ID: 1162966533

View in Genome Browser
Species Human (GRCh38)
Location 19:14158863-14158885
Sequence CTCACAGCTCAGAGAGGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 567
Summary {0: 1, 1: 1, 2: 2, 3: 45, 4: 518}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162966533_1162966544 19 Left 1162966533 19:14158863-14158885 CCCCATCCTCTCTGAGCTGTGAG 0: 1
1: 1
2: 2
3: 45
4: 518
Right 1162966544 19:14158905-14158927 AACTGTAAGGCTCACCCTTAGGG 0: 1
1: 0
2: 0
3: 21
4: 358
1162966533_1162966543 18 Left 1162966533 19:14158863-14158885 CCCCATCCTCTCTGAGCTGTGAG 0: 1
1: 1
2: 2
3: 45
4: 518
Right 1162966543 19:14158904-14158926 CAACTGTAAGGCTCACCCTTAGG 0: 1
1: 0
2: 1
3: 5
4: 167
1162966533_1162966541 6 Left 1162966533 19:14158863-14158885 CCCCATCCTCTCTGAGCTGTGAG 0: 1
1: 1
2: 2
3: 45
4: 518
Right 1162966541 19:14158892-14158914 GAGCCAGCTTTGCAACTGTAAGG 0: 1
1: 0
2: 0
3: 8
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162966533 Original CRISPR CTCACAGCTCAGAGAGGATG GGG (reversed) Intronic
902244885 1:15114303-15114325 CTCCCTGCTCAGGGAGGTTGAGG - Intronic
902294961 1:15460949-15460971 CTCATAGCTCAGCGTGGCTGGGG + Intronic
902297803 1:15480485-15480507 CTCACAGCTCAGCATGGCTGGGG + Intronic
902398463 1:16144874-16144896 CACACAACCCAGAGAGGATGAGG - Intronic
902719314 1:18293447-18293469 CACAGAGCCCAGAGAGGACGAGG - Intronic
903028104 1:20443700-20443722 CTCACAGCTCAGACAGGCCCAGG - Intergenic
903474766 1:23612012-23612034 CACACAGCTCATAGGGGGTGGGG + Intronic
904195200 1:28780388-28780410 CTTATAGATCAGAGAAGATGAGG - Intergenic
904200071 1:28813737-28813759 CCCACAGCCCAGAGAGGTTTAGG - Intronic
904858684 1:33519168-33519190 CACACAGCTCAGAAGGGGTGGGG - Intronic
905527357 1:38649167-38649189 GTCACAGCTTGGAGGGGATGGGG - Intergenic
905695115 1:39968214-39968236 TACACAGCTCAGTGAGGATATGG - Intronic
905976118 1:42175248-42175270 CTCACAGCTAATAGAGGAGCTGG - Intergenic
905995281 1:42376004-42376026 CTTACAGCGCAGGGAGGGTGGGG + Intergenic
906034448 1:42741589-42741611 CTCCCAGCACAGAGAGCCTGAGG - Intergenic
906226807 1:44129456-44129478 CTCACAGCGCAGAGATGCTGGGG + Exonic
906636720 1:47415358-47415380 CTCACATCTCACTGGGGATGGGG - Intergenic
907251456 1:53142371-53142393 CAGACAGCACAGACAGGATGAGG + Exonic
907797188 1:57729405-57729427 CTTTCAGTGCAGAGAGGATGTGG - Intronic
908048148 1:60195118-60195140 CTCTCAGCCCAAAGAAGATGAGG + Intergenic
908162530 1:61424680-61424702 CTTAGAGCACAAAGAGGATGTGG - Intronic
908763219 1:67531314-67531336 CTCACAGTTCAGCGTGGCTGGGG + Intergenic
908808032 1:67950839-67950861 CACACAGCTCAACAAGGATGAGG - Intergenic
909215301 1:72879029-72879051 CTCACAGCTCTGAGATGGTGTGG + Intergenic
909640571 1:77867440-77867462 CTAGCAACTCAGGGAGGATGAGG - Intronic
909746054 1:79098396-79098418 CTCACAGCTCAGAATGGCTGGGG - Intergenic
910708257 1:90152905-90152927 CTCACAGCTCAGCATGGCTGGGG + Intergenic
912236958 1:107862718-107862740 AACACAGCTCAGATAGGATACGG + Intronic
912455098 1:109791937-109791959 CACACAACACAGAGAGGTTGGGG + Intergenic
912467075 1:109881702-109881724 CTCATCGCTCAGACAGGAGGAGG - Intergenic
912846934 1:113082990-113083012 CTCAAAGCCCAGGGAGGTTGAGG - Intronic
913060693 1:115203979-115204001 CTCAGAGTTCAGGGAGGCTGAGG + Intergenic
913257363 1:116965533-116965555 CTCACTGATTAGAGAGGCTGAGG - Intronic
913573725 1:120147825-120147847 CTCCCAGGTCAGAGAGTAGGGGG + Intergenic
913955594 1:143288502-143288524 CACACAGCTCAAAGAGGAGCAGG - Intergenic
913981837 1:143526939-143526961 CACACAGCTCAAAGAGGAGCAGG + Intergenic
914076201 1:144353595-144353617 CACACAGCTCAAAGAGGAGCAGG + Intergenic
914102977 1:144612901-144612923 CACACAGCTCAAAGAGGAGCAGG - Intergenic
914246819 1:145892417-145892439 CTCACAGTTTGGAAAGGATGAGG - Exonic
914294987 1:146312627-146312649 CTCCCAGGTCAGAGAGAAGGGGG + Intergenic
914556028 1:148763410-148763432 CTCCCAGGTCAGAGAGAAGGGGG + Intergenic
917424606 1:174901312-174901334 CTCACAGTTCAGAATGGCTGGGG + Intronic
917501638 1:175591127-175591149 CACACACATCAGAGAGGAGGTGG - Intronic
917600246 1:176566516-176566538 CACACAGCTCCCAGAGGATGGGG - Intronic
918121248 1:181542672-181542694 CTCACAGTTCAGCGTGGCTGGGG - Intronic
918143387 1:181736315-181736337 GGCAGAGATCAGAGAGGATGAGG + Exonic
918374753 1:183897920-183897942 CTGACAGCTCACAGAGGAGAAGG + Intronic
919436209 1:197564637-197564659 CTCATAGCTCAGAGATAGTGTGG - Intronic
919708041 1:200697679-200697701 CTCACAGTTCAGCGTGGCTGGGG - Intergenic
920304870 1:205012216-205012238 CTCACACATCACAGAGGAAGTGG + Intronic
920342580 1:205284735-205284757 CTCACAGCTCTGAGAGCAGCTGG - Intergenic
920539399 1:206766799-206766821 ATCTCAGCTCAAAGAGGATTTGG + Intergenic
921180129 1:212625549-212625571 CACACACCTCAGAGACCATGTGG - Exonic
921641022 1:217554330-217554352 TTCAGAGCTCAGTGAGGATGAGG - Intronic
922721972 1:227903974-227903996 GTCACAGCCCAGAGAGGACCAGG - Intergenic
923233236 1:232008058-232008080 CTCACAGTTCAGTGTGGCTGGGG - Intronic
923409999 1:233698688-233698710 CTCACAGCTCTGCAAGGCTGGGG + Intergenic
923506914 1:234611940-234611962 CTCCCAGCTTGGAGAGGGTGAGG - Intergenic
1062940992 10:1421309-1421331 CTCACAGCTGAGCGTGGGTGGGG - Intronic
