ID: 1162962374

View in Genome Browser
Species Human (GRCh38)
Location 19:14135921-14135943
Sequence TTAAGAAATGGAGGCCGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 337}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162962367_1162962374 14 Left 1162962367 19:14135884-14135906 CCACAGGGAAACCACGGTGGCTG 0: 1
1: 0
2: 5
3: 20
4: 202
Right 1162962374 19:14135921-14135943 TTAAGAAATGGAGGCCGAGAAGG 0: 1
1: 0
2: 4
3: 25
4: 337
1162962368_1162962374 3 Left 1162962368 19:14135895-14135917 CCACGGTGGCTGAAGATCTCCGT 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1162962374 19:14135921-14135943 TTAAGAAATGGAGGCCGAGAAGG 0: 1
1: 0
2: 4
3: 25
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162962374 Original CRISPR TTAAGAAATGGAGGCCGAGA AGG Intronic
900565213 1:3328819-3328841 GTAGGAAATGGAGGCGCAGAGGG - Intronic
900725086 1:4211138-4211160 GAAAGAAATGGAGGCCGAGGCGG + Intergenic
902776802 1:18680085-18680107 TGAGGAAATTGAGGCCCAGAGGG + Intronic
905277352 1:36827086-36827108 TTTAGAGATGGAGGCTGCGAGGG - Intronic
905486365 1:38299759-38299781 TGGAGAAATGGAGGCAGGGAGGG + Intergenic
906140071 1:43529076-43529098 TTAAAATTTGGGGGCCGAGAGGG + Intronic
907936893 1:59049487-59049509 AGAAGAAATGGATGCCGAGAAGG + Intergenic
908056088 1:60288929-60288951 TTAAGAAACAGAGGCCCAGGAGG + Intergenic
908383653 1:63619978-63620000 TGAAGAAATTGAGGCTCAGAAGG + Intronic
908395563 1:63722249-63722271 TTAAGAAATTGAGGCTCAGAAGG - Intergenic
908519433 1:64926825-64926847 TGAAGAAATTGAGGCACAGATGG - Intronic
908743273 1:67350466-67350488 TTTAGAAATGGAGACTCAGAGGG + Intronic
909305220 1:74066380-74066402 ATAAGAAATGGAAGCCCATAGGG - Intronic
909599187 1:77442976-77442998 TTGAAAAATGGAGACAGAGAAGG - Intronic
910287944 1:85575831-85575853 TGAAGAAATGGAGGCATGGAAGG - Intronic
911090749 1:94015190-94015212 TGAGGAAACTGAGGCCGAGATGG + Intronic
912506308 1:110159014-110159036 TGAAGACATGGAAGCTGAGAGGG - Intronic
913464719 1:119128474-119128496 TTAAAAAAGGGAGACAGAGATGG - Intronic
915474232 1:156143588-156143610 TTAAGAGAGGGAGGCTGAGGTGG + Intergenic
915724507 1:158008030-158008052 AAAAGAAAAGGAGGGCGAGAGGG - Intronic
915936199 1:160091660-160091682 TTAAGGGGTGGAGGCCGCGAGGG - Intronic
916556873 1:165900969-165900991 TGAAGAATTGGAGGCCGCGCTGG + Intronic
918561635 1:185875685-185875707 TAAAGTAAAGGAGGCAGAGAAGG - Intronic
918650333 1:186955000-186955022 TGAGGAAATGGAGGAAGAGAAGG + Intronic
918781785 1:188708882-188708904 CTAACAAATGGAGGTGGAGAAGG + Intergenic
918996104 1:191762323-191762345 TTAAAAACTGGAGGCTGAGCAGG + Intergenic
919656601 1:200202863-200202885 CTAGGAAGTGGAGGCCAAGATGG + Intergenic
920068880 1:203288403-203288425 TAAGGAAATGGAGGCTCAGAAGG + Intergenic
921134413 1:212247409-212247431 TTATGAAATGCAGGCCGTGGAGG - Intergenic
921277707 1:213535991-213536013 GAGGGAAATGGAGGCCGAGAAGG + Intergenic
922983966 1:229851570-229851592 TGGAGAAATGCAGGCCCAGAGGG - Intergenic
923409305 1:233691377-233691399 TGAAGAAATGGAGGGTGAGAGGG - Intergenic
1064121713 10:12624796-12624818 TGAAGAAATGGAGGCTTAAAGGG - Intronic
1064494264 10:15891465-15891487 TTAAGATTGGGAGGCCGAGGCGG + Intergenic
1064598469 10:16969946-16969968 GTAAGAAAAGGAGGACAAGATGG - Intronic
1064874794 10:19981351-19981373 TGAAGAAACTGAGGCCCAGAGGG + Intronic
