ID: 1162962367

View in Genome Browser
Species Human (GRCh38)
Location 19:14135884-14135906
Sequence CAGCCACCGTGGTTTCCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 5, 3: 20, 4: 202}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162962367_1162962374 14 Left 1162962367 19:14135884-14135906 CCACAGGGAAACCACGGTGGCTG 0: 1
1: 0
2: 5
3: 20
4: 202
Right 1162962374 19:14135921-14135943 TTAAGAAATGGAGGCCGAGAAGG 0: 1
1: 0
2: 4
3: 25
4: 337
1162962367_1162962369 -10 Left 1162962367 19:14135884-14135906 CCACAGGGAAACCACGGTGGCTG 0: 1
1: 0
2: 5
3: 20
4: 202
Right 1162962369 19:14135897-14135919 ACGGTGGCTGAAGATCTCCGTGG 0: 1
1: 0
2: 0
3: 1
4: 39
1162962367_1162962370 -9 Left 1162962367 19:14135884-14135906 CCACAGGGAAACCACGGTGGCTG 0: 1
1: 0
2: 5
3: 20
4: 202
Right 1162962370 19:14135898-14135920 CGGTGGCTGAAGATCTCCGTGGG 0: 1
1: 0
2: 1
3: 5
4: 56
1162962367_1162962371 2 Left 1162962367 19:14135884-14135906 CCACAGGGAAACCACGGTGGCTG 0: 1
1: 0
2: 5
3: 20
4: 202
Right 1162962371 19:14135909-14135931 GATCTCCGTGGGTTAAGAAATGG 0: 1
1: 0
2: 0
3: 3
4: 70
1162962367_1162962372 5 Left 1162962367 19:14135884-14135906 CCACAGGGAAACCACGGTGGCTG 0: 1
1: 0
2: 5
3: 20
4: 202
Right 1162962372 19:14135912-14135934 CTCCGTGGGTTAAGAAATGGAGG 0: 1
1: 0
2: 0
3: 5
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162962367 Original CRISPR CAGCCACCGTGGTTTCCCTG TGG (reversed) Intronic
900186962 1:1337200-1337222 CACCCAGCGTGGCTTCTCTGCGG + Intronic
900372904 1:2340145-2340167 CAGCCTCCGAGGTCTCCCGGAGG - Intronic
900996031 1:6124175-6124197 CAGCCCCCCTGGCTGCCCTGAGG - Intronic
900999786 1:6143190-6143212 CAGGCACGGTGGTGTGCCTGTGG - Intronic
901599063 1:10408212-10408234 AGGCCACCGTGGTCTCCCAGGGG + Intronic
901811278 1:11768009-11768031 CAGCCACTGGGCTGTCCCTGGGG + Intronic
902218187 1:14947819-14947841 CAGCCACTGGGGTTCACCTGAGG - Intronic
903070976 1:20726883-20726905 CGGCCCCCGTGCTTCCCCTGGGG - Intronic
903837594 1:26215560-26215582 CAGCCATAGTTGTTGCCCTGTGG - Intergenic
904861232 1:33539727-33539749 CAGCCACCTTGCTTTTCCTCTGG - Intronic
905025183 1:34844934-34844956 CAGCCACCCTGCTTTTCCTGTGG - Intronic
905971988 1:42148832-42148854 CAGCCACCCTAGCTTCCTTGAGG - Intergenic
906329751 1:44875491-44875513 AACCCACTGTGATTTCCCTGGGG + Intronic
907093921 1:51757457-51757479 CAGCCAACATGGTTTTCCTTTGG - Intronic
910430393 1:87154350-87154372 CACCCAGCGTGGTGTCTCTGTGG - Intronic
910874688 1:91867445-91867467 CAGCAGCCTTGGTTTCCTTGGGG + Intronic
912730112 1:112094774-112094796 CAGACACAGTGGTATCACTGAGG + Intergenic
917338165 1:173946806-173946828 CAGCCACCGTGGGTTCCATATGG + Exonic
917523536 1:175767638-175767660 CACCCACCGGGGGCTCCCTGAGG + Intergenic
919861675 1:201742829-201742851 CAGCAAGTGTGGTTTGCCTGCGG - Intronic
920854450 1:209651714-209651736 AAGCCACCGTGGGGTCCCAGAGG + Intronic
921885289 1:220299038-220299060 CAGCCATCGTGGTAGCCCTGAGG - Intergenic
