ID: 1162966553

View in Genome Browser
Species Human (GRCh38)
Location 19:14158957-14158979
Sequence TCATGCTAGTGTAAAATTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 172}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162966553_1162966555 10 Left 1162966553 19:14158957-14158979 CCTCAAATTTTACACTAGCATGA 0: 1
1: 0
2: 1
3: 12
4: 172
Right 1162966555 19:14158990-14159012 GCACCGCTGCCCTCTACAAATGG 0: 1
1: 0
2: 0
3: 6
4: 102
1162966553_1162966559 24 Left 1162966553 19:14158957-14158979 CCTCAAATTTTACACTAGCATGA 0: 1
1: 0
2: 1
3: 12
4: 172
Right 1162966559 19:14159004-14159026 TACAAATGGCACAGAGACGCTGG 0: 1
1: 0
2: 0
3: 9
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162966553 Original CRISPR TCATGCTAGTGTAAAATTTG AGG (reversed) Intronic
902443493 1:16446751-16446773 TCATGCTAGTCTCAAATTCCTGG + Intronic
903744155 1:25575374-25575396 TCATGCTGGTCTCAAATTTCCGG - Intergenic
905398597 1:37685076-37685098 TCGTTCTAGGGTAAGATTTGGGG - Intronic
908396100 1:63727167-63727189 TCATGATAGTGAATAATTTCAGG + Intergenic
909789354 1:79654605-79654627 TAATGCTAGTATAAAATGTGGGG - Intergenic
910747069 1:90585480-90585502 TCATGCTGGTTTAAAATCTCAGG + Intergenic
911613856 1:99987090-99987112 ACATGCTATTGTAAAATTCCAGG - Intronic
912039745 1:105374856-105374878 TAATGCTATTGTAAATATTGTGG - Intergenic
912212769 1:107572744-107572766 TCATGATATTATAAAATATGAGG - Exonic
912641602 1:111351581-111351603 TCATTTTAGTGAAATATTTGTGG + Exonic
913231721 1:116745493-116745515 AAATGCTAGTGAAATATTTGGGG - Intergenic
915967031 1:160318148-160318170 TCAAGCTACTCTTAAATTTGAGG + Intronic
917913935 1:179681540-179681562 TCATTCCAGTGTATAAATTGGGG + Intronic
920766054 1:208834938-208834960 TCATGCTGGTGTAATATTACTGG + Intergenic
922101841 1:222483418-222483440 TCATGCTAGTTTCAAACTTCAGG - Intergenic
922262922 1:223958539-223958561 TCATGCTAGTTTCAAACTTCGGG - Intergenic
923205951 1:231759075-231759097 GCATGCTAGTGGGAAATATGTGG - Intronic
924344760 1:243063543-243063565 TCATGCTAGTTTCAAACTTCGGG - Intergenic
1063273527 10:4538551-4538573 TCATGCTGGTTTGAAAGTTGAGG - Intergenic
1064894530 10:20219624-20219646 TAATGGTACTGGAAAATTTGAGG + Intronic
1065459278 10:25939421-25939443 CCTTTCTAATGTAAAATTTGAGG + Intronic
1066731572 10:38441534-38441556 TCATGCTAGTTTCAAACTTTGGG + Intergenic
1068092603 10:52451274-52451296 TGATGTTAATGTAAAAGTTGGGG - Intergenic
1072430171 10:95364187-95364209 TCCTGCTAGTCTACCATTTGGGG - Intronic
1072455516 10:95572043-95572065 TCTTGCTAGTATAACATTTAAGG + Intergenic
1073419574 10:103413410-103413432 TGATGCTAGTTTAAAATTTTTGG + Intronic
1074264216 10:111885059-111885081 TCATGCTAGATTAAAAGTAGGGG + Intergenic
1075562428 10:123478006-123478028 TCATGCTAGATTAAAATTTCTGG + Intergenic