1065568304 10:27040515-27040537 CTGAGAAATGAAGGACGAGAAGG + Intronic
1065942145 10:30574715-30574737 TTAAGAAATTGAGGCCCAGAAGG - Intergenic
1067200736 10:44169772-44169794 TGAAGAAATGGAGGCCTAGAGGG + Intergenic
1067356064 10:45528176-45528198 TTAAGAAATGGAAGAAGACAAGG + Intronic
1069519265 10:69105453-69105475 ATAAGAAATGGATGCTAAGATGG + Intergenic
1069674305 10:70236395-70236417 TGATGAAATGAAGGCTGAGAAGG - Intergenic
1070407621 10:76111096-76111118 CTAAGAACTGGAGGATGAGAAGG - Intronic
1070934597 10:80283508-80283530 CGAGGAAATGGAGGCCTAGAGGG - Intronic
1071025155 10:81104096-81104118 TAAAGAAGTTGAGGCTGAGATGG - Intergenic
1071301036 10:84256385-84256407 CTAAAAAATTGAGGCTGAGATGG + Intronic
1071683200 10:87728417-87728439 TAAAGAAACTGAGGCCCAGAGGG - Intronic
1072004012 10:91224799-91224821 ATATGAAATGGAGGTGGAGAAGG + Intronic
1072175413 10:92916066-92916088 TGACAAAATGGAGGCTGAGAAGG + Intronic
1072264452 10:93713982-93714004 TGGGGACATGGAGGCCGAGAGGG - Intergenic
1072336752 10:94403936-94403958 TTAAAAATTGGAGACGGAGATGG - Intronic
1073152457 10:101321390-101321412 TCAAGAAATGGAAGCTCAGAGGG + Intergenic
1073328537 10:102656547-102656569 TGAAGAAATGGAGGCTGGGGAGG - Intronic
1073912563 10:108363530-108363552 TGAAGAAGTGAAGGCCGAAAGGG + Intergenic
1073917977 10:108428179-108428201 TGAAGAAAATGAGGCTGAGAAGG + Intergenic
1074304660 10:112265641-112265663 TTAAGAAACACAGGCCAAGATGG + Intergenic
1075267309 10:121012620-121012642 TTAAGAATTAGAGGCTGAGATGG - Intergenic
1075317511 10:121464810-121464832 TTAGGAAATAGAGGCTCAGAAGG + Intergenic
1075448252 10:122528855-122528877 TCAAGAAATGGGGCCCCAGAGGG - Intergenic
1077260515 11:1616489-1616511 TTAAGCAATGGAGACTGAGGTGG + Intergenic
1077887772 11:6398631-6398653 TTTAGAAGTTGAGGACGAGAAGG + Intronic
1078145112 11:8717190-8717212 TTAAGGAATGGATGGGGAGAAGG - Intronic
1078347816 11:10566404-10566426 TTAAGAACTGGGGGCCGGGTTGG - Intronic
1078897542 11:15610431-15610453 TTAAAAAACTGAGGCCCAGAGGG + Intergenic
1079328927 11:19518089-19518111 TGAAGAAATTGAAGCCCAGAAGG - Intronic
1080746925 11:35116500-35116522 TAAAGAAACTGAGGCCCAGAGGG - Intergenic
1081801166 11:45860311-45860333 CTAATAAATGGAGGCTAAGAAGG + Intronic
1081878779 11:46429772-46429794 TTAGAAAATGAAAGCCGAGAGGG + Intronic
1083631895 11:64099878-64099900 TCGAGAAATGGAGGGAGAGATGG + Intronic
1084420410 11:69057880-69057902 TGAAGACATGGAGGCCTGGACGG + Intronic
1084438687 11:69158293-69158315 TAAGGAATTGGAGGCAGAGAAGG - Intergenic
1085048989 11:73370126-73370148 TGAGGAAATGGAGGCTCAGAGGG - Intergenic
1085107561 11:73858831-73858853 TGAAGAAACTGAGGCCCAGAGGG + Intronic
1086263552 11:84970608-84970630 TTAGGAAATGGAGGCTTTGAGGG - Intronic
1087241900 11:95789787-95789809 ATGGGAAAGGGAGGCCGAGAAGG - Exonic
1088421498 11:109653153-109653175 TGAAGAAATGGAGGCTTAAAAGG - Intergenic
1089427964 11:118395780-118395802 TTAAGAAATAGAGGCCAGGTGGG + Intronic
1089659441 11:119976349-119976371 TAAGGAAACGGAGGCTGAGAGGG - Intergenic
1089752961 11:120664522-120664544 TGAAGCAATGGAGGCTCAGAGGG + Intronic
1089764042 11:120750068-120750090 TGAAGAAACAGAGGCAGAGAAGG + Intronic
1089773857 11:120822344-120822366 AGAAGAAAGGGAGGCCCAGAAGG + Intronic
1090131211 11:124144332-124144354 CTAAGAAATGGAGGACAACAGGG + Intronic
1091879080 12:3962177-3962199 TGAAGAAAGTAAGGCCGAGAGGG - Intergenic