922518318 1:226224172-226224194 CAGGCACGGTGCTTCCCCTGAGG + Intronic
922757868 1:228106437-228106459 CAGTCACCTTGGTGCCCCTGAGG + Intergenic
923174035 1:231445897-231445919 GAGCCACCATGCTTTGCCTGTGG - Intergenic
1065837117 10:29668716-29668738 CACCCACCTTGGCCTCCCTGAGG + Intronic
1067105918 10:43366307-43366329 TTGCCATCGTGGTTTCTCTGAGG - Intergenic
1068733976 10:60391205-60391227 TGACCAGCGTGGTTTCCCTGTGG - Intronic
1069717224 10:70529123-70529145 TAGCCACAGGGGTTTTCCTGCGG + Intronic
1073330914 10:102669391-102669413 CAGCCCCCTTGGATTCCCTTTGG - Intergenic
1073740939 10:106406181-106406203 CAGCCACACTGGCTTTCCTGTGG - Intergenic
1074912243 10:117921831-117921853 CAGGCACCCTGGTTTGCTTGCGG + Intergenic
1075473463 10:122711865-122711887 CACCCACCGTGGTCTCCCTGAGG + Intergenic
1075679971 10:124324755-124324777 CAGCCTCCTTGGCATCCCTGAGG - Intergenic
1075707682 10:124511582-124511604 CATCCGCCGTGGCTTCTCTGAGG + Intronic
1076048496 10:127313714-127313736 CCGCCTCCCTGGTTTCCCTTTGG + Intronic
1076175276 10:128363387-128363409 CTGCCTCTGTGCTTTCCCTGTGG - Intergenic
1077111451 11:863942-863964 CAGCCACGCTGGCTGCCCTGAGG + Intronic
1077219362 11:1408567-1408589 CAGCCACAGGGGTGTCCTTGAGG - Intronic
1078519505 11:12051953-12051975 CTCCCACCGTGGTTTCCCGAAGG + Intergenic
1079129946 11:17741501-17741523 AAGCCACCATGGTTCCCCTCAGG + Intronic
1080411897 11:32033047-32033069 CAGCCTTCCTGGTTTTCCTGAGG - Intronic
1081703518 11:45166524-45166546 CAGGCCCCCTGGTGTCCCTGGGG - Intronic
1083152314 11:60799583-60799605 CAGCCACCATGGCTTCCTTGAGG + Intronic
1084001174 11:66296085-66296107 CAGCCAGGTTGGCTTCCCTGGGG + Exonic
1084309865 11:68310842-68310864 CAGCCACAGTGGTGTCTCTGTGG - Intergenic
1090919150 11:131192943-131192965 CAGCTATTGTGGTTTCCCTGCGG + Intergenic
1091014631 11:132039038-132039060 CAGCCACACTGGTGTCCATGGGG + Intronic
1091223999 11:133946876-133946898 CAGCCTGCGGGGTTTCCCTCTGG - Intronic
1096579828 12:52577695-52577717 CAGCTCCCTTGGGTTCCCTGGGG - Intergenic
1097270782 12:57772621-57772643 GAGCCGTCGTGGTGTCCCTGTGG - Exonic
1097684382 12:62677762-62677784 CAGCCACAGTGGTTTCCGGCTGG + Intronic
1100979664 12:100154512-100154534 CAGTCACCGTGCTGTCCTTGTGG + Intergenic
1102035694 12:109769404-109769426 CAGCCAGCCTGGCTCCCCTGTGG - Exonic
1102796825 12:115696130-115696152 CAGCCACCCTGGTTTCCCTAGGG - Intergenic
1103369038 12:120404314-120404336 CAGCCCCCCAGTTTTCCCTGGGG + Intergenic
1103849880 12:123925824-123925846 CAGCCACTGTGGGTTCCCAATGG - Intronic
1103999882 12:124853798-124853820 CTGCCACCGTTGTTTCCCAGTGG - Intronic
1104004324 12:124881505-124881527 CAGCCACCCTGGCTTCCTTCAGG + Intronic
1104169035 12:126261895-126261917 CTCCCACAGTGGTCTCCCTGTGG - Intergenic
1105931360 13:25055890-25055912 CTGCCACGATGCTTTCCCTGTGG + Intergenic
1106564405 13:30872244-30872266 CAGCCACCGTGGATAACCTAAGG - Intergenic
