ID: 1162966410

View in Genome Browser
Species Human (GRCh38)
Location 19:14158281-14158303
Sequence CTGGGAACACAGAGGGTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 323}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162966397_1162966410 25 Left 1162966397 19:14158233-14158255 CCCATAACTTGTTCTGGAGGTGA 0: 1
1: 0
2: 1
3: 10
4: 233
Right 1162966410 19:14158281-14158303 CTGGGAACACAGAGGGTACAGGG 0: 1
1: 0
2: 3
3: 32
4: 323
1162966398_1162966410 24 Left 1162966398 19:14158234-14158256 CCATAACTTGTTCTGGAGGTGAG 0: 1
1: 0
2: 0
3: 6
4: 91
Right 1162966410 19:14158281-14158303 CTGGGAACACAGAGGGTACAGGG 0: 1
1: 0
2: 3
3: 32
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162966410 Original CRISPR CTGGGAACACAGAGGGTACA GGG Intronic
900693169 1:3994149-3994171 CTGGGAGCTCAGAGGGCTCAGGG - Intergenic
901091566 1:6645127-6645149 CTGGGGAGACAGAGGGTGCAAGG + Intronic
902374344 1:16023255-16023277 CTGGGGACCCAGAGGATACCTGG + Intronic
902379299 1:16045133-16045155 CTGGGGACCCAGAGGATACCTGG + Intronic
902743580 1:18457812-18457834 CTGGGTAGACTGAGGGAACAAGG + Intergenic
902912876 1:19613658-19613680 CCTGGCACACAGTGGGTACACGG + Intronic
902998021 1:20242864-20242886 CAGGGATCCCAGAGGGGACAGGG + Intergenic
903139735 1:21332283-21332305 CTGGGAACGCAGAGGTGAAAAGG + Intronic
903300563 1:22375765-22375787 CTGGGAACACAGTGGATGCTCGG + Intergenic
904026040 1:27504339-27504361 CTGAGAAGCCAGAGGTTACAGGG + Intergenic
905882007 1:41470087-41470109 CTTGGAACCCATAGGGGACAAGG + Intergenic
906384000 1:45351686-45351708 CTGGGAGCACGGAGGTTCCAAGG + Intronic
907291646 1:53417381-53417403 CTCGGCACAAAGACGGTACATGG + Intergenic
907454953 1:54569485-54569507 AGGGGAAAACAGAGGGAACAAGG - Intronic
907702751 1:56805257-56805279 CTAGGCACACAGAGAGTAGATGG + Intronic
908342309 1:63194146-63194168 CAGGGAAGACATAGGATACATGG - Intergenic
910159076 1:84254279-84254301 CTGGGAACACCAAGGAAACACGG + Intergenic
910836954 1:91523619-91523641 CTGGGCACACAAGGGGTGCAGGG + Intronic
911370307 1:96988086-96988108 CTGGGAACACAGATGGGGAAGGG - Intergenic
912574026 1:110648105-110648127 CTGTGAATACAGAGATTACAAGG + Intergenic
913275706 1:117136154-117136176 CTGGGAAGACAGAGAGAAAATGG - Intergenic
913327802 1:117642603-117642625 CTGGGAGAAAAGAGAGTACAAGG - Intergenic
915222452 1:154385762-154385784 CTGGGAACCCTGAGGGCAGAGGG + Intergenic
915729558 1:158043516-158043538 CTGGGAACACTGATAGTTCAGGG + Intronic
915951913 1:160195276-160195298 CTGGGAACCCCCAGAGTACAGGG - Intronic
916544584 1:165791378-165791400 CAGGAAATACAGAGGGTACAGGG + Intronic
916547201 1:165817145-165817167 CTGTAAACCCAGAGGGTCCAGGG - Intronic
917127086 1:171696572-171696594 CTGGAAAAACAGAGGGTAAAGGG + Intergenic
917218380 1:172701705-172701727 GTGGGAACACAGAGGGAAAATGG + Intergenic
917782111 1:178409290-178409312 CTGGGAACACAAAGCTTGCAGGG + Intronic
919981670 1:202645819-202645841 ATGGGAACACAGTGGGTCCCTGG + Intronic
920084308 1:203403903-203403925 CTGGGAGCCCTGAGGCTACAGGG - Intergenic
920841891 1:209562144-209562166 CTGGAAACACAGGGGGTGCAGGG + Intergenic
922222256 1:223617749-223617771 CTTGGAACACAGAGTGTGTAGGG - Intronic
922459344 1:225803090-225803112 CTGGGAAGACTGAGGTCACAAGG - Intergenic
922473682 1:225891391-225891413 CTTGGAACACAGGCTGTACAAGG + Intronic