1095934448 12:47661805-47661827 ATAAGAAAAGGAGGCTCAGAGGG - Exonic
1097405544 12:59185068-59185090 CTAAGAAATTCAGGCTGAGATGG - Intergenic
1097475243 12:60047254-60047276 TTAAGAAAAGGATGCCAATAAGG - Intergenic
1098083193 12:66811952-66811974 TTAAGAGAAAAAGGCCGAGAAGG - Intergenic
1098093657 12:66931186-66931208 TTAAGAACTAGAGGAAGAGAGGG + Intergenic
1098849557 12:75579157-75579179 TAAAGAAATGGAAGGTGAGAGGG + Intergenic
1099679982 12:85814723-85814745 TTAACAAAGGGAGGCCCAGTTGG - Intronic
1100454257 12:94736716-94736738 TTAATAAAAGGAGGCAGAGTTGG + Intergenic
1100574329 12:95875617-95875639 TGAAAAAATGGAGGTAGAGAAGG + Intronic
1100761418 12:97811554-97811576 TTAGGAAATAGAGGAAGAGAGGG + Intergenic
1101698017 12:107144921-107144943 TTAGGAAATGGAGGTCCAAAGGG - Intergenic
1102275822 12:111581232-111581254 TGAAGAAATTGAGACCAAGAGGG - Intronic
1102876602 12:116454039-116454061 TAAAGAAACTGAGGCCAAGAGGG - Intergenic
1102896626 12:116603499-116603521 TGAAGAAACTGAGGCCAAGAAGG + Intergenic
1103325699 12:120118550-120118572 TTAGGAAATAGAGGGGGAGAAGG + Intergenic
1103367829 12:120395856-120395878 TGAAGAAACCGAGGCCCAGAGGG + Intergenic
1104338041 12:127918978-127919000 TTAAAAAATGGAGGCCTTGGAGG - Intergenic
1106081586 13:26505231-26505253 TTAAGAAAAGTAGGCAGACAAGG - Intergenic
1107400483 13:40064327-40064349 TTAGGAAATGGAAGTTGAGAGGG - Intergenic
1108498787 13:51049916-51049938 TAAAGAAATCAAGGCCCAGAGGG - Intergenic
1109272855 13:60273545-60273567 TGAAGAAACTGAGGCCCAGAGGG + Intergenic
1110393353 13:75001603-75001625 GTAAGAAATGGAAGAAGAGAAGG + Intergenic
1111880602 13:93951643-93951665 TGAAGAAACTGAGGCTGAGAGGG - Intronic
1112362988 13:98733772-98733794 TGAAGAAATGGAAGCCCAGAGGG - Intronic
1112772698 13:102808376-102808398 TGAAGAAATTGAGGCTTAGAAGG + Intronic
1112975356 13:105311114-105311136 ATCAGAGCTGGAGGCCGAGAAGG - Intergenic
1113049058 13:106188269-106188291 ATTAGAAATGGATGCCTAGAGGG - Intergenic
1113077629 13:106483330-106483352 TTGAGAAATGGAGGAGGGGATGG + Intergenic
1113674816 13:112199839-112199861 TAGAGAAATTGAGGCCTAGATGG - Intergenic
1116440469 14:44946136-44946158 TTAGGAAATGGAAGCCCAAAAGG + Intronic
1117128933 14:52664936-52664958 TTAAGAATGGGAGGCCAAGGCGG - Intronic
1117395732 14:55307872-55307894 TTCAGAAATGGAGGATGAAATGG + Intronic
1118210847 14:63764509-63764531 TTAAGAGATGGAGGCGGGGGCGG - Intergenic
1118401526 14:65383956-65383978 GTAGGAAATGCAGGCAGAGAGGG + Intergenic
1118680765 14:68239259-68239281 TTGAGAAAGGGAGTCAGAGAAGG - Intronic
1119191914 14:72688781-72688803 AAAAGAAATGGAGGCCGAAGAGG + Intronic
1119883022 14:78116511-78116533 TTCAGAAATGGAGTCCAAAATGG - Intergenic
1120835736 14:89037029-89037051 TTACGAAATGAAGGGAGAGAGGG - Intergenic
1121520731 14:94584600-94584622 TGAAGAAACTGAGGCCCAGAGGG + Intronic
1121995210 14:98597153-98597175 TTAAGAGGTGGAGGCTGATATGG + Intergenic
1122695511 14:103550266-103550288 TGGGGAAAGGGAGGCCGAGAAGG + Intergenic
1124444599 15:29718819-29718841 TTATCAAAAGGTGGCCGAGATGG + Exonic
1127193477 15:56559151-56559173 CTGACAAATGGAGGCAGAGAAGG + Intergenic
1127257556 15:57304966-57304988 TTAAGAAATTGAGGCTTAAAAGG - Intergenic
1127829104 15:62734397-62734419 GTGAGAAAGGGAGGCCCAGAGGG + Intronic
1128108666 15:65062514-65062536 TGGAGAAATGGAGGAAGAGAGGG - Intronic
1128447261 15:67774885-67774907 TTTGGAAATGGAGGCCTACAGGG - Intronic