1106685451 13:32054552-32054574 CAGCCTCAGGGGTTTCTCTGAGG - Intronic
1107380819 13:39855110-39855132 CAGCTTCCAAGGTTTCCCTGGGG - Intergenic
1107963061 13:45575915-45575937 CAGCCACCATCATTTTCCTGGGG - Intronic
1111705277 13:91740784-91740806 CAGGCAGAGTGATTTCCCTGTGG + Intronic
1113602836 13:111582866-111582888 CAGCTGCTGTGCTTTCCCTGGGG + Intergenic
1116388517 14:44362069-44362091 CAGCCACCATAGTTCACCTGTGG - Intergenic
1117825854 14:59702899-59702921 CAGCCACCCTGGCTTCCTTGCGG + Intronic
1120122782 14:80701827-80701849 CAGCCACACTGGCTTCCTTGTGG + Intronic
1121812513 14:96903869-96903891 CAGCCACCCTGGTTGCCCTCAGG + Intronic
1122274420 14:100584297-100584319 CAGCCTCTGTGGTCTGCCTGGGG - Intronic
1123833696 15:24167285-24167307 CAGCCATAGTTGTTTCTCTGGGG + Intergenic
1125122137 15:36173899-36173921 TAGACACCGTGGCTTCTCTGTGG - Intergenic
1129011361 15:72420791-72420813 CAGCCACATTGGCTTCCTTGTGG + Intergenic
1129153666 15:73704255-73704277 CAGCTACCGGGGCTACCCTGAGG + Exonic
1129840164 15:78738756-78738778 CAGTCACCGTGCTGTCCTTGTGG - Intergenic
1130271845 15:82455819-82455841 CAGTCACCGTGCTGTCCTTGTGG + Intergenic
1130464196 15:84183206-84183228 CAGTCACCGTGCTGTCCTTGTGG + Intergenic
1130488491 15:84411613-84411635 CAGTCACCGTGCTGTCCTTGTGG - Intergenic
1130500070 15:84490329-84490351 CAGTCACCGTGCTGTCCTTGTGG - Intergenic
1130586493 15:85187841-85187863 CAGTCACCGTGCTGTCCTTGTGG + Intergenic
1131022110 15:89107657-89107679 CAGCCACAGTGTTTGTCCTGGGG - Intronic
1132796480 16:1726175-1726197 CTGCCACCGTGGTCACCCTCTGG - Intronic
1133025379 16:2986946-2986968 CAGGCATCGTGGTGTGCCTGTGG + Intergenic
1133191404 16:4136204-4136226 CAGCCATCCTGGTTTCGCTTTGG - Intergenic
1133589318 16:7227526-7227548 CAGACGCAGTGGTTTCCCTGGGG + Intronic
1134189898 16:12112951-12112973 CAGGCAGCGTGGTTTCCATCAGG - Intronic
1137714633 16:50591275-50591297 TAGCCACTGTGGCTCCCCTGTGG + Intronic
1137731990 16:50696224-50696246 CAGCCAGCCCGGTTTCTCTGGGG - Intronic
1141229552 16:82152643-82152665 CAGCAACAGTGGTTTTCCTAGGG - Intronic
1141503934 16:84462581-84462603 CAGTCACCGTGGTTTTCCAAGGG + Intronic
1141562223 16:84877191-84877213 CACCCCCAGTGGTTTCTCTGTGG - Intronic
1141784969 16:86193401-86193423 CAGCCACCCTGGCTGCCCTCTGG - Intergenic
1142279014 16:89138086-89138108 CAGCCGCCGGGGATTCCCTGTGG + Intronic
1142295055 16:89215980-89216002 CAGCCACCGTGCCTGCCCTTGGG - Intergenic
1203142892 16_KI270728v1_random:1780492-1780514 CAGCCACGCAGGGTTCCCTGGGG - Intergenic
1143472918 17:7187118-7187140 CGGCAACCGTGCTTCCCCTGAGG + Intergenic
1144282308 17:13738316-13738338 AAGCCACAGTGGTTCACCTGGGG + Intergenic
1146327778 17:31901809-31901831 CAGCCACCGTCCCCTCCCTGTGG + Intergenic
1146617895 17:34371120-34371142 CTGCCTGCGTGGTTTGCCTGAGG + Intergenic
1151484002 17:74387351-74387373 CAGCCACCGCTGTTTCCCTGGGG - Intergenic
1151620653 17:75242959-75242981 GAGCCTCTGGGGTTTCCCTGGGG - Intronic