1063411237 10:5838238-5838260 ATCCCAGCACTGAGAGGATGGGG + Intronic
1063712243 10:8490877-8490899 CTCACAGTTCAGCGTGGCTGGGG - Intergenic
1064511051 10:16091917-16091939 CCCAGAGCTCTGAGAGGCTGAGG + Intergenic
1065164948 10:22966678-22966700 CTCACAGATCCTAGTGGATGAGG + Intronic
1066297231 10:34065602-34065624 CTCACAGCTCCGTGTGGCTGGGG - Intergenic
1066463517 10:35633328-35633350 CTCACAGCTCCGCGTGGCTGGGG + Intergenic
1066677641 10:37904907-37904929 CTCACAGTTCAGAATGGCTGGGG - Intergenic
1066779148 10:38924222-38924244 CACACAGCTCAAAGAGGAGCAGG + Intergenic
1066952078 10:42129402-42129424 CACACAGCTCAAAGAGGAGCAGG - Intergenic
1067239301 10:44476701-44476723 CTCACAGCTCAGAGGGGAGTGGG + Intergenic
1067654662 10:48182290-48182312 CTCACCTCTCATGGAGGATGTGG - Intronic
1068148245 10:53098507-53098529 CTCACAGTTCAGCGTGGCTGGGG - Intergenic
1068352322 10:55863144-55863166 CTCACAGTTCAGCATGGATGGGG - Intergenic
1068977393 10:63024667-63024689 CTCAGAACTCTGAGAGGCTGAGG + Intergenic
1069798082 10:71066011-71066033 AACACAGGTCAGAGATGATGTGG - Intergenic
1069798559 10:71068552-71068574 AACACAGGTCAGAGATGATGTGG + Intergenic
1070497132 10:77034826-77034848 TTTACAGCTCAGAGGGGATTAGG - Intronic
1070654901 10:78264655-78264677 ATCTCAGCTCTGTGAGGATGGGG + Intergenic
1070690884 10:78524499-78524521 CTCACATGTCAGAAATGATGTGG + Intergenic
1071122529 10:82296199-82296221 GCCGCAGCTCAGAGAGGAAGAGG + Intronic
1071778285 10:88813746-88813768 CTCACAGTTCAGCGGGGCTGGGG + Intronic
1073043377 10:100622127-100622149 CTCACAGTTCTGAGGGGATTGGG + Intergenic
1075618300 10:123907474-123907496 CCCGCAGCACAGGGAGGATGTGG + Intronic
1075640782 10:124062848-124062870 CTCTCACCTCATGGAGGATGGGG + Intronic
1075791013 10:125084510-125084532 CTCCCTTCCCAGAGAGGATGGGG - Intronic
1075949631 10:126465924-126465946 CTCAAAGGACAGAGAAGATGTGG + Intronic
1076082106 10:127591576-127591598 CTCACAGTTCAGCGTGGCTGGGG + Intergenic
1077131646 11:975943-975965 CACACTCCTCAGAGAGGAGGAGG - Intronic
1077229409 11:1451850-1451872 CTCACGGCTCAGAAAGGCGGCGG - Intronic
1077388493 11:2287475-2287497 GTCAGAGCTCAGCGAGGATGAGG + Intergenic
1078849380 11:15150065-15150087 CTCACAGTTCTGATAGGGTGAGG + Intronic
1079029781 11:16977886-16977908 CTCACAGCAGACCGAGGATGAGG - Intronic
1079147916 11:17870191-17870213 CTCACAGTTCAGTGTGGCTGGGG - Intronic
1080786108 11:35476548-35476570 CTCACAGCTCCGTGTGGCTGGGG - Intronic
1080951098 11:37033864-37033886 CTCACAGCTCAGCATGGCTGCGG - Intergenic
1081281139 11:41210469-41210491 CTCACAGTTCAGTGTGGCTGGGG - Intronic
1081735429 11:45400189-45400211 CTCACTCCTCAAGGAGGATGAGG + Intergenic
1082273056 11:50192878-50192900 TTTACAGCTCAGTGAGGATAGGG - Intergenic
1083299653 11:61733742-61733764 CTCACTGCCCAGCGAGGAGGCGG + Intronic
1083802882 11:65057160-65057182 CCTACAGCTCAGAGAGGGTCAGG + Intronic
1084863756 11:72039662-72039684 CTCACAGCTCACAAAGGAAATGG + Intronic
1085745350 11:79110286-79110308 CTCACAGCACACAGAGAATCTGG + Intronic
1087081751 11:94177643-94177665 TTCACACGTCAGAGAGGGTGAGG - Intronic
1088356342 11:108948010-108948032 TTCACATCACAGACAGGATGGGG - Intergenic
1088693022 11:112344009-112344031 CCCACTGCCCAGAGAGGCTGAGG + Intergenic
1088732583 11:112696230-112696252 CTCTCAGCTCTGAGAGGCCGAGG - Intergenic
1089090655 11:115872078-115872100 TTCACACCTCACAGAGGATTGGG + Intergenic
1089182081 11:116590119-116590141 CTCAGAAGTCAGAGAGGATGGGG - Intergenic
1089374328 11:117983793-117983815 CTCTCAGCAGAGAGGGGATGGGG - Intergenic
1089600644 11:119612441-119612463 CTCACAGTTCAGTGTGGCTGGGG - Intergenic
1089965816 11:122654526-122654548 AACTCAGCTCAGAGAGGTTGGGG - Intergenic
1090150020 11:124374295-124374317 CTCTCAGCCGAGAGGGGATGTGG + Intergenic
1090206983 11:124890777-124890799 CTCACTTCTCAGAGAGGAATGGG - Intronic
1090225298 11:125067989-125068011 CTAACATTTCAGAGAGAATGGGG + Intronic
1090358408 11:126156033-126156055 CTCACAGCACACGGAGGCTGCGG + Intergenic
1090601696 11:128379045-128379067 CTCACATGGCAGAGAGGAAGAGG + Intergenic
1090845273 11:130524996-130525018 CTCACTGCCCAGAGAGGACACGG + Intergenic
1091346516 11:134857814-134857836 ATCACAGCTAAGGGAGGATGGGG + Intergenic
1091931968 12:4403482-4403504 CTCACAGGTCAGTGAGGAGTAGG - Intergenic
1092491912 12:8953219-8953241 CTCTCAGCGGAGAGGGGATGTGG + Intronic
1092792504 12:12082108-12082130 CTCATGGCACAGACAGGATGAGG + Intronic
1093099486 12:15010674-15010696 ATCACAGCTTACAGGGGATGAGG - Intergenic
1094493494 12:30975747-30975769 CTCACAGCTCACAGTGGTGGTGG + Intronic
1096653033 12:53071455-53071477 CTCAGAGCTCTGAGGGGTTGAGG - Intronic
1096877267 12:54639699-54639721 ATCACAGTTCAGACAGGAAGTGG - Intergenic
1096912970 12:55002613-55002635 CTCATTGCTCAGAGTGGTTGGGG - Intergenic
1097010857 12:55952720-55952742 CCCACAGATCTGAGAGGAGGGGG - Exonic
1097013390 12:55968616-55968638 CTGTCAGCCCAGAGAGGATAAGG - Intronic
1098202225 12:68068367-68068389 CTCACTCCTCAGAGTTGATGGGG + Intergenic
1098633596 12:72754338-72754360 CTCAAAGCTCAGGGGGGACGTGG + Intergenic
1098646771 12:72911523-72911545 CTCACAGTTCCGAAAGGCTGGGG - Intergenic
1099232735 12:80046195-80046217 CACACAGATCAGAAAGGAAGAGG + Intergenic
