ID: 1162962373

View in Genome Browser
Species Human (GRCh38)
Location 19:14135914-14135936
Sequence GGCCTCCATTTCTTAACCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 143}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162962373_1162962379 10 Left 1162962373 19:14135914-14135936 CCGTGGGTTAAGAAATGGAGGCC 0: 1
1: 0
2: 1
3: 7
4: 143
Right 1162962379 19:14135947-14135969 CCCCATGAAAACGGGTACCTAGG 0: 1
1: 0
2: 0
3: 4
4: 62
1162962373_1162962377 2 Left 1162962373 19:14135914-14135936 CCGTGGGTTAAGAAATGGAGGCC 0: 1
1: 0
2: 1
3: 7
4: 143
Right 1162962377 19:14135939-14135961 GAAGGTCTCCCCATGAAAACGGG 0: 1
1: 0
2: 4
3: 47
4: 911
1162962373_1162962376 1 Left 1162962373 19:14135914-14135936 CCGTGGGTTAAGAAATGGAGGCC 0: 1
1: 0
2: 1
3: 7
4: 143
Right 1162962376 19:14135938-14135960 AGAAGGTCTCCCCATGAAAACGG 0: 1
1: 0
2: 0
3: 10
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162962373 Original CRISPR GGCCTCCATTTCTTAACCCA CGG (reversed) Intronic
901296239 1:8162773-8162795 GGGCTCCTTTCATTAACCCAGGG + Intergenic
901385894 1:8908991-8909013 GGCCTCCAGTTTTTGAGCCAAGG + Intergenic
902117440 1:14133000-14133022 GCCCCCAATTTCTTAACCCGAGG - Intergenic
902120394 1:14160045-14160067 ATCATCCATTTCTTAACCCCAGG - Intergenic
902268218 1:15284180-15284202 GGCCTCCAATTCTTACCACTTGG - Intronic
903529010 1:24015249-24015271 GGCCTCAGTTTCTTTACCTAGGG - Intergenic
904664818 1:32111976-32111998 GGCCACCCTTCCTTACCCCAAGG + Intronic
904733225 1:32610951-32610973 GGCCTTCATTTTTTAACACGTGG - Intronic
906579619 1:46925634-46925656 GGCCTCCATTTCCCAACCAAGGG - Intergenic
906604103 1:47153253-47153275 GGCCTCCCTTTCCCAACCAAGGG + Intergenic
908022851 1:59916142-59916164 ATCCTCCATTTCTGAACACATGG - Intronic
908414601 1:63900576-63900598 GACCTCAATTTCCTAATCCATGG - Intronic
909107062 1:71424707-71424729 CACCTGCATTTCTTAACACATGG - Intronic
912530554 1:110318013-110318035 GGCCTCCATTCCTTCCCTCAAGG + Intergenic
913183169 1:116342463-116342485 TGCCTGCATTCCTTACCCCATGG - Intergenic
915154202 1:153860904-153860926 GGCCTCCAAGTCATAAACCACGG + Intronic
916426387 1:164685119-164685141 GGCCTCGTTTTCTGAATCCAGGG + Intronic
917429550 1:174951780-174951802 GCTCTCCATTTCTGAGCCCATGG - Intronic
917970610 1:180204334-180204356 GGCCTCCAGTCCTCTACCCATGG + Intergenic
918851606 1:189697265-189697287 GGCCTCCAACTCTCAACCCCAGG - Intergenic
920349785 1:205330124-205330146 GGCCTCCAGCTCTCATCCCATGG + Intergenic
923091060 1:230741638-230741660 GGTCTCCCTTTCTTCATCCAGGG - Intergenic
1062811389 10:469035-469057 GGTCTCCAATTCTGCACCCAGGG - Intronic
1069910005 10:71753128-71753150 GGACTCCATTTCTTTTCACATGG + Intronic
1069971649 10:72175942-72175964 CCCCTCCATTTTGTAACCCATGG + Intronic
1075016021 10:118910494-118910516 GACCTCCATTTCTGGACCCAGGG - Intergenic
1078240924 11:9530261-9530283 GGACTCCATTTATCAACCCAAGG + Intergenic
1078510185 11:11979205-11979227 AGCCTCCATTTCCTGACACAAGG - Intronic
