ID: 1162962379

View in Genome Browser
Species Human (GRCh38)
Location 19:14135947-14135969
Sequence CCCCATGAAAACGGGTACCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 62}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162962373_1162962379 10 Left 1162962373 19:14135914-14135936 CCGTGGGTTAAGAAATGGAGGCC 0: 1
1: 0
2: 1
3: 7
4: 143
Right 1162962379 19:14135947-14135969 CCCCATGAAAACGGGTACCTAGG 0: 1
1: 0
2: 0
3: 4
4: 62
1162962368_1162962379 29 Left 1162962368 19:14135895-14135917 CCACGGTGGCTGAAGATCTCCGT 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1162962379 19:14135947-14135969 CCCCATGAAAACGGGTACCTAGG 0: 1
1: 0
2: 0
3: 4
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162962379 Original CRISPR CCCCATGAAAACGGGTACCT AGG Intronic
906536699 1:46554775-46554797 CCCCATGAATAGTGGTGCCTTGG - Intergenic
918628311 1:186684086-186684108 CTCCATGAAAACCAGTACCTGGG + Intergenic
919240545 1:194910358-194910380 CCACATAAAAACGGGTGCCTTGG - Intergenic
920811719 1:209292068-209292090 CCCCATGAAAATGGAGACCAAGG + Intergenic
921731625 1:218585765-218585787 CCCCAACTAAACGGCTACCTCGG + Intergenic
921791601 1:219296568-219296590 CACCCTGAAGACGGGTAGCTGGG + Intergenic
923633449 1:235671237-235671259 CTCCATAAAAACAGGTACTTTGG - Intronic
1070025332 10:72626392-72626414 CAACACGAAAACGGGTACCGAGG - Intergenic
1076066751 10:127454491-127454513 CCCCCTGAAAACTGGTACTTGGG - Intergenic
1077522447 11:3044325-3044347 CCCCAGGAAAACGGGTTACCAGG + Intronic
1079786676 11:24681897-24681919 CCCCATGCTAACAGGTACTTTGG + Intronic
1082652953 11:55817198-55817220 TCTTATGAAAACAGGTACCTGGG + Intergenic
1086690105 11:89780185-89780207 CCTCAGGAAAATGGTTACCTCGG + Intergenic
1086715749 11:90059772-90059794 CCTCAGGAAAATGGTTACCTCGG - Intergenic
1091829078 12:3536447-3536469 CCCCATGGAAAAGAGAACCTTGG + Intronic
1096725740 12:53560606-53560628 CCTCATGAAAACGGGTGCTGTGG - Intronic
1097657096 12:62378992-62379014 CTCCATGAAAGCAGGTACCAGGG - Intronic
1106280256 13:28261155-28261177 CCCCTTAAACACGGGTAGCTGGG - Intronic
1113601927 13:111575638-111575660 CCAGATCAAAACGGGGACCTGGG + Intergenic
1114668867 14:24398586-24398608 TCCCAAGAGAACGGGGACCTCGG - Intergenic
1120960983 14:90124582-90124604 CCACAAGGAAACGGGGACCTCGG + Intronic
1127952371 15:63821862-63821884 CTCCATGAAAGCAGGAACCTTGG - Intronic
1136934214 16:34443890-34443912 GCCCATGAAGACGGGTATATAGG - Intergenic
1136970358 16:34967924-34967946 GCCCATGAAGACGGGTATATAGG + Intergenic
1140581860 16:76240357-76240379 CCCCATGACAAAGTTTACCTAGG + Intergenic
1144610370 17:16706876-16706898 CCCCAGGTAAACAGGTATCTAGG - Intronic
1144928690 17:18837439-18837461 CCCCAGGTAAACAGGTATCTAGG - Intergenic
1145130126 17:20337564-20337586 CCCCAGGTAAACAGGTATCTAGG - Intergenic