1129308794 15:74689818-74689840 TTAAGAAATGGAGGCAGGGCCGG - Intronic
1129448793 15:75637804-75637826 TGAGGAAATGGAGGCAGAGATGG - Intergenic
1130144545 15:81263895-81263917 TGAGGAAATGGAAGCCCAGAGGG - Intronic
1131785104 15:95904203-95904225 TGAAAAAATGGAGGCCCAGAGGG + Intergenic
1131835560 15:96387131-96387153 TTAAGAACTGGAGGAGGAGGTGG + Intergenic
1133291656 16:4726443-4726465 TAAAGAAAAGGAAGCTGAGAGGG + Intronic
1137463955 16:48691277-48691299 TTGAGAAATGGAGGAATAGAGGG - Intergenic
1137766455 16:50981222-50981244 CTAAGAAATGGAGGATGAGTAGG + Intergenic
1138448321 16:57078258-57078280 TGAAGAAACTGAGGCTGAGAAGG - Intronic
1139420515 16:66846847-66846869 CAAAGAAATGGAGGCTGAAAGGG + Intronic
1140879026 16:79180684-79180706 TGAAGAAATGGAGGGAGGGAGGG - Intronic
1141267783 16:82512570-82512592 TGGGGAAATGGAGGCCCAGAGGG - Intergenic
1141747951 16:85938605-85938627 TGAACAAGTGGAGGCCCAGAGGG - Intergenic
1141889809 16:86919045-86919067 TTCAGAAAAGGAGGCTGAAAAGG - Intergenic
1142963730 17:3567584-3567606 GGAGGAGATGGAGGCCGAGAGGG - Intronic
1143928998 17:10400737-10400759 GGAAGAAATCGAGGCAGAGAGGG - Exonic
1144996212 17:19270950-19270972 TCAAGAAATGGAGACCGAAAGGG + Intronic
1145387406 17:22425902-22425924 TAAAGAAATTCAGGCCCAGATGG - Intergenic
1148076690 17:44941081-44941103 TGAAGAAATTGAGACAGAGAGGG + Intronic
1148581247 17:48745503-48745525 TTAATAAATGCAGGCCGTGGAGG + Intergenic
1148674208 17:49435563-49435585 ATGAGAAATGGAGGCTCAGATGG - Intronic
1150598387 17:66627432-66627454 TAAAGAAAAGGAGGGAGAGAGGG + Intronic
1151191406 17:72400657-72400679 TTAAGACATGGACTCCTAGAAGG + Intergenic
1151961495 17:77408196-77408218 TCAAGAAATTGAGGCTGGGAGGG - Intronic
1151987462 17:77553255-77553277 TTTAGAAATGGAGGCTGAGCTGG + Intergenic
1152553298 17:81040480-81040502 GGCAGAAAGGGAGGCCGAGAAGG + Intronic
1152715063 17:81895518-81895540 TCAAGAGATGGAGGCCGGCATGG + Intronic
1152715082 17:81895597-81895619 TCAAGAGATGGAGGCCGGCACGG + Intronic
1153540208 18:6145986-6146008 TTAAGACGGGGAGGCAGAGAAGG + Intronic
1153823542 18:8853928-8853950 CTAACAAATGGGGGCAGAGAAGG - Intergenic
1156014765 18:32535276-32535298 TTCAGAAATGGAGGTAGTGATGG + Intergenic
1157035507 18:43968343-43968365 GAAAGAAATGGAGGCTGAAAAGG - Intergenic
1160801768 19:973735-973757 TGACTAAATCGAGGCCGAGAAGG + Exonic
1161682851 19:5688629-5688651 TGGGGAAATGGAGGCTGAGAGGG + Intronic
1161856585 19:6769239-6769261 TGAGGAAATTGAGGCCTAGAGGG + Intergenic
1162962374 19:14135921-14135943 TTAAGAAATGGAGGCCGAGAAGG + Intronic
1163545587 19:17939535-17939557 TGAGGAAATTGAGGCAGAGAAGG + Intronic
1164101096 19:22055055-22055077 CTAAGAAATGGAAGCTGAGTTGG - Intronic
1164909978 19:32001783-32001805 ATGAGAAATGGAGGCCCAGGAGG + Intergenic
1165405641 19:35629255-35629277 GAAGGAAATGGAGGCGGAGATGG + Exonic
1165532667 19:36417541-36417563 TTAAGAAAAGGGGTCCGAGCGGG - Intronic
1166929519 19:46293547-46293569 TTAAGAGATAGAGGCCGGGCCGG + Intergenic
1167224287 19:48226826-48226848 AAAAGAAATCGAGGCCGAGGGGG + Intronic
1167801188 19:51743318-51743340 TGGAGAAATTGAGGCCCAGAAGG - Intergenic
925763762 2:7211374-7211396 GGAAGGAATGAAGGCCGAGACGG - Intergenic
925851897 2:8089947-8089969 TTAAGAAGTGGACGAAGAGATGG - Intergenic
925876738 2:8317648-8317670 TGAAGACAGTGAGGCCGAGAGGG + Intergenic
