ID: 1162962371

View in Genome Browser
Species Human (GRCh38)
Location 19:14135909-14135931
Sequence GATCTCCGTGGGTTAAGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 70}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162962367_1162962371 2 Left 1162962367 19:14135884-14135906 CCACAGGGAAACCACGGTGGCTG 0: 1
1: 0
2: 5
3: 20
4: 202
Right 1162962371 19:14135909-14135931 GATCTCCGTGGGTTAAGAAATGG 0: 1
1: 0
2: 0
3: 3
4: 70
1162962368_1162962371 -9 Left 1162962368 19:14135895-14135917 CCACGGTGGCTGAAGATCTCCGT 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1162962371 19:14135909-14135931 GATCTCCGTGGGTTAAGAAATGG 0: 1
1: 0
2: 0
3: 3
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162962371 Original CRISPR GATCTCCGTGGGTTAAGAAA TGG Intronic
900948322 1:5843747-5843769 GAGCTCCATGGGTTGAGAAGTGG + Intergenic
904671267 1:32167580-32167602 GTTCTCTGTTGGATAAGAAAAGG - Intronic
916712171 1:167421339-167421361 AATCTCCTTGGACTAAGAAATGG - Exonic
919763903 1:201114515-201114537 GAGCTCCGTGGGTGAAGCGAGGG - Exonic
1076831497 10:132996583-132996605 GGTCTCCGTGGGGTCAGGAAGGG - Intergenic
1078285445 11:9949522-9949544 TATCTCAGTCAGTTAAGAAAAGG - Intronic
1079527473 11:21407848-21407870 GATCTCAGTTGGCAAAGAAAAGG - Intronic
1080289662 11:30656458-30656480 GATCTTCATGGTTTAGGAAATGG + Intergenic
1082653560 11:55824711-55824733 GATCTCTGTGGGATATCAAATGG - Intergenic
1083270364 11:61569246-61569268 GCCCTCTGTGGGTTGAGAAAAGG - Intronic
1092399547 12:8162643-8162665 GCTCTCCGTGGGAGAAGATAGGG - Intronic
1101473735 12:105023890-105023912 CATCACAGTGGGTTAAAAAATGG + Exonic
1103233253 12:119350128-119350150 GATCTCCCTGGTTCAAGATAGGG - Intronic
1106023570 13:25936879-25936901 GAACTCTGTGGGCTATGAAAGGG + Intronic
1110738902 13:78971148-78971170 AATGTCCGTGGGACAAGAAAGGG - Intergenic
1118162962 14:63309452-63309474 GATCTCGGGGGGTTCAGACAGGG - Intergenic
1118760598 14:68878457-68878479 GATCTCCATGGGTTACAACATGG - Exonic
1134815990 16:17206384-17206406 GCTCTCGATGGGTTTAGAAAAGG + Intronic
1137501686 16:49016504-49016526 CATATCCCTGGGTTAAGGAAGGG - Intergenic
1141090462 16:81126840-81126862 GGTCTCCTGGGGTTAAGGAAAGG - Intergenic
1149161004 17:53692902-53692924 GATCTCTGTGTGTAATGAAAAGG - Intergenic
1150094457 17:62360866-62360888 TATCTCCATAGATTAAGAAAAGG + Intergenic
1150614425 17:66758073-66758095 GATCTCCATGGGGCAAGGAAGGG + Intronic
1152701140 17:81820225-81820247 GAGCTCCTTGTGTTAAGAGATGG - Intergenic
1158037903 18:53056340-53056362 AATCCCCGTGTGTTGAGAAAGGG - Intronic
1158298493 18:56026346-56026368 GATTTAAGTGAGTTAAGAAATGG + Intergenic
1162962371 19:14135909-14135931 GATCTCCGTGGGTTAAGAAATGG + Intronic
927523808 2:23719756-23719778 GCTTTCTGTGGGTTAAGATAAGG - Intergenic
930411323 2:51028875-51028897 GCTATCCTCGGGTTAAGAAATGG - Exonic
933586447 2:84184840-84184862 GATCTCAGTGGGTCTAGGAATGG - Intergenic
940311399 2:152282729-152282751 AAACTGCGTGGGTAAAGAAATGG - Intergenic