923079690 1:230641953-230641975 CTGGGAACTCATAGGGAAGAAGG - Intergenic
1063629515 10:7720967-7720989 CTGGCAACACACAGGGCTCAGGG - Intronic
1064706332 10:18076172-18076194 CTGTGAACTCAGAGGGGAGACGG - Intergenic
1065708733 10:28495208-28495230 CTGGGAAGACAGAGGGAAGGAGG + Intergenic
1066213007 10:33258137-33258159 CTAGGAACACAGCTGGTACTTGG - Intronic
1066994236 10:42549194-42549216 CTGGGAGCACAGCGGGGAAAAGG + Intergenic
1067563080 10:47317553-47317575 CTTGGAACACAGAGGTTGCATGG + Intergenic
1068607021 10:59016851-59016873 CTGGGAACACAGTGGCTGCTTGG - Intergenic
1070470284 10:76772598-76772620 CTGGGAGCAGAGAGGATAGAAGG + Intergenic
1070742059 10:78909728-78909750 CTGGGACCACAGAGTGGAGAAGG + Intergenic
1071341416 10:84652194-84652216 CTGGTTAGACAGTGGGTACAAGG - Intergenic
1071341687 10:84654680-84654702 CTGGGGACATAGAGGGTAAAAGG - Intergenic
1071568239 10:86682465-86682487 CTGGGAGCACAGCAGGTAAAAGG + Intronic
1073445930 10:103580293-103580315 ATGGGAACAGAGATGGCACAAGG - Intronic
1075004007 10:118817682-118817704 TTGGGAACACAGAGGGCAGAAGG + Intergenic
1075286730 10:121193559-121193581 CTGGGAACAGGGTGGGTCCAAGG + Intergenic
1076143533 10:128098107-128098129 TGGGGAACACAGAGAGGACAGGG + Exonic
1076601548 10:131660095-131660117 CTGGGAACCTAGAGGATGCAGGG + Intergenic
1076608229 10:131703115-131703137 CTGGGATGACACAGGGTTCAGGG + Intergenic
1077523116 11:3048002-3048024 CTGCAAAGACAGAGGGCACATGG + Intronic
1077890295 11:6413436-6413458 CTGAGAACACAGAGGGAAGGGGG - Intronic
1078101857 11:8334699-8334721 CAGGGAAGACAGAGGGTACAGGG - Intergenic
1078558946 11:12354138-12354160 CTGGGATCTCTGAAGGTACATGG - Intronic
1079110958 11:17604966-17604988 CTGGGGACACAGGGGACACATGG + Intronic
1079125267 11:17714337-17714359 CTGGGGACAGAGAGGGGACCTGG + Intergenic
1079632547 11:22695457-22695479 CAGGAAACAGGGAGGGTACATGG - Intronic
1080493426 11:32792869-32792891 CTGGGAATACCTACGGTACAGGG + Intronic
1081566487 11:44264067-44264089 CTGAGAACACAGATGCCACAAGG - Exonic
1081646080 11:44791622-44791644 CTGGGGACACAGGGGGGACCAGG - Intronic
1081702731 11:45162155-45162177 CTAGGTACCCAGAGGGTCCAGGG - Intronic
1084440442 11:69169772-69169794 CTGGAAACACCGAGGACACACGG + Intergenic
1084909030 11:72372805-72372827 CTGGGCACACAGTGGGTGCTGGG + Intronic
1085042782 11:73336412-73336434 CTGGGAGCGCAGTGGGTACGGGG + Intronic
1085319546 11:75565500-75565522 CTGGGAGCACTGTGGGTAGATGG + Intronic
1088639383 11:111856755-111856777 GTGGGAACAAAGAGTATACAAGG + Intronic
1088805124 11:113345433-113345455 CTGGGAACACAGAGCGGAGCTGG - Intronic
1089005905 11:115090613-115090635 CTGAGGACACAGCGGGTCCAGGG + Intergenic
1089440668 11:118514105-118514127 CTGGAGACTCTGAGGGTACAAGG - Intronic
1089806688 11:121097068-121097090 GTGGGAACACATAGGGCTCAGGG - Intergenic
1090079648 11:123603418-123603440 CTTGGGACACAGAGGCTTCAGGG - Exonic
1090501915 11:127269062-127269084 CTGAGAACAGAAAAGGTACAGGG + Intergenic
1091079344 11:132652105-132652127 CTGGATCCACAGAGGGTCCAGGG + Intronic
1091139347 11:133222084-133222106 CTGGGCACACAGTGACTACAGGG - Intronic
1091900703 12:4141850-4141872 CTGGGAACACACAGGATAAAGGG - Intergenic
1092498466 12:9022371-9022393 ATGGGAACACAGTGTATACATGG + Intergenic
