ID: 1162962371 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:14135909-14135931 |
Sequence | GATCTCCGTGGGTTAAGAAA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1162962367_1162962371 | 2 | Left | 1162962367 | 19:14135884-14135906 | CCACAGGGAAACCACGGTGGCTG | No data | ||
Right | 1162962371 | 19:14135909-14135931 | GATCTCCGTGGGTTAAGAAATGG | No data | ||||
1162962368_1162962371 | -9 | Left | 1162962368 | 19:14135895-14135917 | CCACGGTGGCTGAAGATCTCCGT | No data | ||
Right | 1162962371 | 19:14135909-14135931 | GATCTCCGTGGGTTAAGAAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1162962371 | Original CRISPR | GATCTCCGTGGGTTAAGAAA TGG | Intronic | ||