1152085364 17:78214539-78214561 CAGCCACAGTGGCCTCGCTGGGG - Intronic
1152509342 17:80774807-80774829 CAGCCTCCTTGATTTCTCTGTGG - Intronic
1155774095 18:29737415-29737437 CACCCACCGTGGTGTCAATGTGG + Intergenic
1156940809 18:42765590-42765612 CAGCCTCTCTGCTTTCCCTGGGG - Intronic
1160064294 18:75560847-75560869 TAGCCACCGTGGGCTCCATGTGG + Intergenic
1162218667 19:9157769-9157791 GAGCCACCATGCTTTGCCTGTGG + Intronic
1162925122 19:13927012-13927034 CAGCCACCGTGGCTTCCGAAGGG + Exonic
1162962367 19:14135884-14135906 CAGCCACCGTGGTTTCCCTGTGG - Intronic
1163289704 19:16371250-16371272 CAGCCACCGAGGAAGCCCTGAGG - Intronic
1164612498 19:29642141-29642163 CACCCACGGTGGGTCCCCTGTGG - Intergenic
1166434780 19:42758218-42758240 CAGCCTCCATGGCCTCCCTGGGG + Exonic
1166444652 19:42848239-42848261 CAGCCTCCATGATCTCCCTGGGG + Intronic
1166454544 19:42929658-42929680 CAGCCTCCGTGGCCTCCCTGGGG + Exonic
1166481624 19:43179095-43179117 CAGCCTCCATGGCCTCCCTGGGG + Intronic
1166491205 19:43262076-43262098 CAGCCTCCATGGCCTCCCTGGGG + Exonic
1168137510 19:54361154-54361176 CAGGCACCGTGATCCCCCTGGGG - Exonic
924985714 2:267588-267610 CAGCCACTGCAGCTTCCCTGCGG - Intronic
926412585 2:12620098-12620120 CAGCCAGCCTGGTTCCCATGGGG + Intergenic
933856586 2:86420058-86420080 CAGCCACTCTGGTCTCCATGGGG + Intergenic
934515437 2:94983431-94983453 CCGCCACCGTGGCATCCCTCGGG - Intergenic
935927212 2:108082716-108082738 CTGTCACCGTTATTTCCCTGAGG + Intergenic
936746285 2:115580553-115580575 CAGGCACGCTGGCTTCCCTGTGG + Intronic
938092904 2:128444791-128444813 GACCCATCCTGGTTTCCCTGTGG + Intergenic
945580319 2:211586618-211586640 CAGTCACCATGTGTTCCCTGGGG - Intronic
1168957950 20:1848009-1848031 CAGCCTCTGGGCTTTCCCTGGGG - Intergenic
1169464687 20:5827141-5827163 CAGGCTCTGTGCTTTCCCTGTGG - Intronic
1169547897 20:6669656-6669678 CAAACACCCTGGTTTTCCTGGGG + Intergenic
1171406357 20:24914796-24914818 CAGCCCCCAGGGTTCCCCTGAGG + Intergenic
1172758879 20:37308152-37308174 CAGCCACAGTTCCTTCCCTGGGG - Intronic
1173988713 20:47283124-47283146 AAGTCACCCTAGTTTCCCTGTGG - Intronic
1174116370 20:48229234-48229256 TAGACACTGTGGTGTCCCTGTGG - Intergenic
1179214026 21:39350392-39350414 CAGGCACCGTGAAGTCCCTGGGG + Intergenic
1180147867 21:45931271-45931293 CAGACACAGTTGTTTGCCTGGGG + Intronic
1180743005 22:18066810-18066832 CAGCCACCTTGGTTTCAATGTGG + Intergenic
1181609779 22:24004652-24004674 CAGGCACCCTGGCTTCCTTGTGG - Intergenic
1181811702 22:25407037-25407059 CAGCCACAGTGGCATCCCTGTGG + Intergenic
1182338958 22:29603894-29603916 CGGCCACCATGGTGGCCCTGAGG + Exonic
1182426779 22:30277794-30277816 CAGCCCCCTTGGCTTTCCTGGGG - Intergenic
1182832150 22:33313063-33313085 CACCTCCCCTGGTTTCCCTGAGG + Intronic
1184684066 22:46088099-46088121 CCCCCACCGTGGTTTCCATGGGG - Intronic
1184762942 22:46555334-46555356 CAGACACCCAGGTTTCCCAGAGG - Intergenic
950373869 3:12554225-12554247 CTGCCAGCGCGGGTTCCCTGGGG + Intronic
