ID: 1162968440

View in Genome Browser
Species Human (GRCh38)
Location 19:14166611-14166633
Sequence CGGTGCCCCAGTGGGGGAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 208}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162968440 Original CRISPR CGGTGCCCCAGTGGGGGAGC CGG Intronic
900371585 1:2334519-2334541 CGGGGCTCCCTTGGGGGAGCAGG + Intronic
901138849 1:7014815-7014837 CGGGGGCCGGGTGGGGGAGCGGG + Intronic
903346241 1:22685937-22685959 CAGGGCCGCAGTCGGGGAGCAGG - Intergenic
904237538 1:29124522-29124544 CCCTTCGCCAGTGGGGGAGCGGG + Intergenic
904984273 1:34532048-34532070 CGGTCCCTCACTGTGGGAGCTGG - Intergenic
905449306 1:38046694-38046716 CGGGGCCCCGGTGGCGGAGCCGG - Exonic
906205805 1:43985702-43985724 AGGTCCCCCACTGGGGGATCAGG - Intronic
908006948 1:59737279-59737301 CGGTGCCCCAGTAGGGACTCTGG - Intronic
914490638 1:148148481-148148503 GGGTGCCCCTGGGTGGGAGCTGG + Intronic
915321788 1:155060524-155060546 CTGTGCCCCTGTGGGGTGGCTGG + Intronic
915325875 1:155080899-155080921 GGCTGCCGCAGTGAGGGAGCCGG - Intronic
917141567 1:171841137-171841159 CGGTGCCCCGGTGGTGGCGGCGG + Intergenic
917205196 1:172564216-172564238 CAGTGCTCCAGTGGGGATGCTGG - Intronic
917979330 1:180259575-180259597 CTGGGGCTCAGTGGGGGAGCGGG + Intronic
919220681 1:194624917-194624939 TGGAGCCCCAGTGGGGGCGGGGG + Intergenic
922380331 1:225017443-225017465 AAGTGCTCCAGTGGGGTAGCAGG - Intronic
922885828 1:229019809-229019831 CAGGTCCCCAGTGGTGGAGCTGG - Intergenic
923274545 1:232385086-232385108 GGGTACCCCAGTCAGGGAGCTGG + Intergenic
923577820 1:235176597-235176619 CAGAGCAGCAGTGGGGGAGCTGG - Intronic
1065640539 10:27777877-27777899 CCCTGCCCCAGTGGGGAAACTGG + Intergenic
1065784346 10:29199542-29199564 CGGAGTCCCAGTGGAGAAGCCGG + Intergenic
1066291391 10:34017432-34017454 AGGTGCCCCAGAGGAAGAGCAGG - Intergenic
1067289568 10:44931437-44931459 GAGTGACACAGTGGGGGAGCAGG + Intronic
1067415240 10:46097519-46097541 GGGTGACCCAGACGGGGAGCCGG - Intergenic
1067575234 10:47404533-47404555 TGGTGGCCCAGAGGGGCAGCAGG + Intergenic
1068431206 10:56934750-56934772 CAGTGGCCCAGTGGGGACGCTGG - Intergenic
1070999178 10:80814433-80814455 AGGAGCCCAGGTGGGGGAGCTGG - Intergenic
1071492967 10:86148825-86148847 CTGTGCACCCCTGGGGGAGCAGG - Intronic
1071980991 10:91004253-91004275 CAGTGCCCCAGTGGGGACTCTGG + Intergenic
1073073205 10:100807689-100807711 GTGTGCCCCTGTGTGGGAGCGGG - Intronic
1073268353 10:102241602-102241624 CGGAGCCCCAGCAGGGCAGCTGG - Intergenic
1076395876 10:130136861-130136883 CCGTGCCGCAGTGGCGGGGCGGG + Intronic
1077132713 11:981544-981566 CGCTTCCCCAGTGGGGGACACGG - Intronic
