:57173568-57173590 GCTGAAGCTCAACTCTGGTAGGG - Intronic
1100713859 12:97285381-97285403 AGTGAACACCAACAATGGGATGG - Intergenic
1103280651 12:119755542-119755564 GCTGAACACCCAGGCTGGGAGGG - Intronic
1104723425 12:131060020-131060042 TCTGATACCCACCACTGGGAAGG + Intronic
1105348995 13:19599578-19599600 GCTGAACCAAAGCAATGGGAAGG + Intergenic
1106013696 13:25848277-25848299 CCTCAGCCTCAACACTGGGAGGG + Intronic
1107955667 13:45508823-45508845 GCTTCCCCCCACCACTGGGAAGG - Intronic
1108251582 13:48573107-48573129 GGTGAACCCCTAAGCTGGGATGG - Intergenic
1108623902 13:52209443-52209465 GCTGAACCAAAGCAATGGGAAGG + Intergenic
1108662810 13:52601576-52601598 GCTGAACCAAAACAATAGGAGGG - Intergenic
1116477598 14:45359417-45359439 TCTGAGCCCCAACATTAGGAAGG + Intergenic
1118751811 14:68813280-68813302 CCTGAACCCCATCTTTGGGAAGG - Intergenic
1123029093 14:105442409-105442431 GGTGGACCCCAGCTCTGGGAGGG + Intronic
1123065453 14:105616791-105616813 GCTGAGCCCCTGCACAGGGAAGG - Intergenic
1123069657 14:105636257-105636279 GCTGAGCCCCTCCACAGGGAAGG - Intergenic
1123088750 14:105732040-105732062 GCTGAGCCCCTCCACAGGGAAGG - Intergenic
1123094679 14:105761297-105761319 GCTGAGCCCCTGCACAGGGAAGG - Intergenic
1124656917 15:31516332-31516354 GCTCAACACCAAAACTGGAATGG - Intronic
1131448863 15:92522261-92522283 GCTTAACCCCTACACTAGGCTGG - Intergenic
1132664023 16:1073482-1073504 CCTGAAACCCAAGACTGGGGAGG + Intergenic
1139793059 16:69456259-69456281 GGTGAATCCCAACACTGGGAAGG - Intronic
1141134800 16:81458263-81458285 GCTGAACCCCATCACCTGGAAGG + Intronic
1141771042 16:86089779-86089801 CCTGAATCCCCTCACTGGGAAGG - Intergenic
1141922482 16:87145441-87145463 GCTGTACGTCAACACTGGGCGGG - Intronic
1142394221 16:89822368-89822390 GCTGAACCCAGACACCGCGAGGG - Intronic
1146050311 17:29545815-29545837 AGTGAACACCAACACTGGGAAGG - Exonic
1146239500 17:31205034-31205056 GAGGAATCCCAAAACTGGGAGGG - Intronic
1147644547 17:42026005-42026027 CCTGAACCCCAACTCTTGGAGGG - Intronic
1151729404 17:75901975-75901997 CCTGTACCCCAACTCTGGGATGG + Intronic
1152209695 17:78996504-78996526 CCTGAACCCCAGCAGGGGGAGGG - Intronic
1154486346 18:14874675-14874697 GCTGAACCACAACTTCGGGAGGG - Intergenic
1158344222 18:56499197-56499219 GCAGTACCCCAAACCTGGGATGG - Intergenic
1158555340 18:58470352-58470374 TCTGAAGTCCACCACTGGGAGGG + Intergenic
1161980614 19:7628357-7628379 CCTGAGCCCCAGCAGTGGGATGG - Intronic
1162589175 19:11579242-11579264 GCAGAACCACAGCACTGGGTGGG + Intronic
1162958701 19:14113816-14113838 GCTGGACCCCAACACTGGGATGG + Intronic
1162958708 19:14113856-14113878 GCTGAACCCCAACACTGGGATGG + Intronic
1163674179 19:18647083-18647105 GCTGAGCCCCTTCTCTGGGAAGG + Intronic
1166370047 19:42295355-42295377 GCTGCCCCCCAGCACCGGGAGGG - Exonic
925909672 2:8565602-8565624 GCTGAACCCCAGAACAGGGCAGG - Intergenic
926588312 2:14713399-14713421 CCTGGGCCCCATCACTGGGAAGG - Intergenic