951345138 3:21538730-21538752 CAACCACAGTTTTTTCCCTGTGG - Intronic
952947170 3:38486169-38486191 CAGCCACTATAGTGTCCCTGTGG + Exonic
956525274 3:70152739-70152761 CAGTCACTGTGGTTCCCCTAAGG - Intergenic
957403124 3:79742438-79742460 CAGCCACCAAGGTTTCCCTGTGG + Intronic
959680843 3:109094624-109094646 CAGCGACTGTGGAGTCCCTGTGG + Intronic
959944382 3:112111680-112111702 CAGCCACCCTGCATTCCCAGGGG - Intronic
960042310 3:113163080-113163102 CAGCCACAGGGGTCTCCCTGTGG - Intergenic
960899920 3:122544081-122544103 TACCCACCATGGATTCCCTGTGG + Intronic
962658452 3:137574091-137574113 CAGCCACCTCCCTTTCCCTGGGG - Intergenic
965532036 3:169780886-169780908 CAACCACTGTGGCTTCCTTGTGG - Intronic
965787474 3:172351358-172351380 CAGCAAACTTGGTGTCCCTGTGG + Intronic
968513300 4:1004617-1004639 CAGCCACCGGGGTTTACCCTTGG - Intergenic
969609758 4:8220369-8220391 CAGCCCCCGTGGCTCCTCTGGGG + Intronic
970159232 4:13172360-13172382 GAGTCACTGTGGTTTGCCTGTGG - Intergenic
970403273 4:15738093-15738115 CAGCCTCTGTAGTTTACCTGAGG - Intronic
972719627 4:41683134-41683156 CCACCACTGTGGTTTCACTGTGG + Intronic
975430448 4:74283983-74284005 CAGCCACCACACTTTCCCTGTGG - Intronic
976129874 4:81872254-81872276 CAGCCACAGAGGTTTCCCGCTGG + Intronic
979061914 4:116073544-116073566 CTGTCTCCCTGGTTTCCCTGAGG + Intergenic
981798633 4:148629742-148629764 GAGCCACTGTGATTTCCCTCAGG + Intergenic
981816936 4:148841401-148841423 CTGCTACCCTGGTCTCCCTGAGG - Intergenic
984822763 4:183897063-183897085 TACCCACTGCGGTTTCCCTGGGG + Intronic
984829380 4:183957776-183957798 AAGGCACCGTGGTTTCCTTCAGG + Intronic
985145704 4:186892312-186892334 CAGACACTGTGGTTCTCCTGCGG + Intergenic
985685622 5:1280151-1280173 CAGCCACCCTCTTTTCTCTGCGG + Exonic
994187860 5:96835824-96835846 AAGCCTCTGTGGTTTCCCAGAGG - Intronic
995909245 5:117165619-117165641 GAGCCACCGTGCCTGCCCTGGGG + Intergenic
996464707 5:123786237-123786259 CAGCCACTCTGGTTTCCTAGAGG + Intergenic
998006056 5:138657762-138657784 CAGCCACCCTCCCTTCCCTGGGG + Intronic
1003345172 6:5260535-5260557 GAGCCACCGTGGTTTGCCGGCGG - Intronic
1003537883 6:6991652-6991674 GAGCCACCGTGCTTGGCCTGTGG - Intergenic
1005856450 6:29866682-29866704 CAGCAACCTGGGTCTCCCTGAGG + Intergenic
1006515753 6:34544716-34544738 CAGCCAGCCTGGCTTCCTTGGGG - Intronic
1007807046 6:44458221-44458243 CAGCCACTGTGGGTTCCCTAGGG + Intergenic
1009455001 6:63846253-63846275 CAGCCACTGTGGTATTCCTCCGG + Intronic
1009935937 6:70234759-70234781 CAGCTTCTGTGGTTTCCCTTTGG - Intronic
1010315715 6:74447894-74447916 GAGCCACCGCGGCTTGCCTGTGG - Intergenic
1010601057 6:77827024-77827046 CAGCTACCTTGGTTGCCCAGTGG - Intronic
1012196238 6:96344416-96344438 CAGCCACCATGGTCTCCAGGTGG + Intergenic
1015534955 6:134258329-134258351 CACCCCCCTTGGCTTCCCTGGGG + Intronic
1017252124 6:152291929-152291951 CAGCCATCGAGGTTGGCCTGAGG + Intronic
1018001441 6:159581999-159582021 CAGACACCGGGGTCTACCTGAGG + Intergenic
