ID: 1162962371

View in Genome Browser
Species Human (GRCh38)
Location 19:14135909-14135931
Sequence GATCTCCGTGGGTTAAGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162962367_1162962371 2 Left 1162962367 19:14135884-14135906 CCACAGGGAAACCACGGTGGCTG No data
Right 1162962371 19:14135909-14135931 GATCTCCGTGGGTTAAGAAATGG No data
1162962368_1162962371 -9 Left 1162962368 19:14135895-14135917 CCACGGTGGCTGAAGATCTCCGT No data
Right 1162962371 19:14135909-14135931 GATCTCCGTGGGTTAAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162962371 Original CRISPR GATCTCCGTGGGTTAAGAAA TGG Intronic