1099544268 12:83956717-83956739 CTCACAGTTCAGAATGGATGGGG - Intergenic
1099826811 12:87786197-87786219 CTCACAGTTCAGCAAGGCTGGGG - Intergenic
1100394600 12:94173870-94173892 CGCGCAGCTCAGAGAGGAGCGGG - Intronic
1100928227 12:99575205-99575227 CTTACAAGTCAGAGAGGTTGGGG + Intronic
1101748006 12:107558860-107558882 CACACAGCTAAGTTAGGATGTGG + Intronic
1102015442 12:109645108-109645130 CTCCCAGCTCAGAAAGCATTAGG - Intergenic
1102194311 12:111013560-111013582 CTCACTCCTCAGACAGGATAAGG + Intergenic
1102258611 12:111430129-111430151 TTCATAGCTCAGAGAGGACTGGG - Intronic
1102266627 12:111491492-111491514 CTCACAGCTCTGGGAGGAGAGGG + Intronic
1102383876 12:112490555-112490577 CTAACTACTCAGAGAGGCTGAGG - Intronic
1104054160 12:125216616-125216638 CTCACAGAGCAGAGAGAATCAGG - Intronic
1104265553 12:127229179-127229201 CTCTTGGCTGAGAGAGGATGAGG - Intergenic
1104362488 12:128147142-128147164 CTTACAGCTCATAGGGTATGGGG - Intergenic
1104401588 12:128480914-128480936 CTGTCAGCTCAGAGAGGGTGGGG + Intronic
1104820612 12:131675361-131675383 CCCACAGAGCAGAGAGGACGGGG + Intergenic
1105232861 13:18515782-18515804 CACACAGCTCAAAGAGGAGCAGG + Intergenic
1105505918 13:21009760-21009782 CCCACAGGGCAGTGAGGATGAGG + Intronic
1105551065 13:21396180-21396202 CTCACAGCGCCAAGAGGAAGGGG - Intronic
1106506898 13:30378401-30378423 CTCAGAGCTTTGGGAGGATGAGG + Intergenic
1106562283 13:30857116-30857138 CTCACATCTCTGAGAGGGTTTGG + Intergenic
1106760161 13:32859994-32860016 CTCACAGCTCCGGGAGGAGGAGG - Intergenic
1107981402 13:45737602-45737624 CTCACAGTTCCAAGAGGAGGGGG + Intergenic
1108219435 13:48217779-48217801 CTCACAGCTCAGTATGGCTGAGG - Intergenic
1108904792 13:55454936-55454958 CCAGCAGCCCAGAGAGGATGAGG + Intergenic
1109633656 13:65085560-65085582 ATAACAGCTCAGAGAGGACCTGG + Intergenic
1110341227 13:74392939-74392961 CTCACAGCTCCGCGTGGCTGGGG + Intergenic
1110367295 13:74701331-74701353 CTCATAGGTCAGAGAGGTTAAGG + Intergenic
1110550999 13:76811442-76811464 CTCACATAGCAGAGAGGAAGAGG - Intergenic
1110675390 13:78237059-78237081 CTCATAACACAGAGAGAATGTGG + Intergenic
1111536465 13:89608106-89608128 CTCACACCTCTGCGAGGCTGAGG + Intergenic
1113095948 13:106663826-106663848 CTCACATGACAAAGAGGATGAGG - Intergenic
1113185059 13:107678641-107678663 CTCACAGTTCAGTGTGGCTGGGG + Intronic
1113204450 13:107898964-107898986 CACAAAGTTCAGAGATGATGTGG + Intergenic
1114410994 14:22500409-22500431 CTCAAGGCTGAGAGATGATGAGG - Intergenic
1114572938 14:23687382-23687404 CTAACAGCACTGAGAGGCTGAGG - Intergenic
1114775901 14:25480955-25480977 CTCACAGTTCAGCGTGGCTGGGG - Intergenic
1114984120 14:28205769-28205791 CTCACAGTTCTGAGTAGATGGGG + Intergenic
1115457153 14:33616643-33616665 CTCTCAGCGCAGAGGGGCTGAGG + Intronic
1115942871 14:38628390-38628412 CTCACAGTTCAGCAAGGCTGGGG + Intergenic
1116158987 14:41242788-41242810 CTCACAGTTCAGTGTGGCTGAGG + Intergenic
1116414612 14:44665534-44665556 CTCACAGCTCCGCGAGGCTGGGG + Intergenic
1116419843 14:44720205-44720227 CTCCCACCTCAGAGTGGATGAGG + Intergenic
1118825467 14:69376350-69376372 CTCAGAGCTCATACAGGGTGAGG - Intergenic
1119280736 14:73405384-73405406 CCTACAGCTCAGAGAAGATGAGG + Intronic
1119474100 14:74917303-74917325 ACCACAGCTCAGAGAGCAGGGGG + Intronic
1119672336 14:76529201-76529223 TGGACAGCTCAGAGATGATGAGG - Intergenic
1119861694 14:77940620-77940642 CTGACAGCTCCAAGAGGATGGGG - Intergenic
1119982636 14:79099300-79099322 CTCACTGCACAGAGAGGGAGAGG + Intronic
1120033367 14:79667886-79667908 CTCACAGCAGAGAGAAGATATGG - Intronic
1120293291 14:82605509-82605531 CTCACAGTTCAGCGTGGCTGGGG - Intergenic
1120608266 14:86606592-86606614 CTCAGAACTCTGAGAGGCTGGGG - Intergenic
1121019374 14:90569803-90569825 ATCACAGCTGAGAGAGGCTCAGG - Intronic
1121419219 14:93800659-93800681 CTCACAGAGCAGAGGAGATGGGG - Intergenic
1121556741 14:94843760-94843782 CTCACAGTTCAGCGTGGCTGGGG + Intergenic
1121803234 14:96793116-96793138 CTCACAGTTCAGAATGGCTGCGG + Intergenic
1122008023 14:98721868-98721890 CTCACAGTTCAGCAAGGCTGGGG - Intergenic
1122137651 14:99644261-99644283 CTCACTGGACAGAGAAGATGGGG + Intergenic
1122205440 14:100145854-100145876 GCCACAGCTCAGATGGGATGCGG - Exonic
1122613304 14:103000459-103000481 CTCACAGGTCAGAGAGGCCCAGG + Intronic
1202938107 14_KI270725v1_random:112031-112053 CACACAGCTCAAAGAGGAGCAGG - Intergenic
1123395088 15:19925859-19925881 CACACAGCTCAAAGAGGAGCAGG + Intergenic
1124594607 15:31082412-31082434 ATCACAGCTCAGAGGGGTTGGGG - Intronic
1125550277 15:40539712-40539734 CTGACATCTCAGAGAGCAGGAGG - Intronic
1127595691 15:60479579-60479601 CTCACAGCTAAAACTGGATGGGG - Intergenic
1128751564 15:70154027-70154049 CACACAGGACGGAGAGGATGGGG - Intergenic
1131636514 15:94238608-94238630 CTGTAAGCTCTGAGAGGATGAGG - Intronic
1131892297 15:96985098-96985120 CGCTGAGCTCAGATAGGATGTGG + Intergenic
1132731744 16:1366293-1366315 CACACGGCTCACAGAGGATGTGG + Intronic
1132816884 16:1833486-1833508 CTGACAGATCTGACAGGATGAGG - Intronic
1132996271 16:2825054-2825076 CTCACAGTTCAGCGTGGCTGGGG + Intronic
1133116797 16:3582199-3582221 ATCACAGCGCAGAGCTGATGTGG + Exonic
1133905250 16:10016347-10016369 CACACAGCTCAAACAAGATGGGG + Intronic