926002820 2:9347514-9347536 TTAAGAAATGGAAGCACACAGGG + Intronic
926623555 2:15070461-15070483 CTGAGAAATGGAGGCAGATATGG - Intergenic
927360016 2:22222224-22222246 TTAAGAACTGGAGATAGAGAGGG + Intergenic
928346134 2:30498285-30498307 TAAAGAATTGGAGGCAGAGGTGG + Intronic
929054160 2:37861850-37861872 TTAAGCAATGGAGGGAGAGGAGG - Intergenic
929882671 2:45850838-45850860 TGAAGAAATGGAGGATGAGGGGG - Intronic
931836113 2:66099685-66099707 TGAAGAAACTGAGGCCCAGAGGG + Intergenic
933075006 2:77913080-77913102 TTAAGAAATAGATGACAAGATGG + Intergenic
933149295 2:78894694-78894716 TCAATAAAGGGAGGCCGAGGTGG + Intergenic
933885288 2:86714105-86714127 TGAAGAAATTGAGGCACAGAGGG - Intronic
933924888 2:87082578-87082600 TGAAGAAATTGAGGCACAGAGGG + Intergenic
935402071 2:102670474-102670496 TAAATAAATCGAGGCCCAGATGG + Intronic
935416186 2:102821739-102821761 TTTAAAAATGGAGGCTGAGGCGG + Intronic
936037374 2:109123655-109123677 TGAGGAAATTGAGGCAGAGAGGG - Intergenic
936610855 2:114000763-114000785 TGAAGAAATTGAGACTGAGAGGG - Intergenic
937045729 2:118850460-118850482 TGAACAAATGTTGGCCGAGAGGG + Intergenic
938994483 2:136663309-136663331 TAAAAACATGAAGGCCGAGAAGG + Intergenic
940281798 2:151996816-151996838 TAAAGAAAAGGAGGCAGAGATGG + Intronic
941698103 2:168575128-168575150 TCAAGAAATCGAGGCTGAGGAGG - Intronic
942738359 2:179142402-179142424 TTAAGCAAAGAAGGCAGAGAGGG + Intronic
943053755 2:182949393-182949415 TTAGGAAAGTGAGGCCAAGAAGG - Intronic
946013745 2:216587636-216587658 TTAGGAAACTGAGGCCCAGAGGG + Intergenic
946327953 2:218994379-218994401 TGAAGAAGTGGAGGCCCAGAGGG + Intergenic
948077575 2:235177623-235177645 TTAAGAGATGGAGGTGGGGAGGG - Intergenic
948459516 2:238122439-238122461 TGAAGAAATGGAGGCTCAGGGGG + Intronic
949076076 2:242058671-242058693 ATAAGACATGGAGGTCGGGAGGG + Intergenic
1168909450 20:1435492-1435514 TGAAGAAAAGGAGGCCCAGAGGG + Intergenic
1169745772 20:8941112-8941134 TGAAGAAATGGAAACCTAGAAGG + Intronic
1170193592 20:13668046-13668068 TCAAGAGATGGAGGCCAACATGG - Intergenic
1172873778 20:38151952-38151974 TGAAGAAACTGAGGCCAAGAAGG + Intronic
1173723613 20:45281157-45281179 TAAAGAAATTGAGGCTCAGAGGG + Intergenic
1173912408 20:46680066-46680088 ATAGGAAATGGATGCTGAGAGGG - Intronic
1174199210 20:48795266-48795288 TAAGGAAATGGAGGCTCAGAGGG - Intronic
1174994088 20:55546004-55546026 TTAAGAATTAGAGCCCCAGATGG - Intergenic
1175386980 20:58603634-58603656 TAAAGAAACTGAGGCTGAGAAGG - Intergenic
1175912504 20:62411513-62411535 TGCAGAAATTGAGGCTGAGAGGG - Intronic
1177714978 21:24828137-24828159 TTAAAAAATTGAGGCTGAGGCGG + Intergenic
1178531218 21:33377808-33377830 TGAAGAAATGGCGGAAGAGAAGG + Intergenic
1180109508 21:45641615-45641637 TTTAGAAAAGGAGGAGGAGAAGG - Intergenic
1181839804 22:25647129-25647151 TTCAAAAATGGAGGACGAGGAGG + Intronic
1182026554 22:27123708-27123730 TGAAGAAAGGGAGGCAGAAAGGG + Intergenic
1182138467 22:27930471-27930493 TGAAGAAATGAAGGTCCAGAAGG + Intergenic
1182246450 22:28961700-28961722 TTGAGAAATGGAGGTCCAGAGGG + Intronic
1182457149 22:30459111-30459133 TAAGGAAATGGAGGCTCAGAGGG - Intronic
1182918137 22:34054342-34054364 TGAAAAAATGGAGGCCCAGAAGG + Intergenic
1182965013 22:34512806-34512828 AAAAGAAATGGAGGTAGAGAAGG + Intergenic
1184468476 22:44682559-44682581 TGAAGACATGGAGGCCGGCACGG + Intronic
949494965 3:4622622-4622644 TCAAGAGATGGAGGCCAACATGG - Intronic