944380305 2:199101536-199101558 GATCTCCTTGGGTATATAAAAGG + Intergenic
951787500 3:26438414-26438436 GATCTACGATGGGTAAGAAAAGG + Intergenic
962076781 3:132090480-132090502 GATCCCTGTGGGTGAAGGAAGGG - Intronic
963819293 3:149870156-149870178 GCTTTCTGTGGGTTAAGGAAGGG + Intronic
964085148 3:152808255-152808277 GAACTCTGAGGGTTAGGAAATGG - Intergenic
968562465 4:1291459-1291481 GATCTCTGTTGGTTTAGAGATGG + Intronic
971060867 4:22967680-22967702 AATCTCTGTGGTTTCAGAAAAGG - Intergenic
976969497 4:91088015-91088037 GATCTCACTTGCTTAAGAAATGG + Intronic
986764413 5:10911823-10911845 GATCAGAGTGGGTTAAGAAAAGG + Intergenic
994453378 5:99972895-99972917 AATCCCCAAGGGTTAAGAAAAGG - Intergenic
994725248 5:103427706-103427728 GATCTCCTTGATTTAACAAAAGG + Intergenic
998375760 5:141689525-141689547 GATCTCAGTGGCATGAGAAATGG - Intergenic
1000288862 5:159851077-159851099 GCTCTCCGTTTGTTAACAAAGGG - Intergenic
1002186577 5:177457499-177457521 GATCTCTGTGGCGTTAGAAAGGG + Exonic
1002289589 5:178190648-178190670 GAAATGCTTGGGTTAAGAAAGGG + Intergenic
1003737662 6:8895177-8895199 GATTTCAGTGGTGTAAGAAATGG - Intergenic
1003981528 6:11394811-11394833 TACCTCCTGGGGTTAAGAAAAGG + Intergenic
1004261366 6:14110498-14110520 CAACTCTGTGGGTTAAGAAGGGG + Intergenic
1004493181 6:16137337-16137359 GATCACCGTGGGTTCTGACAAGG + Intronic
1012238067 6:96840534-96840556 GATCTCCGTGTATTAAAAATAGG + Intergenic
1012725894 6:102809355-102809377 GACTTCCGTTGGCTAAGAAAGGG + Intergenic
1020013679 7:4819372-4819394 CGTCTCCGGGGGTTTAGAAATGG - Intronic
1027687753 7:81298526-81298548 GATCTCTGTATTTTAAGAAAAGG + Intergenic
1031444111 7:121829567-121829589 GATCTCTGAGGGGTAAGAAGTGG + Intergenic
1032728685 7:134616162-134616184 GAGCTCCCTGGGTCAAGAAAAGG + Intergenic
1034004432 7:147453432-147453454 GATCTCCTTGAGTCAGGAAATGG + Intronic
1034145088 7:148863212-148863234 GTTCTCTGTGAGTCAAGAAAAGG - Intronic
1036726684 8:11226952-11226974 GACCTGCGTGGATGAAGAAACGG - Intergenic
1039140322 8:34380307-34380329 GGTCAGCGTGGGTTAGGAAAAGG + Intergenic
1040057578 8:43073619-43073641 GGTCTTCGTGGTTTAAGAACAGG + Intronic
1045383824 8:101652114-101652136 GATCTGGGTGGGGTAAGAAAGGG + Intronic
1054787655 9:69224223-69224245 GAATTCAGTGGGTGAAGAAAAGG - Intronic
1056953085 9:91061023-91061045 GATCACTGTGGTTTCAGAAATGG + Intergenic
1060472741 9:123962167-123962189 TAGCTCCGTGAGTTAGGAAATGG + Intergenic
1185866618 X:3629950-3629972 GGTCTCCAGGGGTCAAGAAATGG - Intronic
1188337352 X:28953303-28953325 GATTTCCCTGGGAGAAGAAATGG + Intronic
1188942569 X:36258776-36258798 CATTTCCGTGGATAAAGAAATGG - Intronic
1190110819 X:47587898-47587920 TATCTCCTTTGGTAAAGAAAAGG + Intronic
1190223325 X:48527275-48527297 GGTCTCTGTGGGTAAGGAAAGGG + Exonic
1193566786 X:83086435-83086457 TATCTCTGTGGGTGCAGAAAAGG + Intergenic
1193806562 X:86002637-86002659 GTTCTCCCTTGGTTAGGAAAGGG - Intronic
1196484776 X:116193241-116193263 TATCTCAGTTGGTTAATAAAAGG + Intergenic
1201913356 Y:19156233-19156255 GATCTGCATGAGTTTAGAAAAGG - Intergenic