1077418462 11:2436903-2436925 CAGTGCCCAGGTGGGCGAGCGGG - Intergenic
1078393424 11:10956308-10956330 CAGTGCCCTAGTGGGGAATCTGG - Intergenic
1078590181 11:12634021-12634043 TGGTGGCCCATTTGGGGAGCAGG - Intergenic
1083581245 11:63826924-63826946 CGGAGCCCCGGAGGGGGAGCTGG - Exonic
1083618217 11:64036541-64036563 CGGTTCCCGAGTGCGGGAGCTGG - Intronic
1083662544 11:64258462-64258484 CGCCGCCCCAGCGGGGCAGCTGG + Exonic
1084859359 11:72008006-72008028 AGGTTCCCCAGTGGTAGAGCTGG - Intronic
1089654292 11:119935696-119935718 CCCTGCCCTGGTGGGGGAGCGGG - Intergenic
1092246493 12:6867154-6867176 CTCTGCCCCAGTGGGCGATCTGG + Exonic
1094176896 12:27550191-27550213 CAGTGGCCCCATGGGGGAGCTGG + Intronic
1095382844 12:41615740-41615762 TGGTGCCCCAGTAGGGAATCTGG - Intergenic
1096258806 12:50078429-50078451 AGGTGCCCCAGGGTGGGGGCAGG - Exonic
1099929070 12:89052831-89052853 CAGTGCCCCAGTGGGGACTCTGG + Intergenic
1102720694 12:115013605-115013627 CGGTGCCCCAGGGGGATATCTGG - Intergenic
1103340771 12:120220068-120220090 CAGAGCCACAGTGGAGGAGCTGG + Intronic
1103505994 12:121442684-121442706 GGGTCCCGCGGTGGGGGAGCTGG + Exonic
1104931308 12:132340807-132340829 CGGTGGCCCAGTGAGAGGGCTGG - Intergenic
1108305407 13:49127118-49127140 CAGTATCCCAGTGGGGGAACCGG - Intronic
1111064518 13:83072909-83072931 CAGTGCCCCAGTGGGGACTCTGG - Intergenic
1112203674 13:97302995-97303017 CAGTGCCCAAGTGGCAGAGCAGG + Intronic
1113886703 13:113664847-113664869 AGTTGCCCCATTGGGTGAGCAGG + Intergenic
1114696302 14:24630607-24630629 AGGAGCCCCAGTGGGGGATGAGG + Intergenic
1116378378 14:44232367-44232389 CAGTGCCCCAGTGGGGACTCTGG + Intergenic
1120270683 14:82309745-82309767 CAGTGCCCCAGTGGGGACTCTGG - Intergenic
1120413819 14:84194095-84194117 CAGTGCCCCAGTGGGGACTCTGG - Intergenic
1121044143 14:90775609-90775631 CTGTGCCCAGGTGGAGGAGCTGG - Intronic
1122763532 14:104048691-104048713 GAGTGCCACAGAGGGGGAGCAGG - Intronic
1123056844 14:105574836-105574858 AGGTGCCCCGGTGAGGGTGCAGG - Intergenic
1123081366 14:105696949-105696971 AGGTGCCCCGGTGAGGGTGCAGG + Intergenic
1123783561 15:23647450-23647472 GGGCCCCCCAGCGGGGGAGCCGG + Exonic
1125732402 15:41900574-41900596 CGGTGAGTCAGTGGTGGAGCAGG + Exonic
1125806564 15:42498197-42498219 CAGTGCCCCAGTGGGGATTCTGG + Intronic
1128311064 15:66632044-66632066 AGGAGCCCCAGTGGGGGTGGGGG + Intronic
1129234350 15:74214729-74214751 TGGTGCCTCAGTGGGCAAGCAGG - Intergenic
1129354237 15:74978671-74978693 CAGTGCCACGGTGGGGGAGGGGG - Intronic
1131147767 15:90025194-90025216 CGGTGGCCCTGTGAGGGACCCGG - Intronic
