ID: 1162962368

View in Genome Browser
Species Human (GRCh38)
Location 19:14135895-14135917
Sequence ACGGAGATCTTCAGCCACCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 55}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162962368_1162962372 -6 Left 1162962368 19:14135895-14135917 CCACGGTGGCTGAAGATCTCCGT 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1162962372 19:14135912-14135934 CTCCGTGGGTTAAGAAATGGAGG 0: 1
1: 0
2: 0
3: 5
4: 83
1162962368_1162962374 3 Left 1162962368 19:14135895-14135917 CCACGGTGGCTGAAGATCTCCGT 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1162962374 19:14135921-14135943 TTAAGAAATGGAGGCCGAGAAGG 0: 1
1: 0
2: 4
3: 25
4: 337
1162962368_1162962377 21 Left 1162962368 19:14135895-14135917 CCACGGTGGCTGAAGATCTCCGT 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1162962377 19:14135939-14135961 GAAGGTCTCCCCATGAAAACGGG 0: 1
1: 0
2: 4
3: 47
4: 911
1162962368_1162962376 20 Left 1162962368 19:14135895-14135917 CCACGGTGGCTGAAGATCTCCGT 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1162962376 19:14135938-14135960 AGAAGGTCTCCCCATGAAAACGG 0: 1
1: 0
2: 0
3: 10
4: 161
1162962368_1162962379 29 Left 1162962368 19:14135895-14135917 CCACGGTGGCTGAAGATCTCCGT 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1162962379 19:14135947-14135969 CCCCATGAAAACGGGTACCTAGG 0: 1
1: 0
2: 0
3: 4
4: 62
1162962368_1162962371 -9 Left 1162962368 19:14135895-14135917 CCACGGTGGCTGAAGATCTCCGT 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1162962371 19:14135909-14135931 GATCTCCGTGGGTTAAGAAATGG 0: 1
1: 0
2: 0
3: 3
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162962368 Original CRISPR ACGGAGATCTTCAGCCACCG TGG (reversed) Intronic
900954248 1:5876938-5876960 TCGGACTTTTTCAGCCACCGGGG - Intronic
905272521 1:36796255-36796277 ACAGAGATCTGCAGCCTCCTGGG + Exonic
913662426 1:121016242-121016264 GCTAACATCTTCAGCCACCGTGG - Intergenic
914013806 1:143799438-143799460 GCTAACATCTTCAGCCACCGTGG - Intergenic
914164018 1:145161759-145161781 GCTAACATCTTCAGCCACCGTGG + Intergenic
914652429 1:149708057-149708079 GCTAACATCTTCAGCCACCGTGG - Intergenic
914804628 1:150983145-150983167 CAGGAGATCCTCAGCCACCTGGG + Exonic
916521870 1:165570569-165570591 ACTGAGATGTTCAGCAACCCAGG + Intergenic
922657786 1:227401344-227401366 AGGGAGATCTTCCGCCCCTGAGG + Intergenic
924715097 1:246566092-246566114 GCGGAGAGCCTCAGCCGCCGAGG + Exonic
1063197633 10:3758429-3758451 GGGGAGATTTTCAGCCACCCGGG - Intergenic
1070165453 10:73894228-73894250 ATGGGGAGCTTCAGCCACCCAGG - Intergenic
1070625712 10:78049669-78049691 AAGGAGGTCTTCACCCACAGTGG + Intronic
1075682420 10:124342271-124342293 ACGGAGATCTCCAGCCCCGCAGG + Intergenic
1097711834 12:62925644-62925666 ATGTAGCTCTTCAGCCACAGGGG - Intronic
1102027257 12:109720516-109720538 ACGGAGATCTGCAGATGCCGAGG - Intronic
1111052751 13:82906693-82906715 AGGCAGGTCTTCAGCCACTGAGG + Intergenic