1094630241 12:32166753-32166775 CTGGGACTACATACGGTACAGGG - Intronic
1095174123 12:39071109-39071131 CTGGGAACGCAGAGCCTTCATGG - Intergenic
1096780280 12:53987699-53987721 AAGGGCACAGAGAGGGTACAGGG - Intronic
1097197447 12:57251103-57251125 GTGTGAACACAGGGGGTACTGGG - Exonic
1097307151 12:58081754-58081776 CTGGTGACACAGAGGTAACAAGG + Intergenic
1097478058 12:60083832-60083854 CTGGGCACACACAGGGTTGAGGG + Intergenic
1097683907 12:62674692-62674714 CTGGGAACACCAAAGGTAAATGG + Intronic
1098771725 12:74560778-74560800 CAGGGAAAACAGAGTGTGCAGGG + Intergenic
1101166007 12:102034162-102034184 CTGAGAACAAACAGGGTTCAGGG - Intronic
1103871323 12:124094454-124094476 TGGGGAACACAGAGAGAACACGG + Intronic
1104616437 12:130273694-130273716 CTGTGGATACAGAGGGTACATGG - Intergenic
1105870671 13:24503439-24503461 CAGGGAACAGGGAGGGGACAGGG + Intronic
1106124474 13:26889087-26889109 CTGGGAAGACAGAGGTTGCAGGG + Intergenic
1108532875 13:51343879-51343901 CTGGGAAAACAGCAGGTCCAGGG - Intronic
1108773343 13:53732511-53732533 CTGGGAACAGAGAGGCAAAACGG - Intergenic
1111719164 13:91919610-91919632 CTGGCAACACCTAGGATACATGG + Intronic
1114493069 14:23115224-23115246 CTGGGATCACAGTGGGGAGACGG + Intergenic
1114726617 14:24944448-24944470 CTGGGAGCACATAGGGGATATGG + Intronic
1115492751 14:33973893-33973915 GTTGCAATACAGAGGGTACAAGG + Intronic
1116771905 14:49136075-49136097 ATGGGAACAAAGAGAGTAGAGGG + Intergenic
1118445901 14:65851066-65851088 GTGGGAGCACAGAGGAGACAGGG + Intergenic
1119212836 14:72845678-72845700 CTGGGACCACAGAAGAGACAGGG + Intronic
1119234379 14:73007153-73007175 CTTGGAACAGAGCCGGTACATGG - Intronic
1119727775 14:76932570-76932592 CCTGGAACACAGTAGGTACAGGG + Intergenic
1119986877 14:79148219-79148241 CTGGAAGCTCAGAGGGTTCATGG + Intronic
1122272991 14:100576655-100576677 CAGGGGACACAGATGGTACAGGG + Intronic
1124072063 15:26404693-26404715 TTGGGAACACAGTGCGAACATGG - Intergenic
1124252612 15:28116932-28116954 CAGGGAGCACAGAGGCCACATGG - Intronic
1125004631 15:34803389-34803411 CAGGGAACACAGAAAGTAGATGG - Intergenic
1125556417 15:40589263-40589285 CTGGGAACACAGTGATGACAGGG - Intergenic
1128212384 15:65911814-65911836 TTGGTTACACACAGGGTACAGGG + Intronic
1128341369 15:66824726-66824748 CTGGGATGACAGAGGGGACTTGG - Intergenic
1128368018 15:67018433-67018455 CTGGGAACACAGATGGAAGAAGG - Intergenic
1128704352 15:69827829-69827851 CTGGGAACACAAATGGACCAAGG - Intergenic
1130893002 15:88149392-88149414 CTCTGAACAGAGAGGGTACTGGG - Intronic
1131024988 15:89133123-89133145 AGGGCAACACGGAGGGTACAAGG - Intronic
1131070112 15:89460795-89460817 CTGGGAAAATAGAAGGTACCAGG - Intergenic
1131422574 15:92319618-92319640 CTGGGAAAAGGGAGGGGACAGGG - Intergenic
1132154371 15:99485403-99485425 CTGGGGACTCAGAGTGTCCATGG + Intergenic
1132419021 15:101648587-101648609 CTGGAAGCACAGAGCGTACTTGG - Intronic
1133231077 16:4366913-4366935 CTGGCAACACAGTGGGGACGGGG - Intronic
1133283961 16:4682092-4682114 CTGGGAACCCAGAGGCTCAAAGG - Intronic
1133361431 16:5176962-5176984 CTGGGAACACAGAGGATCTAGGG + Intergenic
1134548888 16:15130201-15130223 CAGGAAACACAAAGCGTACATGG + Intronic
1134603970 16:15555504-15555526 TTGGGAACAGAGTGGGAACAAGG + Intronic
1134711608 16:16329219-16329241 CAGGAAACACAAAGCGTACATGG - Intergenic