949725167 3:7035680-7035702 CTAAGACATGGGGGCTGAGAAGG - Intronic
949725182 3:7035809-7035831 CTAAGACATGGGGGCTGAGAAGG - Intronic
949946757 3:9195639-9195661 TTTAGAAATAGAGCCTGAGACGG - Intronic
951002998 3:17585951-17585973 TTAAGAAATGGTGGGGGAGTGGG + Intronic
951600969 3:24374859-24374881 CTAAAAAATGCAGGCAGAGATGG + Intronic
952196686 3:31083086-31083108 TTAAGAAATGGAACCAGGGAAGG + Intergenic
952529773 3:34251397-34251419 TGAAGAAACTGAGGCAGAGAAGG - Intergenic
953071367 3:39523874-39523896 TTAAGAAACTGAGGCACAGATGG - Intronic
953338800 3:42116785-42116807 TAAAGAAATGGAGTGGGAGAGGG + Intronic
955162615 3:56479447-56479469 TTAAGAAATTGAGGCTCAGAGGG - Intergenic
955558173 3:60160197-60160219 TTAAGAAAGGGAGGAAGAGAGGG + Intronic
957402641 3:79736055-79736077 TTAAGTAAATGAGGCAGAGAAGG + Intronic
960142361 3:114163418-114163440 TAAAGAAATGGAGACCTGGAAGG + Intronic
960178598 3:114547125-114547147 GAAAGAAAAGGAGGCCAAGAAGG + Intronic
960243354 3:115371954-115371976 TTAAGAAATGGAAAGAGAGAAGG - Intergenic
960676098 3:120196238-120196260 TGAAGACATGGAGGCTGAGGAGG - Intronic
961129738 3:124454983-124455005 TGAAGAAATGGAGGCACAGAGGG + Intronic
961523888 3:127484336-127484358 TGAGGAAATGGAGGCTCAGAGGG - Intergenic
963898389 3:150710360-150710382 TTAAGAGATGGAGGCCTTTAGGG + Intergenic
964389194 3:156180072-156180094 TGAAGAAATGAAGGCTTAGAAGG + Intronic
965531801 3:169777936-169777958 TTAAGAAATGCAGGCTGTGCTGG + Intronic
965692727 3:171374899-171374921 TTAGGAAATGGAGGCACGGAGGG + Intronic
966030890 3:175346736-175346758 TAAAGAAACTGAGGTCGAGAGGG + Intronic
966069563 3:175859083-175859105 TGAGAAAATGGAGGCAGAGAGGG + Intergenic
967338261 3:188368477-188368499 TGAAGAAATAGAGGGCCAGAAGG + Intronic
968044606 3:195617026-195617048 TGAGGACATGGAGGCTGAGAGGG + Intergenic
970094397 4:12445944-12445966 TTAAGAAATTGAGGCCCAGAGGG - Intergenic
970876282 4:20874179-20874201 TGAGGAAATTGAGGCCCAGAAGG + Intronic
971220087 4:24697324-24697346 TTAAAAATTAAAGGCCGAGAAGG - Intergenic
972805006 4:42520531-42520553 TTAGGAAATGGAGAGCGAGAAGG + Intronic
976316849 4:83667633-83667655 GTAAGAAAAGGTGGCAGAGATGG + Intergenic
979410395 4:120370809-120370831 TAAAGAAATGAAGGCACAGAGGG + Intergenic
981728633 4:147873907-147873929 TGGAGAAATGGAAGGCGAGAGGG + Intronic
983032724 4:162823034-162823056 TGAGGAAATTGAGGCAGAGAAGG - Intergenic
983646610 4:169997777-169997799 TTAATGAAAGGAGGCCGAGCTGG - Intronic
984550717 4:181155640-181155662 ATAAGAAATGGAGGCCAAATAGG - Intergenic
986104593 5:4647831-4647853 TGAAGAAACCGAGGCAGAGAGGG + Intergenic
986124381 5:4871809-4871831 TGAAGAAACGGAGGAAGAGAGGG + Intergenic
986456856 5:7928234-7928256 TAAAGAAATGGAGGCCTAGAGGG - Intergenic
986821896 5:11476430-11476452 TGAGGAAATGGAGGTCCAGATGG + Intronic
991113038 5:62923439-62923461 TTAAGAAATAGAGCCAGACATGG + Intergenic
992198046 5:74358973-74358995 TGAGGAAATGGAGGCACAGAGGG + Intergenic
992456426 5:76920203-76920225 TTAAAAAATGAAGGCTGAGCCGG - Intronic
993228267 5:85198559-85198581 TTAAAAAATGGATGCTGACAAGG - Intergenic
993302908 5:86235551-86235573 TTAACAAAAGGAGGAAGAGAAGG + Intergenic
995766437 5:115624863-115624885 TTAAGAAAAGCAGGGTGAGAGGG + Intronic
996196135 5:120609957-120609979 TTATGAAATGTAGGCAGAGCAGG - Intronic
996318674 5:122189931-122189953 TACTGAAATGGAGGCTGAGAGGG + Intergenic