1132937372 16:2488000-2488022 AGGGGCCCCAGCGGGGCAGCTGG - Intronic
1133668968 16:7998947-7998969 AGGTGACTCAGTGGGGAAGCAGG - Intergenic
1135354053 16:21754836-21754858 GAGTGCCCCAGAGGGGAAGCAGG - Intronic
1135424425 16:22325296-22325318 CGGAGCCACAGTGTAGGAGCCGG - Intronic
1135452541 16:22570975-22570997 GAGTGCCCCAGAGGGGAAGCAGG - Intergenic
1135615699 16:23908982-23909004 TGGTGTCCCAGTGGGTGTGCAGG - Intronic
1139595901 16:67958125-67958147 TGGGGCCCCACTGGGGGAGGGGG - Intronic
1142958122 17:3535056-3535078 TGGTGCCCCAGAGGGGCAGGAGG - Intronic
1143265315 17:5632501-5632523 CAGCTCCCCAGTGAGGGAGCTGG + Intergenic
1143600678 17:7943784-7943806 CACTGTCCCAGTGAGGGAGCTGG - Intronic
1146256071 17:31392073-31392095 GGGTGACCCGGCGGGGGAGCTGG - Intronic
1147786262 17:42980693-42980715 CTGGGCCCCAGTGGGGGCGGTGG + Exonic
1147793438 17:43027009-43027031 GGTTTCCCAAGTGGGGGAGCGGG - Intronic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1150967384 17:69987337-69987359 CAGTGCCCCAGTGGGGACTCTGG - Intergenic
1151135860 17:71945252-71945274 CGGTGCCCCAGTAGGGACTCTGG - Intergenic
1151361074 17:73589365-73589387 GGGTGACCCTGTTGGGGAGCTGG + Intronic
1151404539 17:73878027-73878049 CTGTGCCCCAGGGGAGGAGAGGG + Intergenic
1151454483 17:74217895-74217917 CTGAGCACCAGTGTGGGAGCTGG + Intronic
1151684334 17:75637872-75637894 TGGGGCACCAGTGGGGGTGCTGG + Exonic
1151800168 17:76374534-76374556 CGGCACCCCAGGGAGGGAGCCGG - Intronic
1152282605 17:79394368-79394390 CCCTGCCCCAGTGGTGGAGATGG - Intronic
1152688312 17:81705775-81705797 TGGTTCCCCAGTGGGGGAAAGGG - Intronic
1152757012 17:82091261-82091283 CGGTGGCCCAGAGGTGCAGCAGG - Exonic
1152888176 17:82864842-82864864 CGGTGCCCCGGGGAGTGAGCAGG - Intronic
1152888191 17:82864880-82864902 CGGTGCCCCAGGGAGTGAGCAGG - Intronic
1153342116 18:3986119-3986141 GGGTGCCCCAGTGGGAGAATTGG - Intronic
1156361622 18:36388951-36388973 CGGTGCCCCCCAGAGGGAGCTGG - Intronic
1156515116 18:37672734-37672756 AGGTGCACCAGTGGGGAAGTTGG + Intergenic
1157813791 18:50716792-50716814 CGGTGCCCCTGAGGAGAAGCAGG - Intronic
1158424525 18:57327153-57327175 GGGTGCCTCAGGGGGGGAGATGG - Intergenic
1160994980 19:1878345-1878367 GGGTGCCCCTGGGTGGGAGCTGG - Intronic
1161624853 19:5320289-5320311 CCCTGCCCCAGTGGGAGAGGGGG + Intronic
1162099864 19:8333275-8333297 CGGCGCCGTGGTGGGGGAGCTGG + Intronic
1162123549 19:8486817-8486839 CAGAGCCCCAGGGAGGGAGCTGG + Intronic
1162968440 19:14166611-14166633 CGGTGCCCCAGTGGGGGAGCCGG + Intronic
1163151696 19:15418814-15418836 CGGGGCCCCAGGGGAGGTGCGGG + Intronic
1163564033 19:18039068-18039090 CAGTATCCCAGTCGGGGAGCTGG + Intergenic