1134719459 16:16372518-16372540 CAGGAAACACAAAGCGTACATGG - Intergenic
1134863425 16:17582469-17582491 CTGTGAACACAGTGGGGAAAAGG + Intergenic
1134912024 16:18036124-18036146 CTGGGAACACTGAGGGGGAAAGG + Intergenic
1134947967 16:18339367-18339389 CAGGAAACACAAAGCGTACATGG + Intergenic
1135257199 16:20950504-20950526 CTGGGAAGACAGAGGCTTAAAGG - Intronic
1135264389 16:21010139-21010161 CTGGGCACACAGAAGGCACTTGG + Intronic
1136075407 16:27813774-27813796 CAGGAAACACGGAGGGGACAAGG + Intronic
1138690855 16:58767310-58767332 CAGGGATCACAGAGATTACAAGG + Intergenic
1139347052 16:66310706-66310728 GTGGGAACTCAGATGATACAGGG + Intergenic
1141365801 16:83441738-83441760 CTGGGAAGAGAGAGAGTACCTGG + Intronic
1141476767 16:84279319-84279341 CTGGGGCCACGGAGGGTGCATGG - Intergenic
1142144333 16:88486559-88486581 CTGGGTACACAGTGGGTGCTAGG + Intronic
1142144345 16:88486617-88486639 CTGGGTGCACAGTGGGTACTAGG + Intronic
1142600490 17:1051346-1051368 CTGGGAACCCAGCTGGCACACGG + Intronic
1142676293 17:1515586-1515608 CTGGAATGGCAGAGGGTACAGGG + Intronic
1143110206 17:4548717-4548739 ATGGTACCACCGAGGGTACAAGG + Intronic
1143848120 17:9788523-9788545 CTGCAGACACAGTGGGTACAAGG + Intronic
1145750957 17:27354475-27354497 CAGGGAAGGCAGAGGGGACAGGG - Intergenic
1145759609 17:27418769-27418791 CTGGGAACACTCAGGGCAAAAGG - Intergenic
1146085082 17:29820866-29820888 CTGGGAAGAGAGAGGTGACAAGG - Intronic
1147337579 17:39736916-39736938 CTGGGCAAACACAGGGTACTTGG - Intergenic
1148791774 17:50177206-50177228 GTGGGACCACAGCGGGGACAGGG - Intergenic
1149330544 17:55576867-55576889 CTGGGAGCACAGAGAGTAGGAGG + Intergenic
1149639502 17:58193639-58193661 CTGGGAGGAGAGAGGGTAAAGGG + Intronic
1149642262 17:58210830-58210852 CTGGAAACGCAGAGGGTTCCTGG - Intronic
1150227627 17:63532397-63532419 CTGGGCACACAGCGGGGAGAGGG + Intronic
1150619339 17:66797693-66797715 GTGGGGACACAGAGGGGAGAAGG - Intronic
1151313899 17:73310689-73310711 CTGGGAAAACACAGGGAACCTGG + Intronic
1152573408 17:81130212-81130234 CTGGGAACACAGAGGCAGGAGGG - Intronic
1152639798 17:81444729-81444751 GGGGGAAGACAGAGGGCACAGGG - Exonic
1152832172 17:82504100-82504122 CTCAGAACACAGAGGTTGCAGGG + Intergenic
1153828287 18:8897286-8897308 CTGGGAACACAGAGGAGACGTGG - Intergenic
1154299229 18:13178417-13178439 CTGGGACCCCAGAGGGTGCGAGG - Intergenic
1155517843 18:26640889-26640911 TTGGGGACACAGAGAGGACAAGG + Intronic
1155671926 18:28381980-28382002 ATGGGAACACAGCTGGTAAAGGG + Intergenic
1155731558 18:29166064-29166086 CTGTGAACACAGAGAGTAGAGGG - Intergenic
1157258222 18:46157053-46157075 CTGGGAACACAGTGTCTCCAAGG + Intergenic
1157500816 18:48189478-48189500 ATGGGAAGACAGAGGGGACGAGG - Intronic
1158390003 18:57037224-57037246 CTGGAAACACAGAGGAAACTGGG - Intergenic
1158793170 18:60806955-60806977 CTAGGAACACAGATGGAAAATGG + Intergenic
1160444778 18:78918882-78918904 CTGGGAAGCCATAGGCTACACGG - Intergenic
1161073391 19:2273537-2273559 CTGGGACCACAGAGGGCCCTGGG + Intronic
1161124418 19:2547759-2547781 CTGGGAACAGAGTGGGTTCCAGG - Intronic
1161517466 19:4704305-4704327 CTGGAAACATACAGGGGACAGGG + Intronic
1161717858 19:5886868-5886890 CTGGGGACCCTGTGGGTACAGGG + Intronic
1162143215 19:8596933-8596955 CTGAGAAAACAGATGGTCCAGGG - Intronic