1078864745 11:15287025-15287047 GTCCTGCCTTTCTTAACCAAAGG + Intergenic
1081160846 11:39746086-39746108 GGCCACCATTTTTTCTCCCAAGG - Intergenic
1084468389 11:69340721-69340743 GGCCTCCATTTCCTTATCCGAGG - Intronic
1088482523 11:110308235-110308257 GGTTTCCATTTCTTACCACATGG - Intergenic
1090858725 11:130634303-130634325 GGCCACCACTTCCTAACCCCAGG + Intergenic
1094609086 12:31975958-31975980 GGCTTGCATTTATTAACCCTTGG + Intronic
1099391656 12:82087909-82087931 GTCCTGCATTTCTGACCCCATGG + Intergenic
1099644964 12:85341411-85341433 AGCCTACATTCCTTAACTCATGG + Intergenic
1104617669 12:130284012-130284034 GGGGTCCATTTCTTTTCCCAGGG - Intergenic
1106069483 13:26394618-26394640 GTCCACCATTTCTGAGCCCACGG + Intronic
1107695914 13:42999660-42999682 GGCCTCAAGTGCATAACCCAGGG + Intergenic
1111689525 13:91544979-91545001 GGCCTCAATTCCTTTCCCCAGGG + Intronic
1111896808 13:94152217-94152239 AACCTCCTTTTCTTTACCCAGGG + Intronic
1111935867 13:94556601-94556623 GGCCTCCTTTTCTGAGCCCCCGG - Intergenic
1116175935 14:41470365-41470387 GGCCTCAGTTTCTTGACACATGG - Intergenic
1116739735 14:48739247-48739269 GGCCTGCATTTCTTAGCTTATGG + Intergenic
1120528022 14:85600296-85600318 GCCCTGCATTTCCAAACCCATGG - Intronic
1120931999 14:89858208-89858230 GGCCTCAGTTTCTTACCACATGG - Intronic
1121721385 14:96111252-96111274 GGCCTCCATTTCTGTAGCTATGG + Intergenic
1122914045 14:104848451-104848473 GGACTCCATTTCTTAACTTCTGG + Intergenic
1126096054 15:45091472-45091494 GACCTCGCTTTCTGAACCCAAGG + Intergenic
1126795873 15:52260164-52260186 GTCCTCCTTTTCTAAACCCCGGG - Intronic
1131627332 15:94135178-94135200 GTCCTCCATTGACTAACCCAGGG + Intergenic
1140693564 16:77508849-77508871 GGCCCCCATTCCCAAACCCAGGG + Intergenic
1146466586 17:33091112-33091134 GGGCTCCATCACCTAACCCAGGG + Intronic
1146948352 17:36889198-36889220 AGCCTCCAGTTCTTCACCCTGGG + Intergenic
1151023743 17:70652104-70652126 GGCCTCCAATTCTTAAGAGAAGG + Intergenic
1151263584 17:72936521-72936543 GGCCTCACTTTCTTTATCCAAGG + Intronic
1152630183 17:81407464-81407486 CGCCTCCTGTTCTTAACACATGG + Intronic
1153119123 18:1700171-1700193 GGCCTCCCTTTCCTAGCCAAGGG + Intergenic
1154486250 18:14873655-14873677 GACCTCCATTTCATAAACAAGGG - Intergenic
1156504329 18:37579523-37579545 TGCCTCCATTTCCCAACTCAGGG - Intergenic
1162962373 19:14135914-14135936 GGCCTCCATTTCTTAACCCACGG - Intronic
1163671135 19:18629394-18629416 GGCCTGAGTTTCTTAGCCCAGGG + Intergenic
1163708166 19:18829078-18829100 GGCCTTAATTTCCTAACCCCAGG - Intergenic
1165194020 19:34087171-34087193 GGTCTCTGTTTCTTATCCCATGG + Intergenic
1165613456 19:37177414-37177436 GGCCTCAATTTCTCACCACAAGG - Intronic
1166542710 19:43616019-43616041 GCCCTCCATTTCCTGCCCCAGGG - Intronic
926319522 2:11739205-11739227 GGGCTCCATTTCTTGCCTCATGG - Intronic
926339587 2:11894171-11894193 AGCCTGCATTTCTTAGCCCGTGG + Intergenic
928302498 2:30138536-30138558 TGCCTCCATTCCTTGACCCCTGG + Intergenic