1075693319 10:124415998-124416020 TCATGCAAGTGTAAAATTGCTGG - Intronic
1078601930 11:12740363-12740385 TATTGCTAGTGTAATGTTTGAGG + Intronic
1079623764 11:22590330-22590352 TAATGCCAGTGTAAAATTTTAGG - Intergenic
1080137422 11:28871960-28871982 TCATATTATTGTAAAATTTTAGG + Intergenic
1082165600 11:48946673-48946695 GCATGCTAGTGTAAAATCTGTGG - Intergenic
1087065307 11:94022303-94022325 TCATGCTATTTTCAACTTTGTGG + Intronic
1088878328 11:113954226-113954248 TCATACTAATACAAAATTTGAGG + Intergenic
1090883233 11:130853097-130853119 TCATGAAATTGTATAATTTGAGG - Intergenic
1093818329 12:23578257-23578279 TCATACTAGATTAAAATGTGAGG - Intronic
1105433879 13:20360963-20360985 TAATGCAAGTGTAAAGTGTGCGG + Intergenic
1107090919 13:36478638-36478660 TCATTCTGGTTTAAAAATTGTGG + Intergenic
1108143834 13:47455657-47455679 CCTTGGTATTGTAAAATTTGAGG - Intergenic
1108292400 13:48975303-48975325 TCGTGCTGTTGTAAAAATTGAGG + Intergenic
1108636787 13:52343256-52343278 TCATGCTATTGGAAAATATATGG - Intergenic
1108651262 13:52482306-52482328 TCATGCTATTGGAAAATATATGG + Intergenic
1113314818 13:109167410-109167432 TCCTGCTTATGTAACATTTGGGG + Intronic
1116319080 14:43436533-43436555 TCATGCTTTTGCAAAACTTGTGG + Intergenic
1124162958 15:27290828-27290850 TCATACTAGTGTAAAAATACTGG + Intronic
1128255800 15:66195726-66195748 ACATGCTAGTGTAGAAGTTCAGG - Intronic
1128460954 15:67866596-67866618 TCATGGTAATGAAAAACTTGTGG + Intergenic
1128502702 15:68238891-68238913 TGATGATGGTGTATAATTTGTGG + Intronic
1131726660 15:95234138-95234160 TCATTCTAGTTTCAATTTTGGGG + Intergenic
1135102480 16:19618373-19618395 TCACGGTAGTGCAAAATTGGAGG + Intronic
1138545020 16:57712890-57712912 ACATGATAGAGTAAAATGTGTGG - Intronic
1138974580 16:62188419-62188441 TCATGCCAGTGTGTAATATGTGG + Intergenic
1141870621 16:86783082-86783104 TCATGATAATGTAGAATTGGTGG + Intergenic
1146323642 17:31866924-31866946 TCATGCATGTCTAAAATATGAGG - Intronic
1150728780 17:67673648-67673670 TTATGCTTGTTTAAAAATTGAGG + Intronic
1151107584 17:71635117-71635139 TCAAGCTAGTGAAAGTTTTGGGG + Intergenic
1153128577 18:1827659-1827681 TCATGGTAATGTCAAATTTTCGG - Intergenic
1153871444 18:9324340-9324362 TCCTGTTAGTGTGGAATTTGAGG + Intergenic
1155865630 18:30961096-30961118 TCATCATAGTGTAGAATTAGTGG - Intergenic
1158151299 18:54375477-54375499 TCATTCTGCTTTAAAATTTGAGG + Intronic
1158798409 18:60876423-60876445 TCAGGCTAGTGGACAAATTGCGG + Intergenic
1162966553 19:14158957-14158979 TCATGCTAGTGTAAAATTTGAGG - Intronic
1165660514 19:37575942-37575964 TCAAGCTATTGTAGTATTTGTGG + Intronic
924995483 2:356888-356910 TCCTCCAAGTCTAAAATTTGGGG + Intergenic
925514200 2:4661927-4661949 TCATGCCTCTTTAAAATTTGTGG - Intergenic
925735834 2:6962868-6962890 TGATGCCAGTGTTGAATTTGTGG + Intronic
927276254 2:21264920-21264942 TCATGCGAGTGGAAAAGTGGGGG + Intergenic