1162947788 19:14054278-14054300 CTGGGAACAGAGAGGGAAGGAGG - Exonic
1162966410 19:14158281-14158303 CTGGGAACACAGAGGGTACAGGG + Intronic
1163432010 19:17273881-17273903 CTGGGGAGGCAGAGAGTACAGGG - Intronic
1164727515 19:30476184-30476206 CTGGGGCCACAGAGGGAAGAAGG - Intronic
1165204927 19:34175304-34175326 CTTGGAAGGCAGAGGTTACAGGG - Intronic
1165407046 19:35637419-35637441 CTGTGGAGACAGAGGGTTCAAGG - Intronic
1165464867 19:35967993-35968015 CTTGGGAGACAGAGGCTACAGGG - Intergenic
1166050376 19:40255615-40255637 AAGGGAACTTAGAGGGTACACGG + Intronic
1166139411 19:40798137-40798159 CAGGGCACACACAGGGTTCATGG - Intronic
1167507881 19:49880727-49880749 CTGGGGTCACACAGGGTGCAGGG + Intronic
1167736448 19:51297262-51297284 CAGGGCACACAGAGAGTGCATGG - Intergenic
1168268667 19:55237753-55237775 CTGGGCACACAGTGGGTCTAGGG + Intronic
1168351452 19:55678484-55678506 CTGGAAACACAAATGGGACATGG - Intronic
1168615727 19:57835488-57835510 CTGGGACCACAGGAGGCACACGG + Intronic
1168621056 19:57879961-57879983 CTGGGACCACAGGAGGCACACGG - Intronic
925134061 2:1514438-1514460 CTGGGCAGACAGAGGGCACTGGG - Intronic
926180996 2:10642821-10642843 CTGGGCCCTCAGTGGGTACAGGG + Intronic
927647288 2:24886153-24886175 CTGGGAACACAGTGGGGACTGGG - Intronic
927680185 2:25133770-25133792 CAGGGGACACAGAGGGGAAAAGG - Intronic
927932689 2:27055329-27055351 CTGGGAACACAGAAGCCAGAAGG - Intronic
928098812 2:28422980-28423002 CCAGGAAGACAGAGGGGACAAGG + Intergenic
931973461 2:67616174-67616196 CTGGGAACTCAGAAGGAACTAGG + Intergenic
932555157 2:72817525-72817547 CTGGGAACCCAAAGGGTGCCTGG - Intronic
934508246 2:94914084-94914106 CTGGAGAGACAGAGGGTGCATGG - Intergenic
935563587 2:104583944-104583966 CTGGGAACACAGAGGATACCAGG - Intergenic
936506975 2:113115824-113115846 CTGGGGACATCGAGGGTAAAGGG - Intronic
937345199 2:121121136-121121158 GTGGGAAGCCAGAGGGCACAGGG - Intergenic
939825818 2:147014544-147014566 CTAGGAACTCAGAGGTTACAGGG - Intergenic
941144811 2:161831897-161831919 TTGGGAACATAAAGGATACATGG - Intronic
944681953 2:202085263-202085285 CTGGGACCTGAGAGGTTACAGGG + Intronic
945322148 2:208436683-208436705 CAGGGAACACAGAGTGCACTGGG + Intronic
948063557 2:235060280-235060302 CTGGGCACACAGAGGGTCCAAGG + Intergenic
948454760 2:238099835-238099857 CTGGGGACACAGTGGCTCCACGG - Intergenic
1169399831 20:5270433-5270455 ATGGGTACACAGAGGACACATGG - Intergenic
1170722513 20:18896185-18896207 GTGGGCAGGCAGAGGGTACATGG + Intergenic
1171456631 20:25276146-25276168 CTGGGAACATGGAGGGTAGCAGG + Intronic
1173622155 20:44444995-44445017 CTGAGGACACAGAGGCCACAGGG + Intergenic
1175902123 20:62364072-62364094 CTGGGGACACAGCGGGAATAAGG - Intronic
1176138918 20:63536762-63536784 CAGGGAGGACAGAGGGTCCAGGG - Intronic
1179260187 21:39750995-39751017 CTGGGAACGCAGAGGCCTCAGGG - Intronic
1179904821 21:44417211-44417233 CTGGCATCACAGTGGGCACAAGG + Intronic
1179904831 21:44417289-44417311 CTGGCATCACAGTGGGCACAAGG + Intronic
1181512613 22:23395615-23395637 CTGGGAGCTCAGAGGGCCCAAGG - Intergenic
1181762431 22:25067521-25067543 CAGGGAACACAGAGGGTGAAAGG - Intronic
1181962247 22:26630576-26630598 CTGGGTTCACACAGGTTACAGGG - Exonic
1182464730 22:30507325-30507347 ATGGGAGGACAGAGGGAACAGGG - Intergenic
1182883613 22:33754858-33754880 CTGGGAAGTCAGATTGTACATGG - Intronic