1134283753 16:12841830-12841852 ATCCCAGCTCAGGGAGGCTGAGG - Intergenic
1135060473 16:19267220-19267242 CTCTCAGTTCTGAGAGGATTTGG - Exonic
1135088052 16:19490551-19490573 CTCACAGCACAATGAGGGTGAGG - Exonic
1135489815 16:22899642-22899664 CTCACAGTTCAGCGTGGCTGAGG + Intronic
1136077290 16:27825911-27825933 CTCACAGTTCAGAAGGGCTGGGG - Intronic
1136701190 16:32144288-32144310 CACACAGCTCAAAGAGGAGCAGG + Intergenic
1136766470 16:32783174-32783196 CACACAGCTCAAAGAGGAGCAGG - Intergenic
1136801628 16:33087204-33087226 CACACAGCTCAAAGAGGAGCAGG + Intergenic
1136948371 16:34684329-34684351 CACACAGCTCAAAGAGGAGAAGG + Intergenic
1137088166 16:36155087-36155109 CACACAGCTCAAAGAGGAGCAGG + Intergenic
1137092674 16:36214288-36214310 CACACAGCTCAAAGAGGAGCGGG + Intergenic
1137220525 16:46445278-46445300 CACACAGCTCAAAGAGGAGCGGG - Intergenic
1138648420 16:58442472-58442494 CTCACAGATCCCAGAGGAGGAGG + Intergenic
1139032367 16:62900509-62900531 CTCACAGTTCAGAATGGCTGGGG - Intergenic
1139291723 16:65864483-65864505 CTCTCAGCAGAGAGGGGATGTGG - Intergenic
1140114016 16:72026200-72026222 ATCAAAGCCCAGAGAGAATGAGG - Intronic
1140456182 16:75106921-75106943 CTCAGAGGTGAGCGAGGATGAGG - Intronic
1141575602 16:84961585-84961607 ACCACAGCTCACAGAGGTTGAGG - Intergenic
1141661959 16:85446291-85446313 CTCACAGCTGAGAGACCATGAGG - Intergenic
1142238042 16:88931848-88931870 GTCACAGTGCAGAGGGGATGGGG + Intronic
1142432181 16:90035385-90035407 CCCACAGCTCTGTGTGGATGTGG + Intronic
1203068859 16_KI270728v1_random:1045424-1045446 CACACAGCTCAAAGAGGAGCAGG - Intergenic
1142649559 17:1339071-1339093 CTCAGTGCTCAGAGAGGCTGAGG + Intergenic
1143973019 17:10809359-10809381 CTCACAGCTCAGCATGGCTGGGG - Intergenic
1144819706 17:18063531-18063553 CCCAGGGCTCAGAGGGGATGAGG - Intronic
1145270477 17:21402066-21402088 CACACAGCTCAGAAAGGGAGGGG - Intronic
1145308687 17:21689463-21689485 CACACAGCTCAGAAAGGGAGGGG - Intergenic
1145691713 17:26748262-26748284 CACACAGCTCAAAGAGGAGCAGG + Intergenic
1145708446 17:26944889-26944911 CACACAGCTCAAAGAGGAGCAGG + Intergenic
1145963562 17:28901524-28901546 CTCAGAGCTCAGAAAGGCAGTGG + Exonic
1146488540 17:33263249-33263271 CTCACAGCTTAGAGAGACAGCGG - Intronic
1146651896 17:34612279-34612301 CTCAAAGCGCAGAAAGGAAGTGG + Intronic
1146911012 17:36648557-36648579 CCCACAGCCTAGAGAGGGTGTGG - Intergenic
1147171352 17:38620952-38620974 GTCACAGCACTGAGAGGCTGAGG - Intergenic
1148344569 17:46894831-46894853 CTCACACATCAGAGTGGAGGGGG - Intergenic
1148771922 17:50072282-50072304 CCCACAGATGAGACAGGATGGGG + Intronic
1149016462 17:51914100-51914122 CTCAGGGCTCAGAGTGGATCAGG - Intronic
1149038329 17:52158757-52158779 TTCCCAACTCAGAGAGGAGGAGG + Intronic
1149113666 17:53064321-53064343 CTCACAGGTCAGCATGGATGTGG - Intergenic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1150971425 17:70032437-70032459 CTCACAGTTCAGTGTGGCTGGGG + Intergenic
1151005211 17:70427862-70427884 GTCACAGCTGAGATAGTATGGGG + Intergenic
1152411886 17:80129700-80129722 CTCACAGTTCAGTGTGGCTGGGG + Intergenic
1203183228 17_KI270729v1_random:85809-85831 CACACAGCTCAGAGAGGAGCAGG + Intergenic
1154520441 18:15222670-15222692 CACACAGCTCAAAGAGGAGCAGG - Intergenic
1155427772 18:25724095-25724117 CCTACAGCTAAGAGAGCATGGGG + Intergenic
1155552690 18:26982613-26982635 CTCACAGTTTAGAAGGGATGGGG + Intronic
1155943101 18:31819427-31819449 CTCACAGTTCAGCGTGGCTGGGG - Intergenic
1156566957 18:38202669-38202691 CTCACAGTTCAGCGTGGCTGGGG + Intergenic
1156751343 18:40459605-40459627 CTCACACCTCAAAGAGTAGGTGG + Intergenic
1157909040 18:51597828-51597850 CTCTCAGTTGAGAGGGGATGTGG + Intergenic
1158962920 18:62601385-62601407 CCCACAGCTCAGGGGGCATGTGG + Intergenic
1159286884 18:66365538-66365560 CTCACAGTTCAGCCTGGATGTGG + Intergenic
1159393495 18:67826589-67826611 CTCACAGCTCTGCAAGGCTGAGG - Intergenic
1159420954 18:68218976-68218998 CTCACAGCTCTGCGTGGCTGGGG + Intergenic
1159875044 18:73801231-73801253 CTCACAGTTCAGCGTGGCTGGGG - Intergenic
1160365599 18:78323621-78323643 CATATAGCTCAGAGAGGTTGTGG + Intergenic
1160412847 18:78686722-78686744 CACACAGCACAGGGAGGGTGTGG - Intergenic
1160846547 19:1168571-1168593 CTCACAGCGTAGGGAGGCTGCGG + Intronic
1160895949 19:1401821-1401843 CTCACACCCCAGCGAGGAGGGGG - Intergenic
1161239505 19:3214235-3214257 CCCACAGCTTTGAGAGGCTGAGG - Intergenic
1161642222 19:5431450-5431472 GTCAAAGCTCTGAGAGGATGCGG - Intergenic
1162870679 19:13584222-13584244 TTCAGTGCTCAGAGAGGCTGTGG + Intronic
1162966533 19:14158863-14158885 CTCACAGCTCAGAGAGGATGGGG - Intronic
1166294273 19:41881315-41881337 CTGACAGATCAGGGAGGAGGGGG - Exonic
1166532595 19:43552081-43552103 CTCGCAGCTCGGAGCGGAAGGGG + Exonic
1167178018 19:47879414-47879436 CTCACAGTTCAGTGTGGCTGGGG + Intronic
1167254182 19:48417485-48417507 CTCACACTTCAGAGAGCAAGTGG - Intronic
1167254357 19:48418470-48418492 CACACAGCACAGAGAGGACCTGG - Intronic
1168115711 19:54220492-54220514 CTTTGAGCTCAGAGAGGACGGGG + Intronic
1168118697 19:54240238-54240260 CTTTGAGCTCAGAGAGGACGGGG + Intronic
1168121480 19:54254582-54254604 CTCACCCCTCAGAGGGGAGGAGG - Intronic