929324631 2:40594048-40594070 TCATGCCATTGAACAATTTGGGG - Intronic
930113845 2:47701942-47701964 TCATGATGGGGTAATATTTGGGG + Intronic
930510225 2:52335248-52335270 TCATGCAAGTGTATAATTAGAGG + Intergenic
935393716 2:102582420-102582442 GCATGATAATGGAAAATTTGTGG - Intergenic
935415826 2:102817519-102817541 TAATGATCGTGTACAATTTGAGG + Exonic
937565501 2:123281206-123281228 TCAGATTACTGTAAAATTTGAGG - Intergenic
938772766 2:134514282-134514304 TCATGCTAGAGTCAAAGTCGGGG + Intronic
939640058 2:144629439-144629461 TCATGCTAATGTAAAGTGTTGGG - Intergenic
939696288 2:145328967-145328989 TCAGGTTATTGTAAATTTTGTGG + Intergenic
939980731 2:148777615-148777637 TTATGTTAGTGTAAAATCTGTGG + Intronic
942587542 2:177499861-177499883 TCAGTTTAGTGTTAAATTTGTGG + Intronic
943210061 2:184951654-184951676 CCATGCTATTGTCATATTTGAGG + Intergenic
943316373 2:186393613-186393635 TTGTTCTAGTGTAAAATTTTTGG - Intergenic
943341777 2:186691064-186691086 TTATTCTAGGGTAAAATATGTGG + Intergenic
943607395 2:189992354-189992376 TTATACTAGTATAAAAATTGTGG - Intronic
945681243 2:212916759-212916781 TTTTTCTATTGTAAAATTTGGGG + Intergenic
945735781 2:213598467-213598489 TCATTAGAGTGTAAAATTTAGGG + Intronic
946672771 2:222123978-222124000 CCATTCCAGTGTAAAATGTGTGG - Intergenic
946854212 2:223936721-223936743 TCATGCCTGTATAAAATATGTGG + Intronic
1170179540 20:13513974-13513996 TCATGCAAAAGTAAATTTTGTGG - Intronic
1173083229 20:39889645-39889667 TCCTGCTATTGTAAGATTAGTGG - Intergenic
1173100271 20:40081109-40081131 TATTGCTAATGGAAAATTTGAGG - Intergenic
1177613936 21:23491913-23491935 TTAAGAAAGTGTAAAATTTGTGG + Intergenic
1178830870 21:36055405-36055427 TGATGATAGTGGAAATTTTGAGG - Intronic
1182986172 22:34719554-34719576 TCATGACATTGTAAAATGTGAGG - Intergenic
951873833 3:27397683-27397705 TCATGTTCCTGAAAAATTTGAGG - Exonic
951905424 3:27701780-27701802 TCAGGCTAGTGTCAAATTTCTGG + Intergenic
953573768 3:44096166-44096188 CCATGCCAGTGAAAAATCTGTGG - Intergenic
953833394 3:46322368-46322390 TTATGCTCTTGTTAAATTTGAGG + Intergenic
954042957 3:47903656-47903678 TCATGCTGCTGTCAAATTTAGGG - Intronic
957291807 3:78286627-78286649 TCATAATGGTGTAGAATTTGGGG - Intergenic
958617405 3:96513142-96513164 TCCTGCTTTTGTTAAATTTGTGG + Intergenic
959590192 3:108071566-108071588 TTATACTAGTGTAACAGTTGAGG - Intronic
965763236 3:172103300-172103322 TTATGTTTCTGTAAAATTTGGGG + Intronic
966089227 3:176111170-176111192 TCATGATAGTCCAAAATTTCTGG + Intergenic
966444814 3:179990327-179990349 TCATGTTACTTTAAAATATGGGG - Intronic
970713616 4:18894120-18894142 TCATTCTATTGAAAAATTTAAGG - Intergenic
970745070 4:19284416-19284438 CCATGTTATTGTAAAACTTGGGG - Intergenic
970964152 4:21908522-21908544 TCATGCTAGAGTGAAGTTTGTGG + Intronic
