ID: 1162971595

View in Genome Browser
Species Human (GRCh38)
Location 19:14184043-14184065
Sequence TCGCATCCTCACCATGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 108}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162971588_1162971595 0 Left 1162971588 19:14184020-14184042 CCCTGCCCACTCATCTCCCCTAC 0: 1
1: 1
2: 1
3: 36
4: 417
Right 1162971595 19:14184043-14184065 TCGCATCCTCACCATGAGCAAGG 0: 1
1: 0
2: 0
3: 8
4: 108
1162971582_1162971595 18 Left 1162971582 19:14184002-14184024 CCCATGCCCCTGTCCTGACCCTG 0: 1
1: 0
2: 3
3: 65
4: 556
Right 1162971595 19:14184043-14184065 TCGCATCCTCACCATGAGCAAGG 0: 1
1: 0
2: 0
3: 8
4: 108
1162971586_1162971595 10 Left 1162971586 19:14184010-14184032 CCTGTCCTGACCCTGCCCACTCA 0: 1
1: 0
2: 5
3: 43
4: 424
Right 1162971595 19:14184043-14184065 TCGCATCCTCACCATGAGCAAGG 0: 1
1: 0
2: 0
3: 8
4: 108
1162971587_1162971595 5 Left 1162971587 19:14184015-14184037 CCTGACCCTGCCCACTCATCTCC No data
Right 1162971595 19:14184043-14184065 TCGCATCCTCACCATGAGCAAGG 0: 1
1: 0
2: 0
3: 8
4: 108
1162971584_1162971595 12 Left 1162971584 19:14184008-14184030 CCCCTGTCCTGACCCTGCCCACT 0: 1
1: 0
2: 8
3: 66
4: 559
Right 1162971595 19:14184043-14184065 TCGCATCCTCACCATGAGCAAGG 0: 1
1: 0
2: 0
3: 8
4: 108
1162971590_1162971595 -5 Left 1162971590 19:14184025-14184047 CCCACTCATCTCCCCTACTCGCA 0: 1
1: 0
2: 1
3: 9
4: 153
Right 1162971595 19:14184043-14184065 TCGCATCCTCACCATGAGCAAGG 0: 1
1: 0
2: 0
3: 8
4: 108
1162971585_1162971595 11 Left 1162971585 19:14184009-14184031 CCCTGTCCTGACCCTGCCCACTC 0: 1
1: 1
2: 6
3: 63
4: 596
Right 1162971595 19:14184043-14184065 TCGCATCCTCACCATGAGCAAGG 0: 1
1: 0
2: 0
3: 8
4: 108
1162971580_1162971595 25 Left 1162971580 19:14183995-14184017 CCTCTTCCCCATGCCCCTGTCCT 0: 1
1: 0
2: 14
3: 116
4: 1128
Right 1162971595 19:14184043-14184065 TCGCATCCTCACCATGAGCAAGG 0: 1
1: 0
2: 0
3: 8
4: 108
1162971591_1162971595 -6 Left 1162971591 19:14184026-14184048 CCACTCATCTCCCCTACTCGCAT 0: 1
1: 0
2: 1
3: 12
4: 272
Right 1162971595 19:14184043-14184065 TCGCATCCTCACCATGAGCAAGG 0: 1
1: 0
2: 0
3: 8
4: 108
1162971589_1162971595 -1 Left 1162971589 19:14184021-14184043 CCTGCCCACTCATCTCCCCTACT 0: 1
1: 0
2: 1
3: 26
4: 455
Right 1162971595 19:14184043-14184065 TCGCATCCTCACCATGAGCAAGG 0: 1
1: 0
2: 0
3: 8
4: 108
1162971583_1162971595 17 Left 1162971583 19:14184003-14184025 CCATGCCCCTGTCCTGACCCTGC 0: 1
1: 0
2: 21
3: 234
4: 1377
Right 1162971595 19:14184043-14184065 TCGCATCCTCACCATGAGCAAGG 0: 1
1: 0
2: 0
3: 8
4: 108
1162971581_1162971595 19 Left 1162971581 19:14184001-14184023 CCCCATGCCCCTGTCCTGACCCT 0: 1
1: 0
2: 3
3: 43
4: 442
Right 1162971595 19:14184043-14184065 TCGCATCCTCACCATGAGCAAGG 0: 1
1: 0
2: 0
3: 8
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162971595 Original CRISPR TCGCATCCTCACCATGAGCA AGG Intronic
