ID: 1162970806

View in Genome Browser
Species Human (GRCh38)
Location 19:14180249-14180271
Sequence AACAAATAGAAGTCAGGCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162970806_1162970811 16 Left 1162970806 19:14180249-14180271 CCCTTGCCTGACTTCTATTTGTT No data
Right 1162970811 19:14180288-14180310 CTCTGTCACCCAGGCTGGAGTGG 0: 637
1: 1347
2: 1790
3: 1673
4: 1832
1162970806_1162970812 21 Left 1162970806 19:14180249-14180271 CCCTTGCCTGACTTCTATTTGTT No data
Right 1162970812 19:14180293-14180315 TCACCCAGGCTGGAGTGGAATGG 0: 95
1: 15415
2: 114265
3: 221083
4: 220487
1162970806_1162970810 11 Left 1162970806 19:14180249-14180271 CCCTTGCCTGACTTCTATTTGTT No data
Right 1162970810 19:14180283-14180305 TCTCGCTCTGTCACCCAGGCTGG 0: 20256
1: 110872
2: 156495
3: 163124
4: 142023
1162970806_1162970809 7 Left 1162970806 19:14180249-14180271 CCCTTGCCTGACTTCTATTTGTT No data
Right 1162970809 19:14180279-14180301 AGAGTCTCGCTCTGTCACCCAGG 0: 6448
1: 47007
2: 126177
3: 160025
4: 148559

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162970806 Original CRISPR AACAAATAGAAGTCAGGCAA GGG (reversed) Intronic
No off target data available for this crispr