1183172535 22:36198762-36198784 CAGGTCACACAGAGGGGACATGG + Intronic
1183283863 22:36950639-36950661 CTGGGCACACAGTGGGGACAGGG + Intergenic
1184493456 22:44823852-44823874 CTGGCAACACTGAGGGTGCAGGG + Intronic
949295624 3:2519171-2519193 CTTGAAACACAGTTGGTACAAGG - Intronic
949346592 3:3082671-3082693 GTGGCAACACAGAGGGCAGAAGG + Intronic
952101486 3:30018040-30018062 CTTGGAACACAGGTGGTCCAAGG - Intergenic
952859948 3:37804629-37804651 CTGGGGACACAGTGGAAACAAGG - Intronic
952931744 3:38365890-38365912 CTGGGAACACACAGGGCAGCAGG - Intronic
953000182 3:38925038-38925060 ATGGGAAGTCACAGGGTACAGGG - Intronic
954014008 3:47669871-47669893 CTGGGAACCCAGAGGGCACCAGG + Intronic
954229908 3:49208817-49208839 CTACCAACAGAGAGGGTACATGG + Intronic
954463577 3:50641450-50641472 CTGGGAACACACAGGCTTCTTGG + Intronic
954683101 3:52356420-52356442 CAGGGAACAAAGAGGATACAGGG - Intronic
955185555 3:56711741-56711763 ATGGGAACACAGAGGCTTCCTGG + Intergenic
957588343 3:82161573-82161595 CTGGGAACCCAGGGCATACATGG - Intergenic
959167142 3:102794566-102794588 CTGGAAACACAGAAGGGAGAAGG - Intergenic
959646701 3:108711611-108711633 CTGGGAACAGGGAGGGCACAGGG + Intergenic
960054030 3:113263979-113264001 GTCTGAACACAGAGGCTACAGGG - Intronic
962289572 3:134122826-134122848 CTGGCAGCACACAGGGTCCATGG + Intronic
962390300 3:134966069-134966091 CTGGGTACACAGAGGGGCAAGGG + Intronic
963204753 3:142621370-142621392 CCTTGAACACAGAGGGTAGATGG - Intronic
963273409 3:143307633-143307655 CTGGGAACAGAAAGGCTGCAGGG - Intronic
963864341 3:150344228-150344250 TTGGGAACACAGGGGGTGAAGGG - Intergenic
964634339 3:158843730-158843752 CTGAGAACCCAGAGGGCAGATGG - Intergenic
967045168 3:185730128-185730150 CTGGGAACACAAAGGGGAAAGGG - Intronic
967303150 3:188036713-188036735 CTGGGACCACAGAGGATCCCTGG - Intergenic
967523180 3:190459789-190459811 CTGGGAACATCGATGGTAAAGGG - Intergenic
968434963 4:579680-579702 CTGGGACCACAGACTGTACAAGG - Intergenic
969455970 4:7299807-7299829 ATGGGAACACAGAGAGCTCAGGG - Intronic
969518718 4:7663534-7663556 CAGTGTACACAGAGGGTACGTGG - Intronic
970640195 4:18055701-18055723 CTGGGAACACAGGGGCAAGATGG + Intergenic
972822589 4:42718807-42718829 CTGGGAAAACAGATGTTTCAGGG + Intergenic
973077134 4:45943266-45943288 CTGCTAACTCGGAGGGTACATGG - Intergenic
976434256 4:84998869-84998891 CTGGGAACAAAGAGGAAATAAGG + Intergenic
976648776 4:87413045-87413067 CTGTGAAGACAGATGTTACATGG + Intergenic
978061522 4:104345362-104345384 CTGGGAAGAATGAGGTTACATGG - Intergenic
981147582 4:141343229-141343251 CAGGGAACACAGATGCTCCAGGG - Intergenic
985607348 5:865134-865156 CAGGGTCCACAGAGGGCACAGGG + Intronic
986064920 5:4225883-4225905 CTAGGGACACAGAGAGAACACGG - Intergenic
986693006 5:10329420-10329442 CTTGGAACACCCAGGGTCCACGG - Intergenic
988900976 5:35731910-35731932 CAGAAATCACAGAGGGTACAGGG + Intronic
989398718 5:40986154-40986176 CTGGGAACACAGAGAGGTCAAGG + Intergenic
990001550 5:50899149-50899171 AAGGGAACACAGAGTGTTCAAGG + Intergenic
992530504 5:77647499-77647521 CTGGGACCACAGAGAGTGAAGGG + Intergenic
993376283 5:87152714-87152736 CTGGGAACTTAGTGGGTAGAGGG + Intergenic
994242515 5:97441608-97441630 CTAGGAAAACAGAGGATACTGGG - Intergenic
997098354 5:130939463-130939485 CACTGACCACAGAGGGTACAAGG + Intergenic