930357421 2:50339334-50339356 GACCTACATTTTTTAAACCAAGG - Intronic
930411322 2:51028870-51028892 GGGCACCATTTCTTAACCCGAGG + Exonic
931956819 2:67436357-67436379 GGCCTCCATTCCTCACCACATGG - Intergenic
932715276 2:74096461-74096483 GACCTGCTTTTCTTAACTCAAGG - Intronic
933473999 2:82766096-82766118 AGCCTCCAGTTCAGAACCCATGG + Intergenic
933708237 2:85307107-85307129 GCCCTCGATTTCATAACACAGGG + Intronic
934576383 2:95404187-95404209 GGCCTCTATTCCTTACCACATGG - Intronic
936389771 2:112060751-112060773 GGCCTCCAACTCTTGACCCCAGG + Intronic
944942168 2:204640463-204640485 GGCTGCCATGTCTTTACCCAGGG + Intronic
948214365 2:236217449-236217471 AGCCTCCATTTCTACACCCAAGG - Intronic
948252737 2:236543581-236543603 GGGCTTCATCTCTTTACCCATGG - Intergenic
1169274826 20:4226654-4226676 TGCCTGCATTTCTTTGCCCAGGG - Intronic
1170596695 20:17811057-17811079 GGCCTCCCTTGCTTGACACAGGG - Intergenic
1171324110 20:24275788-24275810 CGCCTTGATTTCTTAACCTAGGG - Intergenic
1172732082 20:37096449-37096471 AGCCTCCATCTCCTAACTCAAGG - Intergenic
1173539087 20:43838125-43838147 GCCCCCCATTTCCTAACCCGGGG - Intergenic
1175349477 20:58308716-58308738 CGGCTCCATCTCTTATCCCATGG - Intergenic
1176158659 20:63637109-63637131 GGCCTTCATTCCTTACCACATGG - Intergenic
1176795052 21:13365724-13365746 GACCTCCATTTCATAAACAAGGG + Intergenic
1180737321 22:18027070-18027092 GGCATCCCTGGCTTAACCCAGGG - Intergenic
1181965751 22:26655780-26655802 GGCCTTCCTTTCTTTCCCCAGGG + Intergenic
1184697374 22:46147618-46147640 GCCCTCCCTTTCTCAGCCCACGG + Intergenic
949433692 3:4005427-4005449 GGCCTCCATTTTGTAACTCTCGG + Intronic
950579621 3:13853811-13853833 AGCCTCAATTTCCTCACCCACGG - Intronic
951561628 3:23972867-23972889 AGCCTCCATTTCTAAAACCATGG - Intronic
951815933 3:26754825-26754847 TGCCTGCATTTCTTCACTCATGG + Intergenic
953889849 3:46743584-46743606 GGCATGCATTTCTAATCCCAAGG + Intronic
954142254 3:48614170-48614192 GGCCTTCCCTTCTTAGCCCAGGG - Intergenic
957251288 3:77774013-77774035 GGCCTCAGATTCTTAACACATGG - Intergenic
960096891 3:113697460-113697482 GGTCTCCATTTCGTGACCCCTGG - Intergenic
963140216 3:141940713-141940735 GGCCTCCATTCCTTCTCCTACGG - Intergenic
972628778 4:40825552-40825574 GGCCTCCATCTCTGAGGCCAGGG - Intronic
974692477 4:65315338-65315360 GGTCTCCAGTTGTTAGCCCAGGG + Intergenic
975502906 4:75106861-75106883 GGCTTCAAGGTCTTAACCCAGGG - Intergenic
975984973 4:80194010-80194032 GGGCTCCATTTTTGAACCCTGGG + Intronic
980143243 4:128947648-128947670 GGCCTCCTTTTCTTTTCCCAAGG + Intronic
983345139 4:166519934-166519956 GGCCATCATTTCTTACTCCACGG + Intergenic
988382528 5:30516470-30516492 GCCCACCATTTCCAAACCCATGG + Intergenic
990737329 5:58878514-58878536 CGCCTGCATTCCTTGACCCATGG - Intergenic
994656625 5:102602266-102602288 TGCCTCCACTTCTGAACCCCAGG + Intergenic
995019952 5:107354830-107354852 GGTCTTCATTTCTAATCCCAGGG + Intergenic
997675472 5:135709392-135709414 GGAGGCCAGTTCTTAACCCACGG + Intergenic