971797920 4:31252949-31252971 TCAGGCTAGTGTAAAAATAAAGG + Intergenic
972073120 4:35048034-35048056 TCATGCTATTGAAGAATTTAGGG + Intergenic
972102030 4:35431921-35431943 GCATGCTGATGTAAAATGTGGGG - Intergenic
977027451 4:91836961-91836983 TAAAGCTAAAGTAAAATTTGAGG - Intergenic
977473934 4:97479623-97479645 TCTGGTTAGTGTAAAATCTGTGG - Intronic
978443723 4:108761349-108761371 TTATGCAATTTTAAAATTTGAGG - Intronic
979153966 4:117358695-117358717 TCTTGCTGATGTAAAAATTGAGG + Intergenic
979257956 4:118624143-118624165 TCATGCTAGTTTCAAACTTCGGG + Intergenic
979290951 4:118978042-118978064 ATATGCTACTGTAGAATTTGTGG + Intronic
979330393 4:119416420-119416442 TCATGCTAGTTTCAAACTTCGGG - Intergenic
979527488 4:121732657-121732679 TAATGCTAGTGTTGAATTAGTGG + Intergenic
982591447 4:157317596-157317618 TAATGCAAGTGTAAAATTAATGG - Intronic
986901551 5:12440559-12440581 TTCTTCTAGTGTAAAAATTGAGG + Intergenic
987000283 5:13653194-13653216 TCTTGCTTGTGTAAAAGTTCTGG + Intergenic
989088746 5:37706349-37706371 TCATTTCAGTGTATAATTTGAGG - Intronic
989639955 5:43574553-43574575 TGAAGATAGTTTAAAATTTGGGG - Intergenic
989682850 5:44049430-44049452 TCATGGCTGTGTAATATTTGGGG - Intergenic
990319534 5:54616201-54616223 TCATGATTGTGTAACATTTGTGG + Intergenic
990750012 5:59004456-59004478 TCATGCTACTGTTACTTTTGTGG - Intronic
990766708 5:59191943-59191965 TCATACAAGTGTAAATTTTTTGG + Intronic
992492857 5:77261900-77261922 TTATTCTTGTGTAACATTTGAGG + Intronic
993170520 5:84413306-84413328 TCATGCAAGTTGGAAATTTGGGG - Intergenic
993605274 5:89982806-89982828 TCTTGCTAGTGTGCCATTTGGGG - Intergenic
994628985 5:102257863-102257885 TGAGGATAGTGTATAATTTGAGG - Intronic
995346847 5:111131316-111131338 TTATACAAGTGCAAAATTTGAGG - Intergenic
995587013 5:113658622-113658644 TCATTCTAATGAAATATTTGAGG - Intergenic
996047574 5:118892268-118892290 TTATCTTATTGTAAAATTTGAGG - Intronic
996340575 5:122434555-122434577 TCATGCTAGTGTCAATATTCAGG + Intronic
997560167 5:134839657-134839679 TAATGCAAGTGTTAAATTTAAGG + Intronic
998578936 5:143349779-143349801 TCCTGCTAGTCTAAAAGTTTTGG - Intronic
1000145306 5:158447913-158447935 TCATATTAGTGAACAATTTGAGG - Intergenic
1006076906 6:31539265-31539287 TCATGCTGGACTAAAAGTTGGGG + Exonic
1007008297 6:38388935-38388957 TCTTGCTAGTATAAAACCTGTGG - Intronic
1009560951 6:65242565-65242587 TAATGCTACTGTAACATTTTTGG + Intronic
1009669136 6:66723027-66723049 TCAAGATAGTGAAAAATTAGTGG + Intergenic
1010044882 6:71430008-71430030 TCATCCCAGTGTGAAACTTGTGG + Intergenic
1012659013 6:101862632-101862654 TCATGCTAGTCTCAAACTTTTGG + Intronic
1012727949 6:102840345-102840367 TAATGGTAGTATAAAATTGGAGG + Intergenic
1013788636 6:113811246-113811268 TAATACTAGGATAAAATTTGAGG - Intergenic
1014743484 6:125172360-125172382 TCCTGCTAGTGTTAAACTTCTGG + Intronic