1118400133 14:65372230-65372252 ATGGAGATCCTCATCCACCTTGG + Intergenic
1119632703 14:76247733-76247755 AAGGAGGTCTTCAGACACCCAGG + Intronic
1126313679 15:47344579-47344601 CCTGAGAACTTCAGCCACCTTGG - Intronic
1137702310 16:50506162-50506184 AGGCAGATCTTCAGCCCCAGAGG - Intergenic
1147627442 17:41909227-41909249 ACATAGCTCTTCAGCCACTGAGG + Intronic
1155938026 18:31774594-31774616 ACGAAGACCTTCAGCCACTGTGG - Intergenic
1157762075 18:50272713-50272735 ACGGAGATTTTCAGCCTGGGTGG - Exonic
1159509119 18:69373455-69373477 AAGGAGATCTTCAGCAATGGAGG + Intergenic
1162506925 19:11090901-11090923 GCCGAGATCTTCAGCCACGGTGG + Intronic
1162962368 19:14135895-14135917 ACGGAGATCTTCAGCCACCGTGG - Intronic
1164961605 19:32435811-32435833 ACAGAGATCCACAGCCACAGAGG - Intronic
1165421160 19:35722647-35722669 AGGGACATCTTCAGGCACCATGG - Exonic
1168629801 19:57947751-57947773 ACGGCGACCTTCAGCCAATGAGG - Intergenic
932194404 2:69770597-69770619 AAGGAGAGCTTCAGTTACCGGGG + Intronic
937801309 2:126083453-126083475 ACTGAGATCTTAAGGCACCTTGG - Intergenic
939993457 2:148898173-148898195 ATGGAGACCTTCAGGCACCTAGG + Intronic
1170580281 20:17693967-17693989 ACGGATTCCTTCAGCCACTGGGG + Intronic
1178347911 21:31847907-31847929 ACTGAGCTCTTCAGCTCCCGGGG - Intergenic
1184498329 22:44856755-44856777 TCGGTGATCTTCAGCCTCCCAGG - Intronic
1185140924 22:49100825-49100847 GCGGAGGCCTTCAGACACCGGGG - Intergenic
954871883 3:53773518-53773540 GCAGAGATCTACAGCCACCTGGG - Intronic
957713380 3:83893296-83893318 GCGGAGAACTTCACACACCGGGG + Intergenic
964386044 3:156149127-156149149 AGGGAGATCTTCGGACACTGGGG - Intronic
978623394 4:110657026-110657048 AGGGAGAACTTCAGCCAGGGTGG + Intergenic
980263020 4:130478674-130478696 ACTGAAATCTTTAGCCACTGAGG - Intergenic
986488890 5:8269341-8269363 ACACAGAGCCTCAGCCACCGTGG - Intergenic
995533775 5:113115654-113115676 ACGGAACTTTTCTGCCACCGAGG - Intronic
995714619 5:115069803-115069825 AAGGAGATCTTCTGCCAATGAGG - Intergenic
999145623 5:149391369-149391391 ATGGAGAACCTCAGCCACGGGGG + Intronic
1005703543 6:28428822-28428844 ACTGATCTCTTCAGCTACCGGGG + Intergenic
1005831517 6:29674855-29674877 ACTTAGATCTTCAGCCAGCCAGG + Intronic
1006075220 6:31528296-31528318 AACTAGATTTTCAGCCACCGTGG - Intergenic
1015102805 6:129501190-129501212 ACTGAGATCTTAAGCTACAGAGG + Intronic
1021313487 7:19118295-19118317 ACGCAAATCCTCAGCCCCCGCGG - Intergenic
1021827454 7:24569806-24569828 ACGGTGATCTTCAGGCAGCCAGG + Intergenic
1022232864 7:28430900-28430922 AGGGAGATCTTCCCCCACTGAGG - Intronic
1026154922 7:67818395-67818417 ATGGAGATGTTCAGCTAGCGGGG + Intergenic
1190326369 X:49209478-49209500 AAGGAGTCCTTCAGCCACCCTGG + Intronic
1193795840 X:85871937-85871959 ATGCAGATCTTCAGCCATCTTGG + Intronic
1196075339 X:111569508-111569530 ACGTGGATCTTCAGACACCTTGG + Intergenic
1201387624 Y:13459766-13459788 AAGGACAACTTCAGCCACTGAGG - Intronic