1168188320 19:54716478-54716500 CTCACTTCTCAGAGTGGTTGTGG - Intergenic
1202681701 1_KI270712v1_random:11121-11143 CACACAGCTCAAAGAGGAGAAGG + Intergenic
925446734 2:3932773-3932795 CTCACAGTTCAGCGTGGCTGGGG + Intergenic
925641820 2:5992792-5992814 CTCAGAGCTCAGTGAGGTGGAGG - Intergenic
926375160 2:12219950-12219972 CTCACTGGTAAGACAGGATGTGG - Intergenic
928040434 2:27870531-27870553 CGCACAGCTCTGTGAGGAGGTGG - Intronic
928082262 2:28321822-28321844 CTCACTGCTTGGAGAGGAGGAGG + Intronic
928800114 2:35079164-35079186 CTCACAGTTCAGCGTGGCTGGGG + Intergenic
928827895 2:35442107-35442129 CTCACAGAGCAAAGAGGAAGAGG + Intergenic
929917977 2:46151971-46151993 CTCTGAGCTAAGATAGGATGAGG + Intronic
932717325 2:74111058-74111080 CACAGAGGTCAGTGAGGATGAGG - Intergenic
932930678 2:76034371-76034393 CTCACAGTTCAGCGTGGCTGTGG + Intergenic
934196920 2:89844841-89844863 GTTACTGCTCAGAGAGAATGAGG - Intergenic
934250067 2:90343931-90343953 CACACAGCTCAAAGAGGAGCAGG - Intergenic
934259500 2:91459485-91459507 CACACAGCTCAAAGAGGAGCAGG + Intergenic
934302797 2:91791406-91791428 CACACAGCTCAAAGAGGAGCAGG + Intergenic
934330461 2:92061360-92061382 CACACAGCTCAAAGAGGAGCAGG - Intergenic
934468685 2:94291246-94291268 CACACAGCTCAAAGAGGAGCAGG - Intergenic
935228491 2:101075702-101075724 CTCACAGCTCAGCATGGCTGGGG - Intronic
935983870 2:108653536-108653558 CACACTGCCCTGAGAGGATGGGG + Intronic
936055773 2:109260895-109260917 CTCACAGCAGAGGCAGGATGGGG - Intronic
937353722 2:121185134-121185156 CTTTAAGCACAGAGAGGATGTGG + Intergenic
937871180 2:126787488-126787510 CTCCCAGCTCATAGATGATGGGG - Intergenic
938588630 2:132716064-132716086 GTCACAGCTCAGAGAGGGAAGGG - Intronic
940053560 2:149489841-149489863 CTCAAAAATCAGAGGGGATGGGG + Intergenic
940204113 2:151183643-151183665 CTGGCAGCTCAAAGAGGAGGAGG - Intergenic
940386911 2:153084728-153084750 CTCACAGCTCAGCATGGCTGGGG - Intergenic
940393668 2:153162927-153162949 ATTACAGCTGAGAGAGGCTGGGG + Intergenic
940837168 2:158535668-158535690 CTCACACTTTAGAGAGGCTGAGG - Intronic
940853386 2:158709170-158709192 ATTACAGGTTAGAGAGGATGTGG - Intergenic
941689925 2:168490278-168490300 CTCACAGGCCAAAGAGGATGGGG - Intronic
942829610 2:180224259-180224281 CTCACAGTTCAGCGTGGCTGGGG - Intergenic
943483677 2:188454232-188454254 CTCTCAGCAGAGAGGGGATGTGG + Intronic
944480245 2:200149825-200149847 GGCACAGCTGAGAGTGGATGAGG + Intergenic
944684249 2:202104403-202104425 CTCACAGTTCCAAGAGGAGGAGG + Intronic
945265733 2:207889628-207889650 CTCAAAGCTCAGACTGGAAGAGG + Intronic
946292487 2:218755763-218755785 TCCAAAGCTCAGAGAGAATGGGG - Intergenic
946986003 2:225274000-225274022 CTCACAGCTCAGCATGGCTGAGG - Intergenic
947208108 2:227681003-227681025 CTCACAGCTCAGCATGGCTGGGG + Intergenic
947227752 2:227856728-227856750 CTCACAGCTCAGAGAGGACTTGG + Intergenic
947446100 2:230163706-230163728 CCTACAGCTCAGAGAGTCTGGGG + Intergenic
947812643 2:233014261-233014283 CTGACAGCTGAGAGGGGCTGAGG - Intronic
948412214 2:237772716-237772738 CTCTCAGCTCTGGGAGGTTGTGG + Intronic
948912955 2:241014257-241014279 CTCACACCTTTGAGAGGCTGAGG - Intronic
1170004515 20:11651271-11651293 CACACAGAGCAGAGAGGAAGTGG + Intergenic
1172363610 20:34332322-34332344 CTCACAGCGGAGAGGGGATGTGG - Intergenic
1172940402 20:38650024-38650046 CTCTCCACTCAGAGGGGATGAGG + Exonic
1172945581 20:38685764-38685786 CCCAAAGCTCAGATAGGATATGG - Intergenic
1173667768 20:44774945-44774967 CTGAGAGATCAGAGAGGGTGTGG - Intronic
1174034692 20:47661425-47661447 CACACAAGTCAGCGAGGATGGGG + Intronic
1174683534 20:52431393-52431415 CTCACAGTTCAGCGTGGCTGGGG + Intergenic
1175376314 20:58527105-58527127 CTCACAGTTCAGCAAGGCTGGGG + Intergenic
1175603291 20:60292371-60292393 CTCACAGTTCAGCAAGGCTGCGG - Intergenic
1176376805 21:6090798-6090820 CTCCCAGCCCTGAGAGGCTGGGG - Intergenic
1176585208 21:8577105-8577127 CACACAGCTCAAAGAGGAGCAGG + Intergenic
1176674856 21:9768370-9768392 GCCAAAGCTCAGGGAGGATGAGG - Intergenic
1176776841 21:13144084-13144106 CACACAGCTCAAAGAGGAGCAGG + Intergenic
1177603355 21:23344841-23344863 CTCACAGCTCAGCATGGCTGGGG - Intergenic
1177784269 21:25653478-25653500 CTCACAGTTCAGTGTGGCTGGGG + Intronic
1178219316 21:30638042-30638064 CTCACAGCTCAGCATGGCTGCGG - Intergenic
1178683159 21:34690181-34690203 CTCACAGCTCAGAGAGGGTGAGG + Intronic
1178928880 21:36799707-36799729 CTTACAGATGAGAGAGGCTGGGG - Intronic
1179281395 21:39937214-39937236 CCTAAGGCTCAGAGAGGATGAGG + Intergenic
1179746670 21:43447446-43447468 CTCCCAGCCCTGAGAGGCTGGGG + Intergenic
1179779777 21:43691994-43692016 CTCACAGCCCTTTGAGGATGAGG - Intronic
1180183576 21:46128763-46128785 CTCACATCCCAGAGAGGCTGAGG + Intronic
1180268016 22:10554005-10554027 CACACAGCTCAAAGAGGAGCAGG + Intergenic
1181771358 22:25128036-25128058 ATCACAACTCAAAGAGGTTGAGG - Intronic
1181808721 22:25390852-25390874 CTCTCATCCCAGAGACGATGGGG + Intronic
1182165712 22:28170916-28170938 CTCTCTGCACAGAGAGGCTGGGG - Intronic
1182520433 22:30881724-30881746 CCCACAGCACAGCCAGGATGGGG + Intronic
1183212051 22:36457256-36457278 CTCACAGCACAGTAGGGATGGGG + Intergenic
1183417449 22:37690777-37690799 CTCACCGCTGAGAGAGCAGGGGG - Exonic