1014836864 6:126169593-126169615 TCATGCTGTGGTAAAATATGTGG + Intergenic
1018578003 6:165279594-165279616 TAATGCTAGTGTAATGTTTCCGG + Intergenic
1021145181 7:17078352-17078374 TCATGCTAGTCTAAGATGTCAGG - Intergenic
1023399944 7:39785429-39785451 TCATGCTAGTTTCAAACTTCGGG + Intergenic
1024072875 7:45801202-45801224 TCATGCTAGTTTCAAACTTCGGG + Intergenic
1025054595 7:55754640-55754662 TCATGCTAGTTTCAAACTTCGGG - Intergenic
1025132656 7:56384787-56384809 TCATGCTAGTTTCAAACTTCGGG - Intergenic
1027686649 7:81286897-81286919 TCATGCTCTTGTAAAGTTAGAGG + Intergenic
1027952265 7:84832030-84832052 TCATGATGGGATAAAATTTGGGG + Intergenic
1030600085 7:111582763-111582785 TCATGCTGGTATAAAACTTCTGG + Intergenic
1031217660 7:118917158-118917180 TCATCCAAGTCTAAAATTAGGGG + Intergenic
1031310146 7:120186122-120186144 TCATCCTAGTGGAAAATTCCAGG + Intergenic
1032050260 7:128644903-128644925 TCATGCTAGTTTCAAACTTTGGG + Intergenic
1032488209 7:132304468-132304490 ACATGCTAATGTCATATTTGGGG - Intronic
1038820226 8:30945107-30945129 TCATGGTAGTGGAAATTTTGGGG - Intergenic
1039575069 8:38616562-38616584 TCATACTAGGGTATAATATGGGG - Intergenic
1043533195 8:81172362-81172384 TCATGCTGGTCTCAAATTTCTGG - Intergenic
1043809687 8:84721803-84721825 TTATGCTACTTTAAAATTTGGGG + Intronic
1046350974 8:113011727-113011749 TCATGCCAGTATAAGATTTAAGG - Intronic
1048961308 8:139581175-139581197 TCATGTAAGTGGAAAATTTAAGG - Intergenic
1055987573 9:82067279-82067301 TAAAGCTAATGTAAAATATGAGG - Intergenic
1056811381 9:89767055-89767077 TCAGGCTACTGTAAAACATGTGG + Intergenic
1059519868 9:114930927-114930949 TCATGGCAGTATGAAATTTGGGG + Intergenic
1060587774 9:124797188-124797210 TCATGCTGGTCTTAAATTTCTGG + Intronic
1186977316 X:14922046-14922068 TTATGGTAGTATGAAATTTGAGG - Exonic
1189938356 X:46093604-46093626 TAATAATAGGGTAAAATTTGAGG + Intergenic
1191062580 X:56315350-56315372 TAATGCAAGTGTCAATTTTGGGG - Intergenic
1194145128 X:90253253-90253275 TCATGTATGTGTAAAGTTTGAGG - Intergenic
1195777881 X:108427653-108427675 TCATGCCACTCTAACATTTGTGG - Intronic
1196616443 X:117771318-117771340 CAATGCTAGTTTAAAATTGGAGG - Intergenic
1196662689 X:118284215-118284237 ACATGCCAGAGTAAACTTTGAGG - Intergenic
1200730050 Y:6724958-6724980 TGATGCCAGTCTAACATTTGAGG + Intergenic
1202279720 Y:23169296-23169318 TCGGACTTGTGTAAAATTTGGGG - Intronic
1202280449 Y:23180136-23180158 TCGGACTTGTGTAAAATTTGGGG - Intronic
1202281178 Y:23190984-23191006 TCGGACTTGTGTAAAATTTGGGG - Intronic
1202284712 Y:23227536-23227558 TCGGACTTGTGTAAAATTTGGGG + Intronic
1202432851 Y:24805367-24805389 TCGGACTTGTGTAAAATTTGGGG - Intronic
1202436386 Y:24841923-24841945 TCGGACTTGTGTAAAATTTGGGG + Intronic
1202437114 Y:24852771-24852793 TCGGACTTGTGTAAAATTTGGGG + Intronic