ID: 1162962376

View in Genome Browser
Species Human (GRCh38)
Location 19:14135938-14135960
Sequence AGAAGGTCTCCCCATGAAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162962368_1162962376 20 Left 1162962368 19:14135895-14135917 CCACGGTGGCTGAAGATCTCCGT 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1162962376 19:14135938-14135960 AGAAGGTCTCCCCATGAAAACGG 0: 1
1: 0
2: 0
3: 10
4: 161
1162962373_1162962376 1 Left 1162962373 19:14135914-14135936 CCGTGGGTTAAGAAATGGAGGCC 0: 1
1: 0
2: 1
3: 7
4: 143
Right 1162962376 19:14135938-14135960 AGAAGGTCTCCCCATGAAAACGG 0: 1
1: 0
2: 0
3: 10
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162962376 Original CRISPR AGAAGGTCTCCCCATGAAAA CGG Intronic
900492857 1:2961305-2961327 AGGAGGTGTCCCCATCAAGAAGG + Intergenic
901099705 1:6710161-6710183 AGAAGTTCTCCGAAAGAAAAAGG + Intergenic
903107621 1:21097316-21097338 AGTAGGTATCCCTAGGAAAAAGG + Intronic
906457713 1:46011378-46011400 AGAACTTCTCACCATGCAAATGG - Intronic
907090261 1:51717511-51717533 AGAAGGTCTCCACTGGGAAATGG - Intronic
908556948 1:65265754-65265776 GGAAGGGCTCCCCCTGGAAACGG - Intronic
909547432 1:76863296-76863318 GGAAGGTCATCCCATGCAAAGGG - Intergenic
914422425 1:147541653-147541675 AGAATTTCTCCTCATAAAAAAGG + Exonic
920377703 1:205518119-205518141 AGAAGGCCTCCCCAAGAAGCAGG - Intronic
920810155 1:209277793-209277815 AGTAGTTCTTCCCATGACAATGG - Intergenic
921092747 1:211858720-211858742 AGAATGTCTCCCCCTAACAAGGG - Intergenic
921133110 1:212236544-212236566 AGAAGGTTTGCCCTTGTAAATGG - Intergenic
922006244 1:221533446-221533468 AGAAAGGCTTCCCGTGAAAATGG + Intergenic
1064962330 10:20978872-20978894 AGAAAGTCTCCTCATGCACAAGG + Intronic
1065194102 10:23245143-23245165 AGAGGGTATCTACATGAAAAAGG + Intergenic
1065642901 10:27803422-27803444 ACAAGGTCTCCCCTTGATAGGGG - Intergenic
1068696309 10:59971461-59971483 AGAAGGTCCCACTATGAAACTGG - Intergenic
1069774353 10:70918149-70918171 AGAACATCTCCCCATGAAAGAGG - Intergenic
1070534277 10:77363456-77363478 ATAAGCTCTTCCCATAAAAATGG + Intronic
1071119953 10:82265654-82265676 AGATGGTCCAACCATGAAAATGG - Intronic
1072216789 10:93294020-93294042 AGAAAGTCACCCCATGCAGATGG + Intergenic
1072860469 10:98998784-98998806 AAAAGGTCTACCCATGCAAAAGG + Intronic
1076267735 10:129121936-129121958 AAAAGCTGTCCCCATGTAAAAGG - Intergenic
1077522444 11:3044316-3044338 CGATGGGCTCCCCAGGAAAACGG + Intronic
1078408782 11:11094442-11094464 AGAAGGCCTCCCAAAGAGAAAGG - Intergenic
1078550019 11:12273783-12273805 AGAAGGTGTCCCCAGGAGCAGGG + Intergenic
1078638314 11:13073198-13073220 AGAAAGACTCCCCAAGGAAAAGG - Intergenic
1080810065 11:35694956-35694978 AAAAGCTCTCCCCATGCAAGAGG - Intronic
1081740904 11:45439747-45439769 AGAAGCACTCCACAGGAAAAAGG - Intergenic
1081983005 11:47281648-47281670 AGAAGGCCTTCCCAAGAGAAGGG - Exonic
1086809026 11:91281967-91281989 AGAAAGACTCCACTTGAAAATGG + Intergenic
1090453792 11:126829582-126829604 AGTAGGTTTCCCAATGCAAAGGG - Intronic
1091165272 11:133470111-133470133 TGATGGTTTCCCCTTGAAAATGG - Intronic
1091931163 12:4396487-4396509 AGAAGTTCTGCTCATGACAAAGG - Intergenic
1092669044 12:10841588-10841610 AGAAGGTCTACCTTTTAAAAAGG - Intronic