1184667256 22:45995536-45995558 CTCACCGCTCACAGAAGCTGAGG - Intergenic
1185008121 22:48297517-48297539 CTCACAGCTCAGCTTGGCTGGGG - Intergenic
1185042183 22:48510713-48510735 CTCAGAGCACAGGGAGCATGGGG - Intronic
1203237050 22_KI270732v1_random:14301-14323 CACACAGCTCAAAGAGGAGCAGG + Intergenic
1203290714 22_KI270735v1_random:35621-35643 CACACAGCTCAAAGAGGAGCAGG - Intergenic
1203323549 22_KI270737v1_random:93453-93475 CACACAGCTCAAAGAGGAGCAGG - Intergenic
949420851 3:3864394-3864416 CTCACAGTTCAGCAAGGCTGGGG + Intronic
950316086 3:12003583-12003605 CTCACTGGTCAGTGAGGAGGGGG + Intergenic
951194030 3:19804116-19804138 ATCTCTGCACAGAGAGGATGGGG - Intergenic
954106381 3:48411877-48411899 CCGCCTGCTCAGAGAGGATGTGG - Exonic
954384735 3:50238095-50238117 CTCACAGCAGAGACAGGAAGAGG - Intronic
955571073 3:60307155-60307177 CTCTCATCTCACAGAGGAGGAGG + Intronic
955578963 3:60398017-60398039 CTCTCAGCAAAGAGGGGATGTGG - Intronic
955648994 3:61172833-61172855 TTCACAGCTGAGACAGGAAGAGG - Intronic
956015657 3:64880180-64880202 CTCACAGCTCAGCATGGCTGGGG + Intergenic
958170037 3:89927836-89927858 CTTTCAGCAGAGAGAGGATGTGG - Intergenic
958539671 3:95454612-95454634 CTCCCAGCTCTGAGAGGCTGAGG + Intergenic
959145208 3:102535687-102535709 CTCAGAGCTCAGAGAGAGTAGGG - Intergenic
960061139 3:113322876-113322898 CTCACAGCTCAGCATGGCTGGGG + Intronic
960332694 3:116382011-116382033 CATATAGCTAAGAGAGGATGTGG + Intronic
961054476 3:123776273-123776295 CTCACAGATCAGGGAGCAGGTGG + Intronic
961791806 3:129381654-129381676 CTCACAGCTTTGTGAGGATGGGG - Intergenic
961805830 3:129488613-129488635 CTCACAGCTTTGTGAGGATGGGG - Intronic
962204305 3:133422564-133422586 TCCACTGCTCAGAGATGATGGGG - Intronic
962900872 3:139760459-139760481 AGCACAGTTCAGAGAGGATGAGG - Intergenic
963251052 3:143103904-143103926 CTTTCAGCAGAGAGAGGATGTGG - Intergenic
965548362 3:169938231-169938253 CACACATCACAGAGAGGCTGAGG - Intronic
966311177 3:178595705-178595727 CTCACAGCTCAGCATGGCTGGGG - Intronic
966389240 3:179434468-179434490 CTCAGAGCTTTGAGAGGCTGAGG + Intronic
967320321 3:188189048-188189070 CTCACAGCTTGGAGAGGATGTGG + Intronic
968095133 3:195924131-195924153 CTGCCAGCTCTGAGAGGAGGAGG + Intergenic
968298553 3:197595727-197595749 CTCACATCACAGGGAGGAAGTGG - Intergenic
968862318 4:3182678-3182700 CCCACAGCTCCGAGAGGTTATGG + Intronic
969198686 4:5584510-5584532 CCCACAGCACAGACAGGACGGGG + Intronic
969686042 4:8674821-8674843 TCCCCAGCTCAGAGAGGGTGGGG + Intergenic
969871224 4:10106424-10106446 CTCACAGCTGACTGGGGATGGGG + Intronic
969905053 4:10386021-10386043 CTCAAAGATCAGAGAGGAAAGGG + Intergenic
972337292 4:38118528-38118550 CTCACAACCCAGAGTGGCTGAGG - Intronic
974062420 4:57047343-57047365 CTCACAGCTCCATGAGGCTGGGG - Intronic
974117844 4:57602348-57602370 CTGACAGCTCAGACAGGTTCTGG + Intergenic
974763281 4:66307134-66307156 CTCACAGTTCAGCATGGATGAGG - Intergenic
975609383 4:76189348-76189370 CTCACAGCTCAGCATGGCTGGGG + Intronic
976529000 4:86128559-86128581 CTCACAGCTCAGGATGGCTGGGG - Intronic
976871864 4:89803858-89803880 CTCACAGCTCAGCATGGCTGAGG - Intronic
980386220 4:132090197-132090219 CTCACAGCTCAGCATGGCTGGGG - Intergenic
983120980 4:163884457-163884479 CTCAGAGGTAAGAGAGGCTGGGG - Intronic
983320375 4:166189547-166189569 CACACAGCTCAGTGAGCAAGAGG + Intergenic
983889655 4:173017107-173017129 CTCACAGCTCAGCATGGCTGGGG - Intronic
983955856 4:173698213-173698235 CTCAGAGGTCAGAGAGAATGTGG + Intergenic
984371028 4:178864242-178864264 CTCTCAGCTGAGAGGGGATGTGG + Intergenic
986274771 5:6264009-6264031 CTCACAGTTCAGCGTGGTTGGGG - Intergenic
986991973 5:13564763-13564785 GTCACAGCTCAGCAAGGCTGGGG - Intergenic
987898894 5:23984803-23984825 TCCACAGCTCAGAGAGGCTCAGG - Intronic
988163014 5:27544979-27545001 CTCACAGCTCAGCATGGTTGAGG - Intergenic
989170550 5:38467706-38467728 GTCGGAGCTCAGAGAGGCTGGGG - Intergenic
989205503 5:38805434-38805456 CTCCCAGCTCAGGGAGGGTCTGG + Intergenic
989300596 5:39887617-39887639 CTCAAAACTCAGAGATAATGGGG - Intergenic
989547435 5:42690774-42690796 CTGACACCACAGAGAGGTTGGGG + Intronic
991023696 5:62007675-62007697 GTCACAGCTGAGTGAGGGTGGGG - Intergenic
992817747 5:80462270-80462292 CTCACAGTTCAGCGTGGCTGGGG + Intronic
994108016 5:95967734-95967756 CTCACAGTTCAGTGTGGCTGGGG - Intergenic
995396624 5:111693871-111693893 ATCTCAGCTGAGAGAGGCTGAGG + Intronic
995630632 5:114128247-114128269 CTCACAGTTCAGCGTGGCTGGGG + Intergenic
996890013 5:128407469-128407491 CTCACAGCTATGAGATAATGAGG + Intronic
996973320 5:129399154-129399176 CTCATACCTCAGATAGTATGTGG + Intergenic
997625055 5:135326070-135326092 GTCACAGCTCAGAGGGGAACTGG - Intronic
999051590 5:148529532-148529554 CTCACAGTTCAATGTGGATGGGG - Intronic
999383480 5:151138291-151138313 CCCAAAGCCCAGAGAGGATTTGG - Intronic
1000026048 5:157360195-157360217 CTGAGACCTCTGAGAGGATGGGG - Intronic
1000195343 5:158951794-158951816 CTTACAGGTCAGAGACAATGAGG + Intronic
1000268423 5:159659864-159659886 CAGACCTCTCAGAGAGGATGAGG + Intergenic
1001713473 5:173795846-173795868 CTCAGAGCTCTGAGATGGTGAGG + Intergenic
1002186585 5:177457555-177457577 CCCACCGCTCACAGAGGCTGGGG - Intronic