927649142 2:24900705-24900727 GCTGAATTCAAACACTGGAAGGG + Intronic
928907251 2:36381140-36381162 GCTTCACACCACCACTGGGAGGG - Intronic
930874391 2:56197700-56197722 GCTTAACTCCAGGACTGGGAAGG + Intronic
931447360 2:62337848-62337870 GCTGAGCCCAAACACTGCGAAGG + Intergenic
935585506 2:104796769-104796791 GCTGATTCCCAACACTGGGGAGG + Intergenic
937044419 2:118843641-118843663 CCTGACCCCCAACTCTGGGCTGG - Intronic
938400482 2:130987066-130987088 GCTGGACCCCCACAGTGGGGAGG + Intronic
940101342 2:150042718-150042740 TCTGAATCCCAACTCTGGTAAGG + Intergenic
947223079 2:227813363-227813385 GCTGAACCTCAACCATGTGATGG + Intergenic
947501702 2:230675639-230675661 GCTAAGCCCCAGCACAGGGATGG + Intergenic
948632062 2:239308685-239308707 GCTGAACCCCTGCACTGGGCTGG - Intronic
948723909 2:239920188-239920210 GCTGAACCCTCACACGGGGTTGG - Intronic
948846321 2:240684373-240684395 TCTGAACCCCAGAACTGGAAAGG - Intergenic
1169287080 20:4318418-4318440 GCAGAACCCCAACACTGTGCTGG + Intergenic
1171940524 20:31324525-31324547 TCTTCACCCCAACACTGGGAGGG - Intergenic
1171995929 20:31731343-31731365 TCTGAGCCCCAACACTTGGTTGG + Intergenic
1172774454 20:37398908-37398930 CCTGAGCCCCAACCCTCGGACGG + Intronic
1176429830 21:6568697-6568719 GCTGAGCCCCAAGACTGGAGAGG - Intergenic
1176794956 21:13364705-13364727 GCTGAACCACAACTTCGGGAGGG + Intergenic
1177651601 21:23966601-23966623 AATGACCCCCAACCCTGGGATGG - Intergenic
1177856243 21:26403800-26403822 CCTGATCAGCAACACTGGGAAGG + Intergenic
1179597281 21:42451342-42451364 GATGAACCCCAGTTCTGGGAAGG - Intergenic
1179705224 21:43176159-43176181 GCTGAGCCCCAAGACTGGAAAGG - Intergenic
1180697807 22:17764382-17764404 GCTGTGCCCCTACACTGAGATGG + Intronic
1181165550 22:20981142-20981164 GCTGAAGGCAAGCACTGGGAGGG - Exonic
1182064185 22:27418724-27418746 TCTGAATCCCAGCACTGGGTTGG - Intergenic
1183350408 22:37331659-37331681 CCCCTACCCCAACACTGGGAGGG + Intergenic
1184369800 22:44075089-44075111 CCTCCACCCCCACACTGGGAGGG - Intronic
1184836076 22:47021816-47021838 CCTGAACCCCAGCACTGGGGCGG - Intronic
956271059 3:67447276-67447298 GTTGAACCCCAACAATGAGAGGG + Intronic
959847097 3:111046033-111046055 CCTGAACCCCATCACTTGCAAGG - Intergenic
960691697 3:120352805-120352827 GATGAACCCCATCACTGTGGGGG - Intergenic
962900741 3:139759291-139759313 GCTGAACCCCAAAGCAGGGAGGG + Intergenic
972918067 4:43904730-43904752 ACTGAACCCCACCACATGGAAGG + Intergenic
977495587 4:97771387-97771409 TCTGAACCCCAACCTTAGGAAGG - Intronic
978333244 4:107638545-107638567 TCTGAGCCCCCACTCTGGGAGGG - Intronic
982847623 4:160273177-160273199 GCAGAACCCCCACATTGGTAGGG + Intergenic
987029191 5:13960299-13960321 AGTGAACCCCAACACTGGAGGGG + Intergenic
990950211 5:61291231-61291253 AGTGAACCCCAGCACTTGGATGG - Intergenic
992070743 5:73146390-73146412 GCTGAATTCCAACACAGAGAGGG + Intergenic
994039513 5:95243020-95243042 GATGAATCCCAGCACTAGGAGGG + Intronic
995059279 5:107796126-107796148 GCAGAAGCCCAAAGCTGGGAGGG + Intergenic