1092760277 12:11804328-11804350 AGAAGGTTTCCAAATGAAACTGG - Intronic
1095182598 12:39163387-39163409 ATAAGATCTCACCATTAAAAAGG + Intergenic
1095963641 12:47851764-47851786 AGAAGGTATGCCAATGAAAATGG - Intronic
1098768141 12:74516073-74516095 AGAAGGTCACACCCTGAGAAAGG + Intergenic
1099425919 12:82522668-82522690 TAAAGGCCTGCCCATGAAAAGGG - Intergenic
1103642602 12:122364059-122364081 AGTCGGTCTCCCCAAGAAACCGG + Exonic
1106237907 13:27880720-27880742 AGGAGGTATGCCCAGGAAAAGGG - Intergenic
1106497381 13:30292635-30292657 AGAAGGGCTCCCCAGGATGAAGG - Intronic
1111455442 13:88477312-88477334 ATAATGTCTTCACATGAAAATGG - Intergenic
1114210548 14:20610221-20610243 GGATGGTTTCCCCAAGAAAAGGG - Intergenic
1115369066 14:32591591-32591613 AGAAAGTCTCCTCAGGAAGAAGG + Intronic
1118236053 14:64006238-64006260 AAAAGCTCTCCCTATCAAAAAGG - Intronic
1121228856 14:92341695-92341717 AAACAGTCTCCCCAGGAAAATGG + Intronic
1121525566 14:94616691-94616713 GGAAGGTTTCCCCTAGAAAACGG + Intronic
1123824899 15:24071291-24071313 AGAAGCTCTCATCATGAAAGTGG - Intergenic
1124386147 15:29209613-29209635 GGAAGGTCTCCTCATGACCATGG - Intronic
1125828295 15:42693804-42693826 TGGAGGCCTCCCCATGAAGAAGG - Exonic
1128677733 15:69624143-69624165 GAAATGTCTCCCCATGGAAATGG - Intergenic
1129007661 15:72387686-72387708 AGAAGGAGTCCCCACTAAAAGGG - Intergenic
1135122069 16:19774800-19774822 AGTATGTCTGTCCATGAAAACGG - Intronic
1137542274 16:49372916-49372938 AGAAGGTGTCACCAGGAAATGGG - Intergenic
1138956319 16:61974716-61974738 AGAATTACTGCCCATGAAAACGG - Intronic
1138957320 16:61986793-61986815 AAATGGTCTCCCCAGGCAAAAGG - Intronic
1140992844 16:80231030-80231052 AGAAGGTATCCCTATGAAAGTGG - Intergenic
1142469981 17:157905-157927 GAAAGGTCTGCCCATGACAATGG + Intronic
1148449339 17:47765243-47765265 AGCAGGTCTACCCTTAAAAATGG - Intergenic
1149971940 17:61227564-61227586 AGAAGGTCTCCCCAGCACACAGG - Intronic
1152790276 17:82274921-82274943 AGCAGGACTCCCCAGGAAGAAGG - Intergenic
1157206402 18:45703756-45703778 TGAATTCCTCCCCATGAAAATGG + Intergenic
1158948870 18:62473878-62473900 AGAAAGTCTTCCCAAGAAAGGGG - Intergenic
1159497146 18:69221417-69221439 AAAAGGTCCTCCCTTGAAAATGG + Intergenic
1160244539 18:77146530-77146552 AGCAGGTCTGCACAGGAAAAGGG - Intergenic
1161226914 19:3151044-3151066 ACAAGGTCCCCCCAGGAACAGGG - Intronic
1162762055 19:12894306-12894328 ACAAGGTTTCCCCTTGAAACAGG + Intronic
1162962376 19:14135938-14135960 AGAAGGTCTCCCCATGAAAACGG + Intronic
1168440304 19:56359987-56360009 GGAAGCACTCCCCTTGAAAACGG + Intronic
927182283 2:20455158-20455180 AGCAGGTATCCCCAGGATAAAGG + Intergenic
929298535 2:40274833-40274855 AGAAGGTCTCTCTCTGTAAATGG + Intronic
930539499 2:52687568-52687590 TGAAGGAATCCCCATGAAACAGG + Intergenic
932032656 2:68206308-68206330 GGAAGGGCTAACCATGAAAAAGG + Intronic
934097530 2:88620294-88620316 AAAAGTTCACCCCATGGAAAGGG - Intronic
934995952 2:98960652-98960674 AGAAGCTCTCCCGAGGAGAAAGG - Intergenic
935354741 2:102187721-102187743 CGGAGGGCTCCCCAGGAAAAAGG + Intronic
935569372 2:104642732-104642754 AGAAGGTTTTCCAAAGAAAATGG + Intergenic
936043543 2:109168501-109168523 AGAAGGTCCCCCTCTGAACAGGG - Intronic
938052349 2:128185901-128185923 AGAAGGACTCCACAGGAAAAAGG + Intronic