1002259087 5:177981945-177981967 TTCAGAGCCCAGAGAGGTTGGGG + Intergenic
1002958070 6:1888290-1888312 CTCACAGTTCAGCAAGGCTGGGG + Intronic
1003741092 6:8940739-8940761 CACTTAGCTCAGAGATGATGAGG + Intergenic
1004875529 6:19948628-19948650 CTCACAGTTCAGCATGGATGGGG + Intergenic
1006499610 6:34449491-34449513 CGCAAAGATGAGAGAGGATGAGG + Intergenic
1007108021 6:39296701-39296723 CTCACCGGTCAGAGAGGGTGGGG + Intergenic
1007387338 6:41528697-41528719 ATCACAGCTCAGAGTGGGTTTGG + Intergenic
1007914424 6:45547682-45547704 TTCAAAGCACAGAGAGGAAGCGG - Exonic
1008337340 6:50323676-50323698 CTCACAGCTCAGCATGGCTGAGG + Intergenic
1008366077 6:50682174-50682196 CTGACAGATCAGGAAGGATGAGG - Intergenic
1010250866 6:73705760-73705782 CTCTCAGGTCAGAGAAGAGGAGG + Intronic
1010294565 6:74181605-74181627 CTCTCAACAAAGAGAGGATGTGG + Intergenic
1011551443 6:88534486-88534508 CTCACAGTTCAGCGTGGCTGGGG + Intergenic
1012103747 6:95125871-95125893 CTCAAAGCCCTGAGAGAATGGGG + Intergenic
1014826124 6:126050450-126050472 CTCAGAGCTTTGAGAGGCTGAGG + Intergenic
1014878181 6:126686938-126686960 CTCACAGATCAGAAGGGATTAGG + Intergenic
1015001618 6:128223415-128223437 ACCACAACTCAGAGAGGCTGAGG + Intronic
1015343946 6:132133274-132133296 CACACAGCACAGAGAGCCTGAGG - Intergenic
1015873944 6:137803671-137803693 CTCACAGCTTCAAGTGGATGGGG - Intergenic
1016097936 6:140061046-140061068 CTCACAGGTCAGGGAAGAGGTGG - Intergenic
1016219182 6:141645860-141645882 CTCACAGTTCAGCGTGGCTGGGG - Intergenic
1017021237 6:150142491-150142513 CTCACAATCCAGAGAGGAAGTGG + Intergenic
1018072109 6:160173981-160174003 CTCCCTGCTCAGGGAGGGTGAGG + Intronic
1018380424 6:163253886-163253908 CTCCCAGCTCTGAGAGGGAGGGG + Intronic
1019446677 7:1074863-1074885 CTCACAGATCAGAGAGCAGAGGG + Intronic
1020051579 7:5085484-5085506 CTCACACCTCAGGGAGGGAGTGG + Intergenic
1021138674 7:16996386-16996408 CTCACAGTTCAGCGTGGCTGAGG + Intergenic
1021287288 7:18796217-18796239 CTCTGAGATCACAGAGGATGAGG + Intronic
1022942006 7:35250082-35250104 CTCAGTGCACAGAGAGGAGGAGG + Exonic
1023208297 7:37775363-37775385 CTCACAGCTCAGCATGGCTGGGG - Intronic
1023452223 7:40299275-40299297 CTCTCTCCTCAGACAGGATGTGG - Intronic
1023587905 7:41750304-41750326 CTCTCAGCTAAGAAAGGATTTGG - Intergenic
1024351236 7:48367042-48367064 TTTAGAGCTCAGAGAGTATGTGG + Intronic
1024420181 7:49157024-49157046 CTCACAGTTCAGCGTGGCTGGGG + Intergenic
1024805899 7:53139385-53139407 CACACAGCTCAAAGAGGAGTAGG - Intergenic
1024977031 7:55122757-55122779 TTTTCAGCTAAGAGAGGATGAGG - Intronic
1025480169 7:60973035-60973057 CACACAGCTCAAAGAGGAGCAGG + Intergenic
1025488757 7:61084813-61084835 CACACAGCTCAAAGAGGAGCAGG - Intergenic
1025557553 7:62328042-62328064 CACACAGCTCAAAGAGGAGCAGG - Intergenic
1025885819 7:65590443-65590465 CACACAGCTCAAAGAGGAGCAGG - Intergenic
1026216461 7:68353740-68353762 CTCACAGTCCCGAGAGGAGGGGG + Intergenic
1026873621 7:73867726-73867748 CTTACAGCTCAGGGTGGATGTGG + Intergenic
1026891706 7:73986255-73986277 ATCCCAGCTCAGGGAGGGTGGGG + Intergenic
1027507835 7:79040296-79040318 CTCACAGTTCAGAATGGCTGGGG - Intronic
1027782497 7:82536826-82536848 CTCACAGTTCTGAGTGGCTGGGG - Intergenic
1028438432 7:90831225-90831247 CTCACAGTTCAGCAAGGGTGGGG + Intronic
1028472966 7:91224417-91224439 CCCACAGTTCAGGGAGGATCTGG + Intergenic
1028635774 7:92987584-92987606 CTCACAGCTCCTAGAGCTTGGGG - Intergenic
1029626724 7:101724541-101724563 CTCACAGGCCAGGGAGGATCTGG - Intergenic
1030063866 7:105644055-105644077 CTCTCAGCTCAGAGATGACTGGG - Intronic
1030907524 7:115205650-115205672 CTCACAGTTCAGCATGGATGTGG + Intergenic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1032078332 7:128846556-128846578 CTCACCCCTGAGAGAGGATGGGG - Intronic
1032504008 7:132422279-132422301 CTCTCACCTCAGAGAGCAAGAGG + Intronic
1032855358 7:135829302-135829324 TTCAGAGCAGAGAGAGGATGTGG + Intergenic
1033578690 7:142711864-142711886 ATATCCGCTCAGAGAGGATGTGG - Intergenic
1033592128 7:142818070-142818092 GACACAGCTCAGAGAAGAGGAGG + Intergenic
1033911731 7:146272117-146272139 CTCACAGTTCAGAATGGCTGGGG + Intronic
1034031619 7:147772920-147772942 ATCACAGGTCAAAGAGGGTGTGG - Intronic
1034237399 7:149583048-149583070 CTCACAGCTCCAAGAGGGTCTGG - Intergenic
1034240419 7:149606419-149606441 CTCACAGCTCCAAGAGGGTCTGG - Intergenic
1035829063 8:2675072-2675094 CTCACAGCTTCCAGAGGTTGTGG + Intergenic
1036416107 8:8550181-8550203 CTCCCACTTCAGGGAGGATGTGG + Intergenic
1036526707 8:9541659-9541681 CTCGCATGTCAGAGACGATGTGG - Intergenic
1036636917 8:10557531-10557553 CTCACAGCCCAGGCAGGACGGGG - Intergenic
1036980648 8:13466318-13466340 CTCACAGATCACAGAGAAAGAGG - Intronic
1037389652 8:18380313-18380335 CTCACAGTTCTGAGTGGCTGGGG + Intergenic
1040721563 8:50330317-50330339 CTCACAGTTCAGCAAGGCTGGGG - Intronic
1042265917 8:66909217-66909239 CTCACAGTTCAGCGTGGCTGGGG - Intronic
1043146413 8:76661301-76661323 CTCACAGCTCCATGTGGATGGGG + Intergenic
1043345981 8:79297778-79297800 CTCACAATTCAGCAAGGATGGGG - Intergenic
1043625242 8:82248946-82248968 CTCACAGTTCAGAATGGCTGGGG - Intergenic
1044092761 8:88022541-88022563 CTCACAGTTCAGCGTGGCTGAGG - Intergenic
1047147059 8:122214226-122214248 CTCACAGGGCAGGGAGGAAGAGG - Intergenic