1163578557 19:18124531-18124553 TGGAGACCCAGTGGGTGAGCTGG + Intronic
1164925186 19:32124741-32124763 GGGTGCCCCAGGGTGGGAACTGG - Intergenic
1165886784 19:39084387-39084409 CGGCGCCCCCGAGGGTGAGCCGG + Exonic
1168347964 19:55660073-55660095 CTGAGCCCCAGGGTGGGAGCAGG - Intronic
925558767 2:5164589-5164611 CAGTGCCTCAGTGGGTGAGTAGG - Intergenic
926718680 2:15942874-15942896 CAGTGCCCCAGGGAGGCAGCCGG - Intronic
927900250 2:26813772-26813794 TGGCGCCCAAGTTGGGGAGCTGG - Intergenic
929569159 2:43009222-43009244 TGTTGTCCCAGTGGGGAAGCTGG + Intergenic
931776936 2:65548995-65549017 ATATGCCCCAGTGGGGGAACCGG + Intergenic
932611486 2:73203116-73203138 CGGCGCCCCAGTGCAGGAGAGGG + Intronic
934697122 2:96407867-96407889 CCGGGCCCCTCTGGGGGAGCTGG - Intergenic
941906165 2:170717056-170717078 CGGCGCCCCCGAGGCGGAGCCGG + Exonic
947549041 2:231033407-231033429 GGGTGCCCCTGAGGTGGAGCAGG - Intergenic
1168974162 20:1951717-1951739 CAGTGCCTCACTAGGGGAGCTGG - Intergenic
1170337065 20:15281807-15281829 CAGTGCCCCAGTGGGGACTCTGG + Intronic
1170574432 20:17651948-17651970 AGGTGCCCCAGAGGGAGACCTGG - Intronic
1172972430 20:38883238-38883260 CGTTTCCCCAGAGGAGGAGCAGG + Intronic
1174478689 20:50815604-50815626 CTGTGCCTCAGTCGGGGAGAGGG - Intronic
1175703090 20:61154681-61154703 CAGGGCCCCAGCTGGGGAGCTGG + Intergenic
1175962358 20:62643387-62643409 CGGGGCGCCAGTGCGGGAGGCGG - Intronic
1175994392 20:62805587-62805609 CGGCCCCCCTGTCGGGGAGCTGG + Intronic
1176216244 20:63949314-63949336 CGGTGCCCTGAAGGGGGAGCAGG + Intronic
1176235286 20:64050929-64050951 GAGTGCCCCTGTGGGGGTGCTGG - Intronic
1179471754 21:41614895-41614917 CGGGGCCACAGTGGGGGAGTGGG + Intergenic
1179908226 21:44435079-44435101 CCGTCCACCAATGGGGGAGCAGG - Intronic
1179964211 21:44791704-44791726 CAGTGCCCCAGTGGGGACTCTGG - Intronic
1180076947 21:45467817-45467839 CCTTGCCCCAGCGGGGGTGCCGG + Intronic
1180092262 21:45539213-45539235 AGGTGCACCTGTGGGGGACCAGG - Intronic
1180936250 22:19627176-19627198 CCTTGCCCCAGTGTTGGAGCAGG + Intergenic
1180958444 22:19751474-19751496 CAGGGACCCAGTGGGGAAGCCGG + Intergenic
1181121036 22:20668879-20668901 GGGTGCCCCTGGGTGGGAGCTGG - Intergenic
1181334002 22:22115905-22115927 GGGTGCCCCTGGGTGGGAGCTGG - Intergenic
1181941748 22:26483421-26483443 AGGGGCCTCAGTGGGGCAGCAGG + Intronic
1182424687 22:30265908-30265930 CGGTGCCCCGTTGGGGGTGGTGG - Intronic
1183182276 22:36268139-36268161 GGGTGCCCCAGTGGGGTTGGTGG - Intergenic
1183373588 22:37449417-37449439 AGGTGACCCAGTGGGGGCACAGG + Intergenic
1184266024 22:43346523-43346545 CTGTGCCTCGGTGGGGAAGCTGG + Intergenic