939153120 2:138495929-138495951 AGAAGGTCAACCAATGAGAATGG + Intergenic
943620012 2:190138814-190138836 AGAGGGTCTTCTCGTGAAAATGG - Intronic
945701642 2:213177999-213178021 AGCAGTACTCCCCATGAAACAGG + Intergenic
946385371 2:219381254-219381276 AGATGGGCCCCCCATGAACAGGG - Intronic
948439429 2:237977216-237977238 AGAAGGTCTCACAAGGAGAAGGG + Intronic
948701014 2:239760327-239760349 AGAACTGCTCGCCATGAAAACGG + Intergenic
948796065 2:240402588-240402610 AGACAGTCTCCCCAAGAACATGG + Intergenic
1171146916 20:22792655-22792677 AGAATGAAACCCCATGAAAAAGG + Intergenic
1173209549 20:41021536-41021558 AGCATGACTCCCCAAGAAAATGG - Intergenic
1173265704 20:41478105-41478127 AGAAGGGTCCCCAATGAAAATGG + Intronic
1174697814 20:52578345-52578367 AGAAGGTCTCCCCAAGCAAGTGG + Intergenic
1175755820 20:61529093-61529115 TCAATGTCTCACCATGAAAATGG - Intronic
1176845091 21:13870590-13870612 TGAAGTTTTCCCCCTGAAAATGG - Intergenic
1178210501 21:30526045-30526067 TGAAGATCTCACCATGCAAAAGG - Intergenic
1182181399 22:28352713-28352735 CCAAGGTCTGCCCATGAAATAGG + Intronic
1182287310 22:29256007-29256029 AAAATCTCTCCCCATGAAACTGG + Intronic
949415355 3:3807943-3807965 ACATGGCCTCCCCATGAGAAAGG - Intronic
951643377 3:24861009-24861031 AGAAGGTATCCCCATCATTAAGG + Intergenic
954464363 3:50645959-50645981 TGAGGGTCTCCCCATGCCAAGGG + Intronic
956451267 3:69377633-69377655 AGATGGGCTACCCTTGAAAAGGG - Intronic
958814349 3:98900514-98900536 TGAAGCTCTCCACATTAAAAAGG - Intronic
960496674 3:118383758-118383780 TGAATTTCTCCCCAGGAAAAAGG - Intergenic
960941074 3:122935208-122935230 AGAGGGCCTCCCAGTGAAAAAGG - Intronic
961115177 3:124323230-124323252 AGAGGCTCCCCGCATGAAAAAGG - Intronic
971987429 4:33844857-33844879 ACAAAAACTCCCCATGAAAAGGG + Intergenic
978717454 4:111863243-111863265 AGAATGACTGCCCATAAAAAAGG + Intergenic
980032198 4:127844388-127844410 ATAAGGTCTTTCCAGGAAAAGGG - Intergenic
985681394 5:1257683-1257705 ACAAGGTCGTACCATGAAAATGG - Intronic
986076041 5:4339285-4339307 AGAAGGTCATCCCAAGTAAAAGG + Intergenic
986298951 5:6463223-6463245 AGAAGGTTTCACCCTGAAATGGG + Intronic
989763454 5:45049528-45049550 AGAAGGTCTGTCAAGGAAAATGG - Intergenic
995741576 5:115361329-115361351 AGTAGGTCTCCACAGGAATAGGG + Intergenic
996446263 5:123555094-123555116 AGAATGTTTCCCCCTAAAAAGGG - Intronic
1002943076 6:1734620-1734642 AGGAGGCCTCCCCACAAAAATGG - Intronic
1003455803 6:6281047-6281069 CGCATGGCTCCCCATGAAAACGG + Intronic
1003457115 6:6293233-6293255 ACCAGGTCTCCCCCTCAAAACGG - Intronic
1005323560 6:24678690-24678712 AGAATGTCTCCCCCTAACAAGGG + Intronic
1005743964 6:28818927-28818949 AGAAGGTTGCCTCATAAAAATGG + Intergenic
1007417758 6:41702088-41702110 GAAAGGTCTCCCCATGTAGATGG + Intronic
1007717598 6:43866239-43866261 ATGAGGTCTCCCTTTGAAAAAGG - Intergenic
1008889041 6:56464036-56464058 AGAAAGTGTCAGCATGAAAATGG + Intronic
1010980193 6:82363340-82363362 AGAAGCTCTCCCCATCAAAGTGG - Intronic
1012003023 6:93678319-93678341 AGATGGTCCCCCCTTAAAAAAGG + Intergenic
1013463776 6:110399897-110399919 AGAAGGTCTCCCCAGGACTCGGG + Intronic
1016533036 6:145079066-145079088 AGAATGTCTCCCATGGAAAAAGG + Intergenic
