ID: 1162962597

View in Genome Browser
Species Human (GRCh38)
Location 19:14136701-14136723
Sequence CGGCGCGCGCCCAGACTCCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 63}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162962586_1162962597 22 Left 1162962586 19:14136656-14136678 CCCTGGCGGCGCGCGCACCCCCT 0: 1
1: 0
2: 1
3: 6
4: 98
Right 1162962597 19:14136701-14136723 CGGCGCGCGCCCAGACTCCTCGG 0: 1
1: 0
2: 0
3: 4
4: 63
1162962587_1162962597 21 Left 1162962587 19:14136657-14136679 CCTGGCGGCGCGCGCACCCCCTC 0: 1
1: 0
2: 0
3: 16
4: 274
Right 1162962597 19:14136701-14136723 CGGCGCGCGCCCAGACTCCTCGG 0: 1
1: 0
2: 0
3: 4
4: 63
1162962589_1162962597 5 Left 1162962589 19:14136673-14136695 CCCCCTCAGCCAGTCCTGGAGCG 0: 1
1: 0
2: 0
3: 15
4: 200
Right 1162962597 19:14136701-14136723 CGGCGCGCGCCCAGACTCCTCGG 0: 1
1: 0
2: 0
3: 4
4: 63
1162962592_1162962597 2 Left 1162962592 19:14136676-14136698 CCTCAGCCAGTCCTGGAGCGCCG 0: 1
1: 0
2: 1
3: 12
4: 167
Right 1162962597 19:14136701-14136723 CGGCGCGCGCCCAGACTCCTCGG 0: 1
1: 0
2: 0
3: 4
4: 63
1162962595_1162962597 -9 Left 1162962595 19:14136687-14136709 CCTGGAGCGCCGATCGGCGCGCG 0: 1
1: 0
2: 0
3: 4
4: 46
Right 1162962597 19:14136701-14136723 CGGCGCGCGCCCAGACTCCTCGG 0: 1
1: 0
2: 0
3: 4
4: 63
1162962590_1162962597 4 Left 1162962590 19:14136674-14136696 CCCCTCAGCCAGTCCTGGAGCGC 0: 1
1: 0
2: 1
3: 11
4: 184
Right 1162962597 19:14136701-14136723 CGGCGCGCGCCCAGACTCCTCGG 0: 1
1: 0
2: 0
3: 4
4: 63
1162962591_1162962597 3 Left 1162962591 19:14136675-14136697 CCCTCAGCCAGTCCTGGAGCGCC 0: 1
1: 0
2: 2
3: 14
4: 190
Right 1162962597 19:14136701-14136723 CGGCGCGCGCCCAGACTCCTCGG 0: 1
1: 0
2: 0
3: 4
4: 63
1162962594_1162962597 -4 Left 1162962594 19:14136682-14136704 CCAGTCCTGGAGCGCCGATCGGC 0: 1
1: 0
2: 0
3: 0
4: 32
Right 1162962597 19:14136701-14136723 CGGCGCGCGCCCAGACTCCTCGG 0: 1
1: 0
2: 0
3: 4
4: 63
1162962585_1162962597 30 Left 1162962585 19:14136648-14136670 CCAACGCTCCCTGGCGGCGCGCG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1162962597 19:14136701-14136723 CGGCGCGCGCCCAGACTCCTCGG 0: 1
1: 0
2: 0
3: 4
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162962597 Original CRISPR CGGCGCGCGCCCAGACTCCT CGG Exonic
911052338 1:93681566-93681588 CGCCGCGCGCCCAGCGTCCTCGG - Intronic
916037202 1:160932792-160932814 CGGCGCGCGCCCGCAATCCCAGG - Intergenic
916794084 1:168149780-168149802 CGGCCTGTGCCCAGCCTCCTGGG - Intergenic
924801424 1:247331722-247331744 CGGCCCGCGCCCGGCCTCCGCGG - Exonic
1062774797 10:135797-135819 CGGCCCGCGCCCACTCGCCTTGG + Intronic
1067100116 10:43328932-43328954 CGGCGCTCGCCCACAATCCCAGG - Intergenic
1074773000 10:116745348-116745370 CAGGGCACGCCCAGACTCCTGGG + Intergenic
1077635790 11:3840816-3840838 CGGCGCCCGCGCCGAGTCCTGGG + Intronic
1084041616 11:66546114-66546136 CGGCGAGCGCTCAGACTCTCAGG + Exonic
1087788728 11:102384764-102384786 CGCCGAGCGGCCAGACTCCAGGG - Intergenic
1089688090 11:120169531-120169553 CGCCGCCCGCACACACTCCTGGG - Intronic
1096143901 12:49264930-49264952 CGCCGCGCGCCCCCACTCCGCGG + Exonic
1103852229 12:123940769-123940791 CTGGGCCCGCCCAGACTTCTGGG + Intronic
1104089449 12:125503026-125503048 AGGTGCGGTCCCAGACTCCTGGG + Intronic
1107836552 13:44416377-44416399 GGGCCTGTGCCCAGACTCCTTGG - Intergenic
1108618555 13:52159348-52159370 CACCGCGCGCCCAGACCCCAAGG + Intronic
1112613168 13:100976068-100976090 CGCCGCACGCCCACACTCCTCGG - Intergenic
1117776335 14:59188579-59188601 GGTCGGGCGCGCAGACTCCTGGG - Intergenic