997631447 5:135372187-135372209 CTGGGAACACTGAGAAGACAGGG - Intronic
997864104 5:137445449-137445471 CTGGGCACTCAGAGGCAACAGGG + Intronic
999253759 5:150197918-150197940 CTGGGCACACAGTGGGTCCTGGG + Intronic
1001535877 5:172497546-172497568 CTGGGAATACAGAGGGCCCCAGG - Intergenic
1001999743 5:176191069-176191091 CTTGGAATACAGAGGACACAGGG - Intergenic
1003619869 6:7690429-7690451 CTGGGCTCAAAGAAGGTACATGG + Intergenic
1003912359 6:10753917-10753939 CAGGGAAACTAGAGGGTACATGG - Intronic
1004349403 6:14878112-14878134 CTGTGGACACAGTGGCTACATGG - Intergenic
1006682774 6:35809059-35809081 CTGGGAACAGGGAGGGGGCAGGG + Intronic
1007095861 6:39212606-39212628 CTGAGAGCACAGTGGGTCCAAGG + Intronic
1007289568 6:40775214-40775236 CTGGGAGCAAAGAGGGAACTTGG - Intergenic
1007337771 6:41166981-41167003 CTAGGAACACAAAGGCTCCATGG - Intergenic
1007717989 6:43868376-43868398 CTGGAGACATAGAGGGTACATGG - Intergenic
1007778500 6:44237632-44237654 CCGGGATCACAGCTGGTACAGGG - Intergenic
1008872549 6:56289747-56289769 CTTGGAACACAGGCTGTACAGGG + Intronic
1009307061 6:62103477-62103499 CTGGGAGCAGAGAGAGGACAGGG + Intronic
1009512241 6:64567985-64568007 GTGGGAACACAAATGGAACATGG + Intronic
1009705030 6:67239032-67239054 CAGGGGACTCAGAGGGGACAGGG - Intergenic
1010344355 6:74794435-74794457 CAGGGAACCCAGAGAGTCCACGG - Intergenic
1010555073 6:77268751-77268773 CTGAGAACCCAGTGGGTAAAAGG - Intergenic
1011043546 6:83057380-83057402 CTGGGGATACAGAGTGAACAAGG - Intronic
1011345538 6:86366040-86366062 CTGGGACAAGAGAGGGTTCAGGG - Intergenic
1011495541 6:87933667-87933689 ATGGCAAAACAGAGGGCACAGGG - Intergenic
1013482055 6:110561407-110561429 CTGGGAACACAGCATGAACAAGG + Intergenic
1015291744 6:131545380-131545402 CTTTGAACACAGGTGGTACAAGG + Intergenic
1015795150 6:137003947-137003969 CTGGGAATTCTGGGGGTACAAGG - Intronic
1015917882 6:138236548-138236570 CTGGGAAGGTAGAGGCTACAAGG - Intronic
1016426320 6:143939467-143939489 CTGAGAACAAAGAGGGGATATGG + Intergenic
1017309248 6:152957142-152957164 CTGGGAACACAGGCAGTAGACGG + Intergenic
1017587871 6:155947041-155947063 CTGGGAACAGGGAGAGGACAGGG - Intergenic
1018226915 6:161637588-161637610 CTGGGAACGCAGAGGAGAAAAGG - Intronic
1018650386 6:165987634-165987656 CCGGGAGCACAGTGGGTCCAGGG + Intergenic
1018696968 6:166397877-166397899 CTGGGAACATCACGGGTACAGGG + Intergenic
1019372846 7:672059-672081 CTGGGAACACAGTGGGGGTAGGG - Intronic
1020188493 7:5976365-5976387 CTCGGGACACAGAGGTAACAAGG - Intronic
1020294422 7:6748405-6748427 CTCGGGACACAGAGGTAACAAGG + Intergenic
1022631866 7:32093011-32093033 CTGGGGACTAAGAGGGTTCATGG + Intronic
1023198496 7:37667768-37667790 TTGGGAACAGAGTGGCTACAGGG - Intergenic
1023490053 7:40730024-40730046 CTGCTAATACAGAGGGTCCAGGG + Intronic
1023896658 7:44439428-44439450 CTGGGCACTCAGAGGGCACGTGG - Intronic
1026131609 7:67625621-67625643 CGGGGAAGACGGAGGGTTCAAGG - Intergenic
1028354058 7:89885316-89885338 GTGGGGACACTGAGGGTAGATGG - Intergenic
1029180004 7:98693534-98693556 CTGGGTGCACCGTGGGTACAGGG + Intergenic
1031188605 7:118516729-118516751 CTGTGAGAAAAGAGGGTACAAGG - Intergenic
1034066716 7:148144024-148144046 CTGGAAACACAGAGATTCCAGGG + Intronic
1035289035 7:157825374-157825396 CTGGGACCTCAGAGGCTGCAAGG + Intronic