1149165867 17:53751102-53751124 CCCCATCAAAACGTGCACCAAGG - Intergenic
1152918390 17:83053021-83053043 CCCCAGGAGAAGGGGTGCCTGGG + Intergenic
1162962379 19:14135947-14135969 CCCCATGAAAACGGGTACCTAGG + Intronic
926720046 2:15953122-15953144 AAACCTGAAAACGGGTACCTTGG + Intergenic
936502134 2:113074762-113074784 CCCCAGGAAAATGGGGACCTTGG - Exonic
937681825 2:124652406-124652428 CCCACTGAAAAAGGCTACCTTGG + Intronic
944492708 2:200274198-200274220 CCCCATAAAAACAGCTATCTTGG + Intergenic
948765291 2:240216289-240216311 ACCCAAGAAAAAGGGTACATAGG + Intergenic
1170919685 20:20665902-20665924 ACCAGTGAAAAAGGGTACCTTGG + Intronic
1175479837 20:59302856-59302878 CCCCATGAAAGCTGCTACCAAGG - Intronic
1176021793 20:62965995-62966017 CTCCATGAAGACGGGCAGCTGGG + Intronic
1179829156 21:43985154-43985176 CCCCATGACACCTGGCACCTGGG - Exonic
1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG + Intronic
952407014 3:33014038-33014060 TCCCATGAAGACACGTACCTTGG + Exonic
957975201 3:87434163-87434185 CCCCATGAAAATGCATACTTTGG + Intergenic
963327904 3:143882017-143882039 ACCCATGAAAACTGGCTCCTGGG - Intergenic
967839710 3:193995381-193995403 ACCCATGGAAAGGGCTACCTTGG - Intergenic
969227774 4:5810374-5810396 CCCCAGGAAAGAGGGGACCTGGG + Exonic
972707762 4:41562083-41562105 ACACCTGAAAAAGGGTACCTTGG - Intronic
976505136 4:85837624-85837646 CCCCATGAGAACTGCAACCTCGG - Intronic
979580643 4:122355000-122355022 CCCCATGAGAACAGTTACCATGG + Intronic
980099841 4:128530719-128530741 CCCCATGAAAAAGGGGACAAAGG - Intergenic
991637683 5:68722732-68722754 CCCCATGAGAACAAGTACATAGG - Intergenic
996034229 5:118740040-118740062 CCCCATGAAACAGGTTTCCTAGG - Intergenic
997895006 5:137708590-137708612 CCCCATGAGGACAGGGACCTTGG - Intronic
1003100918 6:3175981-3176003 CAGCAAGAAAACGGGAACCTCGG + Intergenic
1008053986 6:46927762-46927784 CTCTATGAAAGCTGGTACCTAGG - Intronic
1008734465 6:54526175-54526197 CACCATTAAAATGGGCACCTAGG - Intergenic
1012780261 6:103548422-103548444 CCCCATGAAAATCGGCACCAGGG - Intergenic
1019776433 7:2914277-2914299 CCCAATTAACACGGGTACCCGGG + Intronic
1022637680 7:32152545-32152567 CCCCATGAAAAGGGCTACTCAGG + Intronic
1023937453 7:44749528-44749550 CCCCATCAAAACTGGCAGCTGGG - Intronic
1026224667 7:68429748-68429770 CCCCAGGATAACAGGTTCCTGGG + Intergenic
1031567086 7:123313792-123313814 CCCCATTAAAATGGGCCCCTGGG - Intergenic
1032914528 7:136474576-136474598 CCCCATTAAAAAGTGTACATAGG - Intergenic
1056580814 9:87887153-87887175 TCCCAGGAAAATGGGAACCTTGG - Exonic
1190689952 X:52905501-52905523 ACCCATGAAAAGGAGTACTTTGG + Intronic
1190696031 X:52950291-52950313 ACCCATGAAAAGGAGTACTTTGG - Intronic
1195057932 X:101164631-101164653 CTCCATAAAAACAGGTACTTTGG - Intergenic