953252848 3:41262188-41262210 CGGTGTCCAACTGGGGAAGCCGG + Intronic
954613621 3:51958756-51958778 CTGGGCGGCAGTGGGGGAGCAGG - Intronic
961650191 3:128413333-128413355 TGGGGCACCAGTGGGGGAGACGG + Intergenic
963108247 3:141664644-141664666 GGGAGCCCCAGCTGGGGAGCTGG - Intergenic
965501093 3:169457134-169457156 CAGGGCCCCAGCAGGGGAGCTGG - Intronic
968708035 4:2092532-2092554 CGCAGCCACCGTGGGGGAGCTGG - Intronic
969256882 4:6008283-6008305 CGGTGTCCCACTGGGCCAGCAGG + Intergenic
971195920 4:24471773-24471795 CTGTGCCCCAGGGGAGGCGCGGG + Intergenic
974487595 4:62525094-62525116 CGGTGCCCCAGTAGGGACTCTGG - Intergenic
982343959 4:154335408-154335430 CAGTGCCCCAGGTTGGGAGCAGG - Intronic
985703510 5:1387470-1387492 CGGTGCCTGACTTGGGGAGCTGG - Intergenic
986821085 5:11467370-11467392 CCTTGCCCCAGTGTGGGAGAAGG - Intronic
993531115 5:89026890-89026912 CAGTGCCCCAGTGGGGACTCTGG + Intergenic
997505229 5:134411815-134411837 GGCTGCCGCAGTGGAGGAGCTGG - Exonic
998280555 5:140802916-140802938 CGGTGGCGCAGTGAGCGAGCTGG + Exonic
1001399927 5:171440401-171440423 CTCTGCCCCAGTGAGGGAGGAGG + Intronic
1001554451 5:172626415-172626437 GAGGGCCTCAGTGGGGGAGCAGG - Intergenic
1002054856 5:176592938-176592960 CAGTGAACCAGTGGAGGAGCAGG - Intronic
1002574066 5:180161626-180161648 CCGAGCCCGAGAGGGGGAGCAGG + Intronic
1013352473 6:109317976-109317998 CGGTGCCTCAGTCTGGTAGCTGG + Intergenic
1015731396 6:136351938-136351960 ATCTGCCCCAGTGGGGGTGCTGG - Intronic
1019663343 7:2238298-2238320 TGATGCCACAGTGAGGGAGCTGG + Intronic
1019692591 7:2424877-2424899 GGGTGCCCCCGTGGAGGAGCAGG + Intronic
1019964891 7:4490724-4490746 CCGTGGCCCAGGGGGAGAGCAGG - Intergenic
1021027316 7:15685974-15685996 CGCGGCCCCAGTCGGGGTGCTGG + Exonic
1022193452 7:28040550-28040572 CGGTGCCACAGTGGGGAGGTGGG + Intronic
1022511572 7:30938121-30938143 CTCTGCCCCAGTGGGGGATAAGG + Intergenic
1023181999 7:37494001-37494023 CGTAGCCCAAGTGGGAGAGCGGG - Intergenic
1023223288 7:37943235-37943257 CTGTGCCCCAGCGGGGGCGTTGG + Intronic
1023873894 7:44276621-44276643 AGGTGCCCCAGAAAGGGAGCTGG + Intronic
1023965800 7:44962571-44962593 CGGGTCCCCAGCGGGTGAGCCGG + Intergenic
1024054896 7:45653681-45653703 CAAAGCCCCAGTGGGGGAGAGGG - Intronic
1025929405 7:65982188-65982210 CGGTGGCCGAGCGGGGGACCGGG - Exonic
1029131614 7:98335729-98335751 AGGAGTCCCAGCGGGGGAGCTGG - Intronic
1029422192 7:100477529-100477551 CAGTCCCCCAGTGAAGGAGCGGG + Exonic
1029423976 7:100485424-100485446 CTGTGGCCCAGTGAGGGGGCAGG - Intronic
1030809873 7:113959174-113959196 CAGTGCCCCAGTGGGGACTCTGG + Intronic