900121604 1:1050711-1050733 GCCCCTCCTCACCAGGAGCAGGG + Exonic
901323064 1:8350994-8351016 ACGCATCCTCAGCTTGAGCATGG - Intergenic
902071275 1:13740859-13740881 CAGCATCCTCACCATCAGCGGGG + Intronic
903362911 1:22788228-22788250 TTGCACCCTCACCATCTGCAAGG - Intronic
903687145 1:25140163-25140185 TCACTTCCCCACCATGAGAAAGG - Intergenic
904013549 1:27403973-27403995 TCCCCTTCTCACCATGAGAAAGG - Intergenic
904531099 1:31170046-31170068 AGACATCCTCACCAAGAGCAGGG + Intergenic
905284799 1:36872251-36872273 TCGCTTCATCTCCTTGAGCAAGG + Exonic
916805901 1:168261000-168261022 TTGCATGTTCACCATGAGCAGGG - Intergenic
917434438 1:175005277-175005299 TCCCAACCACAACATGAGCAAGG - Intronic
920101536 1:203520048-203520070 ATGCATCCTCACTGTGAGCAGGG + Intergenic
923660340 1:235951833-235951855 GAGCTTCCTCACCAAGAGCAGGG + Intergenic
923877641 1:238066808-238066830 TCTTTTCCTTACCATGAGCATGG + Intergenic
1064101032 10:12464385-12464407 TTGCAGACTCACCTTGAGCAAGG + Intronic
1064534397 10:16343848-16343870 TCCCATCCTCCCCAGGAGCTGGG + Intergenic
1068586657 10:58807672-58807694 TCCCAGTCTCACCCTGAGCAGGG - Intronic
1068788741 10:61004500-61004522 TCACTTCCTATCCATGAGCATGG + Intergenic
1075212520 10:120503087-120503109 TCCCATCCTCACCATGGCCAGGG + Intronic
1075797052 10:125128114-125128136 GAGCAGCCTCACCATGAGCTGGG - Intronic
1075867137 10:125733209-125733231 TCTCATCCACCCCATCAGCAAGG - Intronic
1077825696 11:5806287-5806309 TGGTACCCCCACCATGAGCAAGG + Intronic
1084460722 11:69295155-69295177 TCTCATCCTCCCCATGGTCAAGG + Intronic
1088016704 11:105069891-105069913 TCTCATCCTCACCATGGGGTAGG + Intronic
1088019252 11:105099798-105099820 TCTCATCCTCACCATGTGGTAGG + Intronic
1093680165 12:21993478-21993500 TCCTATCCTAACCATGGGCAAGG - Intergenic
1094467277 12:30766676-30766698 TTGCTTCCTCAACATCAGCAAGG - Intergenic
1094868945 12:34576738-34576760 TTTCTTCCTAACCATGAGCATGG - Intergenic
1102860045 12:116328302-116328324 TAGCATCCACACCATCAGAATGG + Intergenic
1104374516 12:128252073-128252095 CCCCTTCCTCACCTTGAGCAAGG + Intergenic
1104616635 12:130275835-130275857 TTTAATCCACACCATGAGCAAGG - Intergenic
1108989702 13:56639622-56639644 TCTCTTCCTACCCATGAGCATGG - Intergenic
1111629386 13:90829774-90829796 TCACAGCCACCCCATGAGCATGG + Intergenic
1115915294 14:38305675-38305697 TTGCTTCCTATCCATGAGCATGG - Intergenic
1119519218 14:75273396-75273418 TCTCATAATCACCATGTGCAGGG - Intergenic
1119821484 14:77620086-77620108 ACCCATCCTCACCATAAGCTAGG - Intergenic
1127910391 15:63411587-63411609 CAGCAGCCTCCCCATGAGCAGGG + Intergenic
1128073680 15:64812887-64812909 GAGCATCTTCACCATGAGAAGGG + Intergenic
1130577864 15:85108237-85108259 TCGGATCCTGTACATGAGCAGGG + Intronic
1132758848 16:1499323-1499345 TGGCGTCCTCACCGTGAGCCGGG - Exonic
1134084579 16:11347577-11347599 TTGCATCCTCACTGTGAGCCAGG - Intronic
1134765862 16:16757355-16757377 CCCCATCTTCACCATGAGCCTGG - Intergenic