997603081 5:135153806-135153828 GCTCAACTTCAACACTAGGACGG - Intronic
998416405 5:141949426-141949448 GCTGGACCCCAGCACAGGTAGGG - Exonic
998492533 5:142559521-142559543 TCTGAGCCCCAACAATGGAATGG + Intergenic
1002112941 5:176932577-176932599 GCCGAATCCTAATACTGGGAGGG + Intronic
1013078095 6:106788885-106788907 GCAGAGCCCCAACATGGGGATGG - Intergenic
1014879739 6:126708906-126708928 GCATAACCCAAACACTGGCAAGG - Intergenic
1016990811 6:149926323-149926345 GCTGATCCCAAACACAGTGAGGG - Intergenic
1017007543 6:150038464-150038486 GCTGATCCCAAACACAGTGAGGG - Intergenic
1019055766 6:169222247-169222269 GGTGAACTCCACCACGGGGACGG - Exonic
1020003801 7:4771095-4771117 GCTGCACCCCAGCACCGGGAGGG + Exonic
1021839811 7:24713458-24713480 CCTGAACCCCGTCACAGGGAAGG + Intronic
1023066408 7:36381837-36381859 CCTGAACCCCAGCATTTGGAAGG + Intronic
1023250178 7:38250670-38250692 GCTGCATCCCAAAACTTGGAGGG - Intergenic
1023251487 7:38266771-38266793 GCTGCATCCCAAAACTTGGAGGG - Intergenic
1023451187 7:40287053-40287075 GCTGAGGTGCAACACTGGGAGGG + Intronic
1027735312 7:81925273-81925295 GCTGAACTCTAGCACGGGGACGG - Intergenic
1029005174 7:97201799-97201821 TCTGAATCCCAACCTTGGGAAGG - Intergenic
1029521267 7:101064179-101064201 GGTGAACCGCATAACTGGGAAGG - Intergenic
1032890337 7:136188170-136188192 CCTGAACCCCACTATTGGGATGG - Intergenic
1033358984 7:140624425-140624447 CCTCAACACCAACACAGGGAGGG + Intronic
1035262719 7:157671934-157671956 GCTGTACCCCAAGAAGGGGACGG + Intronic
1036773298 8:11593239-11593261 CCTGAATCCCAACACTGACAGGG + Intergenic
1040800024 8:51330102-51330124 GATGCCCCCCTACACTGGGAGGG + Intronic
1041847859 8:62352229-62352251 GCTGAAGCTCAGCAATGGGAAGG - Intronic
1046362277 8:113176730-113176752 GGGGAACAACAACACTGGGAGGG + Intronic
1046631884 8:116629685-116629707 GCTGAAGCCCCATGCTGGGAAGG - Intergenic
1052269807 9:26615716-26615738 ACTGTGACCCAACACTGGGAGGG - Intergenic
1052665572 9:31491016-31491038 TCTGAACCCCAACATTGTCATGG + Intergenic
1052973818 9:34397865-34397887 GCTCAGCCCCATCCCTGGGAAGG + Intergenic
1052977203 9:34420126-34420148 ACTGAACCCCAACAAGGGGGAGG + Intronic
1053887270 9:42653487-42653509 GCTGAACCACAACTTCGGGAGGG - Intergenic
1054226291 9:62460938-62460960 GCTGAACCACAACTTCGGGAGGG - Intergenic
1055569829 9:77605356-77605378 CCTGAACCCCATCACCGGGGTGG - Intronic
1057374813 9:94511143-94511165 ACTGAAGCCCCACCCTGGGAAGG - Intergenic
1058646349 9:107134901-107134923 GCTGCACCCCAACCCTCTGAAGG + Intergenic
1060281554 9:122218973-122218995 CCGGGACCCCAACTCTGGGAAGG - Intronic
1060502591 9:124173300-124173322 GCTGAATCCCAACAGAGGGAGGG - Intergenic
1062233886 9:135498933-135498955 GCTGATCCCCAGCCCTGGCAGGG + Intronic
1062275762 9:135729871-135729893 GCCCAACCCCACCACTGGGCAGG + Intronic
1187858654 X:23660906-23660928 GAAGGACCCCAACACAGGGATGG + Intergenic
1196456084 X:115892677-115892699 GTAGAACTCCAGCACTGGGAAGG + Intergenic