1019559693 7:1649866-1649888 CAGCCACCGGTGTCACCCTGCGG - Intergenic
1031753582 7:125610173-125610195 CAGCTTCCAAGGTTTCCCTGGGG + Intergenic
1033128111 7:138722522-138722544 CAGGCACCGTGGCTCACCTGGGG + Intronic
1034223797 7:149466846-149466868 CAGCCACTTTGGATCCCCTGGGG - Intergenic
1034877228 7:154735862-154735884 CAGCCAGCCTGGCTTACCTGTGG - Intronic
1035313441 7:157983941-157983963 CAGCCTCCCTGGAATCCCTGAGG + Intronic
1036419601 8:8583520-8583542 CAGCCACCCTGGGTTCCAGGGGG - Intergenic
1037502631 8:19500219-19500241 CTGCCACCCTTGCTTCCCTGGGG + Intronic
1038431945 8:27507442-27507464 CAGCCATCATGATGTCCCTGGGG + Intronic
1039894043 8:41703889-41703911 CAGCTACCTTGGGTACCCTGGGG - Intronic
1040044877 8:42952508-42952530 CAGCCTCCTTTGTTTCCCAGAGG + Intronic
1040289373 8:46116528-46116550 CAGGCTCCCAGGTTTCCCTGGGG + Intergenic
1040703231 8:50092950-50092972 CAGCCACAGTGCTTTCCTTTTGG - Intronic
1040725494 8:50377961-50377983 CAGCCACAGAGGTTTCCATCCGG - Intronic
1041195891 8:55401073-55401095 CAGATACCATGCTTTCCCTGGGG - Intronic
1045290893 8:100831823-100831845 CAGCCAATGAGGTTTACCTGAGG - Intergenic
1047191217 8:122680854-122680876 CACCCACCCTGGGATCCCTGTGG + Intergenic
1047318206 8:123754163-123754185 CAGCCACAGAGGTTTCCAGGTGG - Intergenic
1048006854 8:130426590-130426612 CAGCCACACTGGCTTCCTTGAGG + Intronic
1049011801 8:139892257-139892279 GAGCCATCGTGGTGTCCCTTGGG - Intronic
1049566970 8:143345334-143345356 CAGCCACCAGGGATGCCCTGTGG - Intronic
1049624175 8:143612718-143612740 CCGGGACCCTGGTTTCCCTGAGG + Exonic
1049716773 8:144096634-144096656 CACCCACCGGGGTGTCACTGCGG + Exonic
1052281794 9:26741625-26741647 CAGCCACAGAGCTTTGCCTGGGG + Intergenic
1052370543 9:27659717-27659739 CCAGCACCGTTGTTTCCCTGGGG - Intergenic
1053411329 9:37917814-37917836 CAGCCAGCGTGGTCTCTATGAGG + Intronic
1056023535 9:82466717-82466739 CAGCCACTGTGGTTCCCCTGGGG + Intergenic
1056981323 9:91314643-91314665 CAGCCTCTGAGGTTTCTCTGTGG - Intronic
1057822510 9:98343318-98343340 CTGCCACAGTGGCTGCCCTGTGG + Intronic
1060527912 9:124330847-124330869 GAGCCACCCTGGGCTCCCTGGGG - Intronic
1060966131 9:127713223-127713245 CTGCCACCTTGCTTTCCCTGGGG - Intronic
1061132444 9:128715474-128715496 CAGCCATCCTGGGTGCCCTGCGG - Intronic
1061521724 9:131122203-131122225 GAGCCAACGTGGGTTCCCTGCGG + Exonic
1062302082 9:135879736-135879758 CAGCCACGATGATTTCCCTCAGG - Intronic
1186455209 X:9705256-9705278 CAACCACCATGGTTACCATGGGG - Intronic
1186507334 X:10103591-10103613 AAGCCACCATGCTTTGCCTGTGG - Intronic
1197828179 X:130612958-130612980 CAGCCACTTTGGTTTCTCTTGGG + Intergenic
1200796810 Y:7348399-7348421 CAGCCACACTGGTTTATCTGAGG + Intergenic
1200949002 Y:8874301-8874323 CATCCATAGTGGTTTCTCTGTGG - Intergenic
1202371022 Y:24195432-24195454 CAGTCACCGTGCTGTCCTTGTGG - Intergenic
1202499762 Y:25474685-25474707 CAGTCACCGTGCTGTCCTTGTGG + Intergenic