1122837187 14:104436097-104436119 CTGCGAGCGCCCACTCTCCTGGG - Intergenic
1126850795 15:52795717-52795739 GTGCGCTCGCCCAGAATCCTGGG - Intergenic
1130151215 15:81313169-81313191 CTGCGTGCTCCCAGGCTCCTTGG + Exonic
1132566548 16:626117-626139 CGGCGCCCGCCCACCCACCTCGG - Exonic
1137300494 16:47143871-47143893 CGCCGCGCGTCCGCACTCCTCGG - Exonic
1139817578 16:69687902-69687924 CCGCGCCCGGCCAAACTCCTGGG - Intronic
1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG + Exonic
1146052831 17:29566870-29566892 CGGCGCGCCCCCAGGGTCCCCGG + Exonic
1149335656 17:55633141-55633163 AGGCACGTGCCCAGCCTCCTTGG - Intergenic
1149382400 17:56107172-56107194 CAGCCAGCGCCCAAACTCCTGGG - Intergenic
1152346009 17:79752291-79752313 CGGCAGGAGCCCGGACTCCTTGG + Intergenic
1152654954 17:81515024-81515046 CGGCTCCCGCCCCGACCCCTCGG - Intronic
1160577333 18:79864104-79864126 CGGCGCGCGCCCTGGGACCTCGG + Exonic
1161313455 19:3607220-3607242 CGGGGGTCGCCCAGACTCCAGGG + Intergenic
1162954347 19:14090112-14090134 CGGCGCGCGTCCAGCCGCCCCGG - Exonic
1162962597 19:14136701-14136723 CGGCGCGCGCCCAGACTCCTCGG + Exonic
1166975043 19:46601057-46601079 CGCCGCGCGCCCCGCCTCCCGGG - Intronic
1168642780 19:58040900-58040922 CTGGGCCCGCCCAGAATCCTGGG - Intronic
935059181 2:99593258-99593280 CGGTGCGCTCTCAGAGTCCTTGG + Exonic
949079898 2:242088521-242088543 CCGCGCGCGCCCAGAGTGCCGGG - Intergenic
1175443682 20:59006908-59006930 AGGCGCGCGCTCTGCCTCCTGGG - Intronic
1176237955 20:64063048-64063070 CGCGGCGCGCACAGCCTCCTGGG - Intronic
950906724 3:16545525-16545547 GGGGGCCAGCCCAGACTCCTGGG + Intergenic
953930258 3:47002489-47002511 GGGAGCGCGCCCAGAGTCGTCGG + Exonic
962770836 3:138608973-138608995 CTGCGCCCGCCCGGACGCCTCGG + Intronic
982256770 4:153458506-153458528 CCGCGCCCGGCCTGACTCCTTGG + Intergenic
984813854 4:183819410-183819432 CGGCGCGCGCCCACAATCGCAGG + Intergenic
985593525 5:777463-777485 CGGCGCGCACCCAGACTGAGCGG + Intergenic
990910220 5:60844451-60844473 CGCCGCGCGCCCTGACTCTCGGG + Intergenic
992312206 5:75511864-75511886 CGTCGCTCGCGCAGCCTCCTGGG + Exonic
993654368 5:90559041-90559063 GGGTGCGCGCCCAGCCTCCCTGG - Intronic
1004174552 6:13328465-13328487 CCGCGCGCGCCCAGACGGCCCGG + Intronic
1005559178 6:27020235-27020257 GGGCGCGCGCCCTTAGTCCTGGG - Intergenic
1006014295 6:31067877-31067899 CGGCGCGCGCCTGCAATCCTAGG + Intergenic
1006679513 6:35787173-35787195 CAGGGCGGGCCCAGATTCCTGGG + Intronic
1011075296 6:83431515-83431537 CGGCGGTCGCTCAGACACCTAGG + Intergenic
1019143445 6:169962279-169962301 CGGCGCAGGCCCAGACCCCGGGG - Intergenic
1026787150 7:73308835-73308857 CGGCGCCCGCCCGGACTTCCGGG + Intronic
1029115904 7:98236943-98236965 GGGCCTGCGCCCAGATTCCTCGG - Intronic
1032964078 7:137075243-137075265 CGGTGAGAGTCCAGACTCCTGGG - Intergenic
1038644332 8:29350291-29350313 CCTCGCGCGCCCAGCCGCCTCGG - Exonic
1039493682 8:37965708-37965730 CGGCGCCGGCGGAGACTCCTCGG + Exonic
1044569404 8:93700575-93700597 CAGCGCGCGCCCAGGCGCCTTGG + Exonic
1049714343 8:144082834-144082856 CGGCGCGAGCCCAGGGCCCTCGG - Intronic
1053358241 9:37465118-37465140 CTGCGCGCTCCCCGACGCCTTGG + Intronic
1055501457 9:76906225-76906247 CGGCGCGCCCCGGGGCTCCTGGG - Intergenic
1057766335 9:97922596-97922618 CTGCGCGCGCACATTCTCCTGGG - Intergenic
1062594943 9:137295398-137295420 CGGCGCCCGCCCCGCCTCCCTGG + Intergenic
1185508314 X:644651-644673 CCCCGCGCGCCCGGACTCCCGGG + Exonic
1186274330 X:7923358-7923380 TGGAGGGTGCCCAGACTCCTTGG - Intronic