998743565 5:145230872-145230894 GGCCGCAGTTTCTTAACACATGG + Intergenic
999985621 5:157002378-157002400 TGCCTCAATTTCTTCACCTATGG + Intergenic
1001227013 5:169953468-169953490 GACCTCCATTTCATAAACAAGGG - Intronic
1002330047 5:178434873-178434895 GGCATCCACTTCTGAACCCTCGG + Intronic
1003670521 6:8153760-8153782 AGCCTCCAGATCTTTACCCATGG + Intergenic
1004251081 6:14023659-14023681 GGCCTCCAATTCTTGACCTCAGG + Intergenic
1005242316 6:23845645-23845667 TGCCACAATTTCATAACCCAGGG - Intergenic
1009588131 6:65632829-65632851 GGACTCAATTTCTTCACCTATGG - Intronic
1009797776 6:68494665-68494687 GGCCTCCCTTTCCTAGCCAAGGG + Intergenic
1010441248 6:75897143-75897165 TTCCTCCATTTCTTTTCCCATGG - Intronic
1014069850 6:117168590-117168612 TGCCTCCACTTCCTATCCCAGGG - Intergenic
1014483224 6:121964760-121964782 CCCCTCCATTTCTTGACTCATGG - Intergenic
1019892091 7:3954971-3954993 GGCATCCTTGTCTTACCCCAAGG - Intronic
1020013678 7:4819367-4819389 AGACTCCATTTCTAAACCCCCGG + Intronic
1023714131 7:43026049-43026071 GGCCTCCATTTCTTTGCCCAAGG + Intergenic
1029253180 7:99251246-99251268 AGCCTCCATTTCTTTACCTGGGG - Intergenic
1032356468 7:131215754-131215776 GGCCTCCATGACTGAATCCATGG - Intronic
1032666997 7:134046726-134046748 GGCCTCTTCTTCTGAACCCAGGG + Intronic
1034442871 7:151095890-151095912 GGCCTTCATTTCTTCTCTCAGGG + Intronic
1037709579 8:21345111-21345133 GCCCTCTGTTTCTTAACGCAAGG - Intergenic
1044735914 8:95277606-95277628 GGCCTCCATTTCTAGGCCCTTGG + Intergenic
1052272202 9:26638500-26638522 AGCATCCATTTCTTAGACCATGG + Intergenic
1053650882 9:40168408-40168430 GACCTCCAGTTCTCAACCAAAGG + Intergenic
1053887170 9:42652467-42652489 GACCTCCATTTCATAAACAAGGG - Intergenic
1053901272 9:42797761-42797783 GACCTCCAGTTCTCAACCAAAGG + Intergenic
1054226190 9:62459918-62459940 GACCTCCATTTCATAAACAAGGG - Intergenic
1054533698 9:66207795-66207817 GACCTCCAGTTCTCAACCAAAGG - Intergenic
1059054875 9:110968916-110968938 TGCCTCTATTTCCTTACCCACGG - Intronic
1186177977 X:6945011-6945033 GGCCTCCATGTATTAACTTATGG + Intergenic
1186618501 X:11214520-11214542 GGCCTCCATTCCTTAGGGCAGGG + Intronic
1186795760 X:13044865-13044887 GGCCTCCATTCCTTAGGGCAGGG - Intergenic
1187092727 X:16114246-16114268 TGCCCCCATTTCTGATCCCATGG - Intergenic
1187964298 X:24595496-24595518 GGCCTCCAGTCTTCAACCCAGGG - Intronic
1188515030 X:30976038-30976060 GGCTTCCATGTCTCAATCCAGGG - Intergenic
1188942568 X:36258771-36258793 AGCATCCATTTCTTTATCCACGG + Intronic
1189659241 X:43279246-43279268 GGCCTCCAGTACATCACCCACGG + Intergenic
1190233538 X:48599780-48599802 GGCATCCTTTTCTGAATCCAAGG + Intronic
1192040113 X:67610950-67610972 TGCCTCCATTTTTTCACACAAGG - Intronic
1192972293 X:76245690-76245712 GGTCTCCTTTTCTTAAGCTAAGG + Intergenic
1198062532 X:133061705-133061727 GGCCTCCCTTTCCCAACCAAAGG + Intronic
1199210373 X:145202158-145202180 AGCCTCCATTTCTTTTCCCTAGG + Intergenic