1032441931 7:131948605-131948627 AGATGCCCCAGGGAGGGAGCGGG - Intergenic
1033753431 7:144377890-144377912 CAGTTCCCCAGTGGGTGAGGAGG + Intronic
1034338690 7:150339074-150339096 CGTTTCCTCTGTGGGGGAGCGGG + Exonic
1034556370 7:151852822-151852844 CGGGGCCCCAGGGAGGGAGGAGG - Intronic
1034560557 7:151877046-151877068 CTGTGCCCAAGTGGGGAATCTGG + Exonic
1035205308 7:157290718-157290740 AGGTGCGCCAGTGGTGGAGCAGG - Intergenic
1036187662 8:6638237-6638259 CCGTCCCACAGTGAGGGAGCTGG + Intronic
1036518915 8:9472323-9472345 AGGTGCTCCAGTGGAGGAGATGG - Intergenic
1038759497 8:30373564-30373586 CTGTACCCCAGTGGGTCAGCTGG - Intergenic
1042591456 8:70402668-70402690 CGGGGCCCCAGGCGGGAAGCGGG - Intronic
1048111367 8:131472218-131472240 CAGTGCCCCAGTGGGGTCTCTGG - Intergenic
1048972925 8:139655278-139655300 CGGTGCCCAAGAGCAGGAGCAGG + Intronic
1049105337 8:140609069-140609091 AGGGGCCTCAGCGGGGGAGCAGG + Intronic
1049238148 8:141523036-141523058 CGGAGCCCCAGAGGGAGGGCAGG + Intergenic
1049420743 8:142515437-142515459 AGGTGGACCAGTGGGAGAGCTGG + Intronic
1049432467 8:142571676-142571698 CTGTGGGCCTGTGGGGGAGCGGG - Intergenic
1049451832 8:142666133-142666155 CGGAGCCCCAGAAGGGGAGCAGG - Exonic
1057200711 9:93138332-93138354 GGGAGCCCCAGTGGGAGAGACGG - Intergenic
1061265886 9:129504877-129504899 GGGTGCCACTGTGGGAGAGCAGG - Intergenic
1061962749 9:133996727-133996749 CGGTACCACAGTGGCGGGGCGGG - Intergenic
1062213255 9:135375937-135375959 AGAGGCCCCAGTGGGAGAGCGGG - Intergenic
1062340216 9:136090804-136090826 CGGGGCCCCGGTGGCTGAGCTGG + Intronic
1062435984 9:136546734-136546756 CGGGTCCCCCTTGGGGGAGCGGG - Intergenic
1188405155 X:29798275-29798297 CATTGCCCCAGTGTGGGAGCAGG + Intronic
1189400796 X:40666814-40666836 CAAAGCCCCACTGGGGGAGCTGG + Exonic
1190509666 X:51162602-51162624 TGGGGCCCCAGAGGAGGAGCAGG - Intergenic
1192791011 X:74381866-74381888 CTGCACCCCAGTGGGGGAGTTGG + Intergenic
1193816172 X:86107334-86107356 CAGTGCCCCAGTGGGGACTCTGG + Intergenic
1200688010 Y:6274214-6274236 GGGTGTCTCAGTGGGAGAGCTGG - Intergenic
1201047257 Y:9900488-9900510 GGGTGTCTCAGTGGGAGAGCTGG + Intergenic
1201060204 Y:10037741-10037763 GGGTGTCTCAGTGGGAGAGCTGG + Intergenic
1201062308 Y:10058624-10058646 GGGTGTCTCAGTGGGAGAGCTGG + Intergenic
1202111483 Y:21426623-21426645 GGGTGTCTCAGTGGGAGAGCTGG + Intergenic
1202116961 Y:21477514-21477536 GGGTGTCTCAGTGGGAGAGCTGG - Intergenic
1202232539 Y:22671253-22671275 GGGTGTCTCAGTGGGAGAGCTGG - Intergenic
1202310617 Y:23524905-23524927 GGGTGTCTCAGTGGGAGAGCTGG + Intergenic
1202560185 Y:26145689-26145711 GGGTGTCTCAGTGGGAGAGCTGG - Intergenic