ID: 1162962689

View in Genome Browser
Species Human (GRCh38)
Location 19:14137150-14137172
Sequence GTCGAGCGCCACCGCGGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 19
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 18}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162962689 Original CRISPR GTCGAGCGCCACCGCGGTGT TGG Intergenic
903867833 1:26411533-26411555 GTCGAGCGCGACCCCGGCGCGGG - Exonic
904009702 1:27382738-27382760 GGCGAGGGCCACCGGAGTGTTGG - Intronic
1075651099 10:124128737-124128759 GTCCACCTCCACCGCGGTGCTGG - Intergenic
1084592581 11:70099092-70099114 GTCGAGAGCCACGGCCGTGGGGG - Intronic
1117974023 14:61280572-61280594 GTCGAGCGGCACCTCGACGTAGG + Exonic
1132837032 16:1959374-1959396 GCCGAGCGCCTACGCGGTGCTGG - Intergenic
1144944055 17:18960828-18960850 GTCCAGGGCCCCCGGGGTGTAGG + Intronic
1145254779 17:21316583-21316605 GCCGAGCGCTCCCTCGGTGTCGG - Intergenic
1145321821 17:21771382-21771404 GCCGAGCGCTCCCTCGGTGTCGG + Intergenic
1162962689 19:14137150-14137172 GTCGAGCGCCACCGCGGTGTTGG + Intergenic
1163625817 19:18388871-18388893 CTGGAGCGACACCCCGGTGTCGG - Exonic
926043803 2:9694864-9694886 GTCGTGGGCCTCCGCGCTGTTGG + Intergenic
929808656 2:45169903-45169925 CGCGACCGCCACCGCGGGGTGGG - Intergenic
943081177 2:183260820-183260842 GTCGAGCGCGACCACGGCGCGGG - Intergenic
1032215378 7:129953021-129953043 GTGGGGCGCCGCCGCGGCGTGGG + Intergenic
1037670978 8:21015075-21015097 GTGCAGCGCCACAGCAGTGTAGG - Intergenic
1042880431 8:73482070-73482092 TTTGAGCGCCTCCGAGGTGTGGG + Intronic
1187390653 X:18884557-18884579 GGCCAGCGCCACCGTGGGGTGGG + Intergenic
1200279362 X:154763256-154763278 GTCCCACGCCACCGCGGGGTGGG - Intronic