1047173904 8:122522331-122522353 CTCAAGGCTCAGAGAGAATAAGG + Intergenic
1047208661 8:122822935-122822957 CTCACAGCTGAAATCGGATGAGG - Intronic
1047576145 8:126157650-126157672 CTAGCATCTCAGAGAGGGTGAGG + Intergenic
1047665313 8:127085418-127085440 CTCACAGTTCAGCGTGGCTGGGG - Intergenic
1048457988 8:134595415-134595437 CTCACAGCCCAAAGAGGCAGAGG + Intronic
1048687425 8:136919594-136919616 CTCACAGCTCAGTGAATAGGGGG + Intergenic
1048988912 8:139750053-139750075 CTCCCAGCTGAGATGGGATGGGG - Intronic
1050482060 9:6097535-6097557 CTTTCAGCAGAGAGAGGATGTGG - Intergenic
1050544499 9:6698315-6698337 CTCAGTGCTCTGAGAGGCTGAGG - Intergenic
1051371540 9:16363375-16363397 CTCACAGTTATGTGAGGATGAGG - Intergenic
1051536485 9:18164092-18164114 CTCACATCTGTGAGAGGAGGGGG + Intergenic
1051924803 9:22310780-22310802 CTTACTGCTCAGAGATCATGTGG - Intergenic
1052428773 9:28338800-28338822 CTCACAGTTCAGGGTGGCTGAGG - Intronic
1053512851 9:38703619-38703641 CTCACAGGTCCCAGAGGAGGGGG - Intergenic
1053699075 9:40669278-40669300 CACACAGCTCAAAGAGGAGCAGG - Intergenic
1053945085 9:43299522-43299544 CACACAGCTCAAAGAGGAGCAGG - Intergenic
1054117418 9:61178811-61178833 CTCACAGCTCCATGAGGCTGGGG - Intergenic
1054310364 9:63468679-63468701 CACACAGCTCAAAGAGGAGCAGG - Intergenic
1054409153 9:64792829-64792851 CACACAGCTCAAAGAGGAGCAGG - Intergenic
1054442316 9:65276646-65276668 CACACAGCTCAAAGAGGAGCAGG - Intergenic
1054487965 9:65744850-65744872 CACACAGCTCAAAGAGGAGCAGG + Intergenic
1054590337 9:67003755-67003777 CTCACAGCTCCATGAGGCTGGGG + Intergenic
1054959120 9:70947628-70947650 CTCAGAGCTCAGAGAAGGTGGGG + Intronic
1057888996 9:98853742-98853764 CTCACAGATCAGAGAGGCCGGGG + Intergenic
1057967212 9:99515961-99515983 CTCACAGCTCTGAGAAGCTCTGG - Intergenic
1058566375 9:106289518-106289540 TTGACAGCTGAGAGAGGCTGTGG + Intergenic
1058575080 9:106392391-106392413 GTCACAGCTCAGAGAGGTTAAGG - Intergenic
1060050029 9:120371952-120371974 CTGACAGCTCAGAGAGGGAAAGG - Intergenic
1060237882 9:121878885-121878907 CCCACAGCCCAGGGAGGAGGAGG - Intronic
1060299040 9:122363278-122363300 ATCCCAGCTCAGGGAGGCTGAGG - Intergenic
1060392120 9:123286620-123286642 CACACAGCTGAGAGAGGACAGGG + Intergenic
1060422450 9:123479041-123479063 CTCTCCTCTCAGAGAGGGTGGGG + Intronic
1060516851 9:124271311-124271333 CCCAGAGATCAGAGAGGGTGAGG + Intronic
1060554631 9:124501919-124501941 CTCTCAGCCCAGAGAGGAGGAGG - Intronic
1061397112 9:130349268-130349290 CTGATAGCTCTGTGAGGATGGGG - Intronic
1061423010 9:130482297-130482319 CTGACAGCTCCCAGAGGATGGGG - Intronic
1061512935 9:131071813-131071835 CTCTAAGCTCAGTGAGGATGGGG + Intronic
1061901379 9:133673926-133673948 CCAGCAGCTCAGCGAGGATGGGG + Intronic
1062089367 9:134666925-134666947 CTCACATCTCCTCGAGGATGGGG + Intronic
1062536950 9:137025277-137025299 CCCCCAGCTCAGGGAGGAGGAGG + Intronic
1203581083 Un_KI270746v1:5616-5638 CACACAGCTCAAAGAGGAGCAGG + Intergenic
1203588220 Un_KI270747v1:28100-28122 CACACAGCTCAAAGAGGAGCAGG - Intergenic
1185731176 X:2463198-2463220 CTCCCTACTCAGAGAGGCTGTGG + Intronic
1186046554 X:5543016-5543038 CTCACAGTTCAGAATGGCTGGGG + Intergenic
1186163692 X:6804830-6804852 CTCCCAGTTCAGAGAGGAGAAGG + Intergenic
1186330474 X:8527031-8527053 ATCAAAGATCAGAGAGGCTGGGG - Intergenic
1186407101 X:9313728-9313750 CACACTGCTCAGAGAGGTGGTGG + Intergenic
1186461115 X:9749330-9749352 CTCACAGTTCAGCGTGGCTGGGG - Intronic
1186686280 X:11928281-11928303 CTCACAGTTCAGCGTGGCTGGGG + Intergenic
1186783777 X:12940332-12940354 CTCACAGAGCAGAGAGCAGGAGG - Intergenic
1187398026 X:18934920-18934942 GCCTCAGCTCAGAGAGGCTGTGG - Intronic
1188018905 X:25135462-25135484 CTCACAGCTCAGCATGGCTGGGG - Intergenic
1188802732 X:34551554-34551576 CTCACAGTTCAGCATGGATGGGG - Intergenic
1189257311 X:39650587-39650609 CTCACAGTTCAGCAAGGCTGGGG - Intergenic
1192155827 X:68745894-68745916 CTCACAGTTCAGCGTGGCTGGGG - Intergenic
1192526300 X:71847678-71847700 ATCAAAGGTTAGAGAGGATGCGG + Intergenic
1194365369 X:93007483-93007505 CTCACAGCTCTGCGTGGCTGGGG + Intergenic
1194507215 X:94746953-94746975 CTCACAGTTCAGCGTGGCTGGGG - Intergenic
1194815958 X:98441457-98441479 CTCACAAGTCAGAAAGGATTGGG + Intergenic
1195645798 X:107229467-107229489 CTCACTCCTCAGTGAGAATGGGG - Intronic
1196507465 X:116464022-116464044 CTCACAAATCAGAGTGGAGGTGG - Intergenic
1197383497 X:125775010-125775032 TTCTCAGCAAAGAGAGGATGTGG + Intergenic
1197397207 X:125941346-125941368 CTCTCAGCAGAGAGAGGATGTGG + Intergenic
1198439602 X:136650342-136650364 CTCACAGTTCAGTAAGGATAAGG - Exonic
1198571933 X:137966689-137966711 CTCCCAGATCTGGGAGGATGTGG - Intergenic
1198679529 X:139166396-139166418 CTCACAGCTCAGTATGGCTGGGG - Intronic
1198838457 X:140830307-140830329 CTGGCAGGGCAGAGAGGATGGGG + Intergenic
1198865755 X:141121144-141121166 CTCACAGTTCAGCATGGATGGGG - Intergenic
1199453191 X:147996571-147996593 CTCACACCACAGCGGGGATGGGG + Intronic
1199661142 X:150052316-150052338 CACACAGCTTAGGGAGTATGTGG + Intergenic
1199722105 X:150549442-150549464 CTGAGAGCTCAGGGAGGTTGGGG + Intergenic
1201703353 Y:16908350-16908372 CTCACAGTTCTGCAAGGATGGGG + Intergenic