997439671 5:133900331-133900353 TGAAGAAACTGAGGCTGAGATGG + Intergenic
998321823 5:141239916-141239938 TGGAGAAATGGAGGCTGAAAAGG + Intergenic
999459346 5:151744638-151744660 AGAAGGAATGGAGGCAGAGAAGG - Intronic
999673496 5:153977411-153977433 TGAAGAAATGGAGGCTCATAGGG + Intergenic
999911401 5:156204615-156204637 TGAAGAAAGTGAGGCTGAGAAGG - Intronic
1000023469 5:157338836-157338858 GACAGAAATGGAGGCCCAGAAGG - Intronic
1001121706 5:168986264-168986286 TGATGAAATGGAGGCCAAAAGGG + Intronic
1001748427 5:174109684-174109706 TGAAGACATGGAGGCTCAGAGGG + Intronic
1001800928 5:174543420-174543442 TGAGGAAATGGAGGCTCAGAGGG + Intergenic
1002046620 5:176544972-176544994 TAAAGAAATGGCGGCTCAGAGGG + Intronic
1002067453 5:176659134-176659156 TGAGGAAATGGACTCCGAGAGGG + Intergenic
1002462632 5:179383060-179383082 TTCAGAAATGGATGCCCAAATGG - Intergenic
1003107613 6:3227945-3227967 TGAAGAAAAGGAGGGTGAGAGGG + Intronic
1003309612 6:4957957-4957979 TGAAGAAACTGAGGCCCAGAAGG + Intergenic
1003606229 6:7563650-7563672 TGAAGAAAAGGAGGCTTAGAAGG + Intronic
1003747474 6:9018983-9019005 TTAAGAGATGAAGACAGAGAAGG + Intergenic
1005498411 6:26409154-26409176 TTAAGAAAGGGAGGGTGGGAGGG + Intronic
1006215005 6:32433891-32433913 TTAGGAAATGGAGGCAGAACTGG - Intergenic
1006433897 6:34015937-34015959 TGAAGAAAATGAGGCCCAGAGGG + Intergenic
1006718694 6:36136361-36136383 TGAAGAAACTGAGGCCCAGAAGG + Intronic
1007254340 6:40518118-40518140 TGAAGAAACTGAGGCCCAGAGGG - Intronic
1007637726 6:43309303-43309325 TGAGAAAATGGAGGCAGAGAGGG - Intronic
1009315468 6:62213625-62213647 TAAAGAATGGGAGGCTGAGACGG + Intronic
1009556081 6:65168822-65168844 TTAAAAAATTGAGGAAGAGAGGG - Intronic
1010191228 6:73199128-73199150 TTAAGAAATGGGGGCCAGGTGGG + Intergenic
1010247888 6:73678910-73678932 TTTAGAAAAGGAGGCCATGATGG - Intergenic
1012194567 6:96324596-96324618 CTAAGAAATGGATGACTAGAAGG - Intergenic
1012574485 6:100775448-100775470 CTAATAAATTGTGGCCGAGACGG + Intronic
1015669630 6:135673652-135673674 TCAAGAAATGGAGGGTCAGAAGG + Intergenic
1016523937 6:144977856-144977878 TTAAGAAATGTCTGCCAAGATGG - Intergenic
1016890750 6:149004731-149004753 TTAAGAAATGGAGAACCAGGTGG + Intronic
1017052506 6:150407000-150407022 TGAAGAAATGTAGGCTAAGAGGG + Intergenic
1017137536 6:151161453-151161475 TTAAGACATGGGGGCAGGGAGGG + Intergenic
1017329196 6:153175776-153175798 TTAAGAAAAAGAGGCTCAGAAGG + Intergenic
1021074318 7:16282452-16282474 TCAAGAGATGGAGGAGGAGAAGG + Intronic
1022087848 7:27086711-27086733 TGAAGAAACTGAGGCCCAGAAGG - Intergenic
1022894610 7:34737396-34737418 TAAAGAAATGCAGTGCGAGATGG - Intronic
1023545749 7:41316213-41316235 TGAAGAAAAGGTGGCCCAGAAGG - Intergenic
1030081795 7:105784740-105784762 TGAAGAAATGGAGGTGAAGAGGG + Intronic
1030566657 7:111166160-111166182 TTAAGAAATTGATGCTTAGATGG + Intronic
1030733234 7:113014360-113014382 TGAAGATATGGAGGCTGACATGG + Intergenic
1031837579 7:126696751-126696773 TGAAGAAAAGGAGGCTCAGATGG + Intronic
1034360022 7:150487002-150487024 TTCAGAGATGGAGGCAGGGAGGG + Intergenic
1034596706 7:152202220-152202242 TGAAGAAATAGAGGCCAGGAAGG + Intronic
1036496960 8:9278382-9278404 TGAAGAAATGGAGGCACAGGCGG - Intergenic
1036534362 8:9631840-9631862 CTAAGAAATGGCAGCTGAGATGG + Intronic
1036959450 8:13227982-13228004 TAAAAAAATGGAGGCAGAGTGGG - Intronic