1019278513 7:188554-188576 AGATGGGCTCCCCAGGATAAGGG - Intergenic
1020537676 7:9422383-9422405 AGAAGGTCAACCCATCAATATGG - Intergenic
1021550544 7:21866758-21866780 AGAATCACTCCCCATCAAAATGG - Intronic
1022879228 7:34568280-34568302 AGGAGGTATACACATGAAAATGG + Intergenic
1027748930 7:82116414-82116436 AGAAGGCTTCCCTGTGAAAAAGG - Intronic
1029650445 7:101887635-101887657 ATAAGGGCTCCCCATGACACTGG + Intronic
1037706666 8:21321314-21321336 AGAAGTTTTCCCCAAGAAAGGGG + Intergenic
1039026785 8:33267300-33267322 AGGAGGGCTCCCCTTGAATAAGG - Intergenic
1039217710 8:35291250-35291272 AGAAAGTTTACCCATGCAAATGG + Intronic
1039414363 8:37380620-37380642 AGACGGTCTCCCCAAGAACAGGG - Intergenic
1041561433 8:59223829-59223851 AGAATGTCTCCCAATGGACAAGG - Intergenic
1042252755 8:66773405-66773427 AGAAGGTATCCCCTTGGATAAGG - Intronic
1045145766 8:99342235-99342257 CAAATGTCTCACCATGAAAAAGG - Intronic
1045475617 8:102549977-102549999 AGAAGGCTTCCCCAAGAAAGGGG + Intergenic
1045580410 8:103472859-103472881 TGAATGTCTCACCATAAAAACGG + Intergenic
1045769511 8:105719115-105719137 AGAATGTTTCACAATGAAAAAGG - Intronic
1047922457 8:129649682-129649704 AGAAGGTCCCCCTATGGAAGTGG + Intergenic
1048855474 8:138683389-138683411 AGAACACTTCCCCATGAAAAAGG + Intronic
1049769544 8:144373545-144373567 GGAAGGTCTCCCCATGGGCACGG + Intronic
1050098793 9:2096450-2096472 AGAAGGCCCCCCCATCATAATGG + Intronic
1050455445 9:5830615-5830637 AAAAGGTTTGCCCAAGAAAATGG + Intronic
1051638242 9:19200851-19200873 ATAAGGTTTCCCCATGAAGCAGG - Intergenic
1051655601 9:19378861-19378883 ACAAGGTTTCCCCATGAAGCAGG - Exonic
1051982026 9:23031791-23031813 AGAAGGCCTTCCCATGACCAAGG + Intergenic
1052489989 9:29153949-29153971 AGAAGTTCTCTCCACTAAAATGG + Intergenic
1053419208 9:37966524-37966546 AGCAGGTCTGCCCAGGAAAGGGG - Intronic
1056415840 9:86375517-86375539 ACAAGGTTTCCCCATGAAGAAGG - Intergenic
1057248507 9:93480337-93480359 AGCAGGTCTCCCGAGGAATAGGG - Intronic
1058429421 9:104904915-104904937 AGAAGGTCTTCTCGTGAACAAGG + Intronic
1061996096 9:134186888-134186910 AGAAGGACTTCCCATGACACCGG - Intergenic
1186680575 X:11869452-11869474 CAAATGTCTCACCATGAAAAAGG + Intergenic
1186766532 X:12776233-12776255 AGAATGTTGCCCCAGGAAAAGGG + Intergenic
1187043857 X:15625947-15625969 AGAGGGTCTATCCTTGAAAAAGG - Intergenic
1188170836 X:26923372-26923394 AAAAGGTTTTCACATGAAAAAGG - Intergenic
1190040045 X:47063854-47063876 ATAAGGTAGCCCCATGTAAAAGG - Intergenic
1191659642 X:63636330-63636352 TCAAGGTCTATCCATGAAAAGGG + Exonic
1192939873 X:75901228-75901250 AGAATGTCTCTCCATAACAATGG + Intergenic
1193013873 X:76710200-76710222 AGAAGGAATCCCCAGGAAAATGG - Intergenic
1193834842 X:86329430-86329452 AGAAACTCTCTCAATGAAAAGGG - Intronic
1194339448 X:92691470-92691492 TGAATTTCTCCCCATAAAAATGG - Intergenic
1194494447 X:94594502-94594524 AGCAGGTCCCCATATGAAAAAGG + Intergenic
1195239864 X:102940308-102940330 AGAATGTCTCTCCATGACATTGG + Intergenic
1196582603 X:117394366-117394388 TGAAGTTCTCCCCAGAAAAATGG + Intergenic
1200647833 Y:5808251-5808273 TGAATTTCTCCCCATAAAAATGG - Intergenic
1202378044 Y:24255799-24255821 AGAAGGACACCCCAAGAGAAGGG + Intergenic
1202492738 Y:25414322-25414344 AGAAGGACACCCCAAGAGAAGGG - Intergenic