1035785117 8:2253871-2253893 CTGGGAACACAAAGAGGAAAAGG - Intergenic
1035807694 8:2467845-2467867 CTGGGAACACAAAGAGGAAAAGG + Intergenic
1036428910 8:8671471-8671493 CTGGGAACACAGGGGCAAGAGGG + Intergenic
1037384095 8:18318947-18318969 CTGACAACACAGAGTCTACAGGG + Intergenic
1039395548 8:37222388-37222410 CTGGGCCCACAGGGGGAACAAGG - Intergenic
1039438947 8:37581394-37581416 CTGGGGGCACAGAAGGAACATGG - Intergenic
1040519239 8:48160656-48160678 CTGGGAACAAACAGGGTCCCAGG + Intergenic
1040538079 8:48327027-48327049 CTGGGGACACAGAGGTTGCCTGG - Intergenic
1041118960 8:54567059-54567081 CAGGGAACACCCAGGGTTCAGGG - Intergenic
1042805885 8:72770278-72770300 TTGGGGACACAGATGGCACATGG - Intronic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1043511699 8:80956609-80956631 CTGGGAACACTGAGGGTGGAGGG + Intergenic
1048982864 8:139712472-139712494 CTGGGGACCCAGAAGGTACGTGG - Intergenic
1049136549 8:140906656-140906678 CTGGGAAGGGAAAGGGTACAGGG + Intronic
1049283494 8:141762353-141762375 CTGGGGACAGACAGGGGACAGGG + Intergenic
1049503130 8:142978725-142978747 CTGGAGAGACAGAGGGGACATGG + Intergenic
1050180291 9:2915536-2915558 CTCGGAACACATAGTGTGCACGG - Intergenic
1052339593 9:27352110-27352132 CTGGGATTACAGATGGTACCTGG - Intronic
1052352094 9:27468466-27468488 CTGGTAAAGCAGAGGGAACAAGG + Intronic
1052391262 9:27881243-27881265 CTTGGAAGACTGAGGGTAGAAGG - Intergenic
1053257120 9:36627015-36627037 CTGGGAACACAAAGAAGACAAGG + Intronic
1053291364 9:36881724-36881746 GTCTGAACACAGAGGGTGCAGGG - Intronic
1055868948 9:80850956-80850978 CTGGAGAGACAGAGGTTACATGG + Intergenic
1056216557 9:84410344-84410366 CTGGGGAGACAGAGGCTATAGGG + Intergenic
1056295807 9:85192018-85192040 CTGGGAATACAGTGTGAACAAGG + Intergenic
1056408800 9:86303970-86303992 CTGGGAGTACAGAGGGAATAGGG + Intronic
1056667090 9:88589641-88589663 CTGTGCACACACAGGGTACAGGG + Intergenic
1058689790 9:107510065-107510087 CTAGGAGCCCAGAGGGCACAGGG + Intergenic
1059193654 9:112350207-112350229 TTGGGGACTCAGAGGGTAAAGGG + Intergenic
1060879606 9:127108831-127108853 CTGGGATCACTGATGGCACAGGG - Intronic
1060947656 9:127579575-127579597 CTGGGAGCAGAGAGGTTACGAGG + Intergenic
1062586069 9:137250679-137250701 CTGGGGGCACAGAGGCTAGAGGG - Intergenic
1203565176 Un_KI270744v1:83147-83169 GTGGGAGCACAGTGGGCACAGGG - Intergenic
1186071061 X:5821215-5821237 CTGGAAACACAAATGGCACACGG + Intergenic
1187579594 X:20593731-20593753 CATGGAACACAGACTGTACACGG - Intergenic
1188145143 X:26602714-26602736 AGAGGAACCCAGAGGGTACATGG - Intergenic
1190061080 X:47212074-47212096 GGGGGAACACAGAGGATACAGGG - Intronic
1193359924 X:80569976-80569998 CTGGGAGCACAGAGGGGAGAGGG - Intergenic
1195998409 X:110755210-110755232 CTGGGCCCAAAGAGGCTACATGG - Intronic
1197809307 X:130427386-130427408 CTTGGAACACAGAGGCAGCATGG + Intergenic
1199747449 X:150782548-150782570 CTGGGAACACGGCGTGAACATGG - Intronic
1200687280 Y:6267760-6267782 CTGGGAAGACTGAGGCTAGAGGG + Intergenic
1201047993 Y:9906950-9906972 CTGGGAAGACTGAGGCTAGAGGG - Intergenic
1201063343 Y:10067943-10067965 CTGGGAAGACTGAGGCTAGAGGG - Intergenic
1201771785 Y:17622891-17622913 CTGGGACCATAGAGGGACCAGGG + Intergenic
1201829770 Y:18283095-18283117 CTGGGACCATAGAGGGACCAGGG - Intergenic