1037340244 8:17836932-17836954 TGAGGAAATTGAGGCCTAGAGGG - Intergenic
1037478601 8:19282372-19282394 TTAAGAAATGGAAGGAGACAAGG - Intergenic
1039376318 8:37037766-37037788 TGAAGAAATGGAGGCTGAAAGGG + Intergenic
1042268404 8:66931849-66931871 TTAAAAAATGCAGGGCGGGAGGG + Intergenic
1044260380 8:90112952-90112974 TTAAAAGATGCAGGCCCAGAAGG - Intergenic
1045196344 8:99934846-99934868 TAAAGAAAAGGAGGCCGGGCTGG + Intergenic
1045281284 8:100751627-100751649 TAAGGAAACTGAGGCCGAGAGGG + Intergenic
1045557499 8:103228790-103228812 TTAAGGACTGGAGGCCAACATGG - Exonic
1046104030 8:109645207-109645229 TTAAGACCTGGAGGCCAAGGAGG - Exonic
1046444295 8:114296256-114296278 AAAAAAAATGGAGGCCAAGAGGG + Intergenic
1047084501 8:121501151-121501173 TAAAGAAATTGAGACCCAGATGG - Intergenic
1047944447 8:129860781-129860803 CTAACTAATGGAGGCAGAGATGG + Intronic
1048324804 8:133430569-133430591 TGAAGAAATGGAGGGTTAGAAGG - Intergenic
1049816700 8:144606591-144606613 TTAAGAGAAGGAGGAGGAGAAGG + Intergenic
1049844451 8:144793142-144793164 GCAAGAAATGGAGGCTGGGAGGG + Intergenic
1050519068 9:6477982-6478004 TTAAAAAATGGAGCAAGAGATGG - Intronic
1050707335 9:8416858-8416880 TAAAGAAATTGAGGCATAGAAGG + Intronic
1051476552 9:17515263-17515285 TCTAGAAATTGAGGCTGAGAAGG - Intergenic
1051872327 9:21752989-21753011 TAGAGAAATGGACGCCAAGATGG - Intergenic
1053319588 9:37083985-37084007 TTAAAAGATGAAGGCTGAGAAGG + Intergenic
1053593413 9:39534703-39534725 TGACTAAATCGAGGCCGAGAAGG - Intergenic
1053851147 9:42289411-42289433 TGACTAAATCGAGGCCGAGAAGG - Intergenic
1054572893 9:66830574-66830596 TGACTAAATCGAGGCCGAGAAGG + Intergenic
1054888802 9:70229585-70229607 CTAAGAAAAGGAGTCAGAGAGGG - Intergenic
1055056180 9:72026484-72026506 TGAGGAAATGGAGGCACAGAGGG + Intergenic
1055880365 9:80994268-80994290 AAAAGAAATGCAAGCCGAGATGG - Intergenic
1056379443 9:86043866-86043888 TTGATAAATGTTGGCCGAGAAGG - Intronic
1056668910 9:88606525-88606547 TTGAAAAATGGAGGCTGAGGAGG - Intergenic
1057782933 9:98064648-98064670 TGAAGAAATGGAGGACCAGAGGG + Intronic
1058060317 9:100488703-100488725 TGAAGAAATGGAGGCATAGGTGG + Intronic
1059386098 9:113965653-113965675 GTAAAAAATGGGGGCGGAGAAGG - Intronic
1060277725 9:122194518-122194540 TTGAGACCTGGATGCCGAGAAGG + Intronic
1061036507 9:128117348-128117370 TTAAAAAATAGAGGCCGGGGAGG - Intergenic
1061421577 9:130475621-130475643 TGAAGAAATTGAGGCTGAGCGGG - Intronic
1062157645 9:135062238-135062260 TGAAGAAACTGAGGCAGAGATGG - Intergenic
1186642277 X:11468487-11468509 TTAAGAAAAGAAGGACGTGATGG - Intronic
1187280423 X:17854556-17854578 GAAAGAAATGGAGGCCTGGAAGG - Intronic
1187336392 X:18385655-18385677 TTAAGCAAAGGAGACTGAGATGG - Intergenic
1189175569 X:38953859-38953881 TAAAGAAATGGAGGCTCAGAAGG + Intergenic
1189178074 X:38978148-38978170 TGAAGAAATGGAGGCTTGGAGGG + Intergenic
1189667627 X:43373951-43373973 GGAAGAAATAGAGGCAGAGAGGG + Intergenic
1189795578 X:44642841-44642863 TTAGGAAATGGAGGCACAGAAGG - Intergenic
1192828890 X:74729443-74729465 TGAGGAAATTGAGGCCCAGAAGG + Intergenic
1195341256 X:103908218-103908240 TCAACAAATGGAGGCCAAAAAGG - Intergenic
1195377312 X:104240374-104240396 TTAAGCAATGCAGGACCAGAGGG - Intergenic
1196001869 X:110795482-110795504 TAAAGAAATGCAGGCCGAGTGGG + Intronic
1200875488 Y:8150149-8150171 TTAAAAAATGCATGCCAAGAAGG + Intergenic