1134980188 16:18601859-18601881 CCCCATCTTCACCATGAGCCTGG + Intergenic
1137441450 16:48501932-48501954 TACCATCCTCATCATGAGGAAGG + Intergenic
1141768815 16:86076250-86076272 TCCCATCCCCACCAAGGGCAGGG - Intergenic
1143338719 17:6192850-6192872 TCGTATCCTCACCTTCATCATGG - Intergenic
1144872788 17:18381087-18381109 TCCCATCTTCACCATCACCAGGG - Intronic
1146664999 17:34694085-34694107 TGTCTTCCTAACCATGAGCATGG - Intergenic
1148229724 17:45924347-45924369 TCAGTTCCTCACCATTAGCAGGG + Intronic
1149576522 17:57717193-57717215 TCACATCTTCACCATCATCAAGG + Intergenic
1151748461 17:76023912-76023934 TCCCATCTTCACCATCACCAAGG + Intronic
1152237626 17:79146827-79146849 GCTCAACCTCACCATGAGGAGGG + Intronic
1153907204 18:9672856-9672878 TCGCATCCTCACCACCTGGATGG + Intergenic
1157528705 18:48404837-48404859 TCACGTCCTCAGCATCAGCAAGG - Intronic
1159554386 18:69930006-69930028 TCTCCTCTGCACCATGAGCACGG + Intronic
1160368169 18:78347369-78347391 TCGAATACTCACTATGAGCCAGG - Intergenic
1160910514 19:1471770-1471792 TCCCATCCCCAGCATGGGCAAGG + Exonic
1161395884 19:4044624-4044646 ACGCAACTTCACCATGAGAATGG + Exonic
1161746671 19:6064351-6064373 TCCCTTTCTGACCATGAGCAGGG + Intronic
1162971595 19:14184043-14184065 TCGCATCCTCACCATGAGCAAGG + Intronic
1165747818 19:38240758-38240780 TGGAACCCTCACTATGAGCAAGG + Intergenic
1166534571 19:43564413-43564435 TCGGATTCTCACCATGTGCCAGG + Intronic
926633904 2:15160853-15160875 TATCATCCTCACCCTGAGAATGG - Intergenic
928801476 2:35099274-35099296 TCTCATCCTAGCCATGACCATGG - Intergenic
932561407 2:72874202-72874224 TAGCAACATCACCATCAGCAGGG - Intergenic
936981492 2:118269328-118269350 TCACATCCTCACCAGCAGCCGGG - Intergenic
940958604 2:159756853-159756875 TCGCATACTTACCATGTGCCTGG - Intronic
946176880 2:217927724-217927746 TCTCTTCCTCACCCAGAGCACGG + Intronic
1170580239 20:17693729-17693751 TCTCTTCCCCACCGTGAGCAAGG - Intronic
1171720823 20:28561518-28561540 TCTCATCGTCACCATCATCATGG + Intergenic
1171757257 20:29122186-29122208 TCTCATACTCACCATCATCACGG - Intergenic
1172513416 20:35515905-35515927 TCTCATCCTCACCTCCAGCAGGG - Exonic
1172573208 20:35986475-35986497 TTCCATCCTCACCATGACCTTGG - Intronic
1172576202 20:36010796-36010818 TCTCATGCTCAGCATGAGGAAGG - Intronic
1175257730 20:57657177-57657199 CTGCATCCTCCCCATGACCACGG + Intronic
1177705791 21:24702508-24702530 TCACATAGTCATCATGAGCATGG - Intergenic
1177872603 21:26591507-26591529 TCCCATCCTCACCAGGACCCTGG + Intergenic
949593777 3:5522393-5522415 TTGCTTCCTGTCCATGAGCATGG + Intergenic
953344814 3:42166329-42166351 TGGCACCCTCACCATGAGCCTGG - Intronic
961149977 3:124629157-124629179 TCTCATCATCACCATGATCTTGG - Intronic
966412378 3:179656923-179656945 TTTTATCCTCACCATGTGCAGGG - Intronic
967892974 3:194376107-194376129 ACGCATCATCACCATGAGGAAGG - Intergenic
973981776 4:56314037-56314059 TAGGATCCACAACATGAGCAAGG + Exonic
974075726 4:57166611-57166633 GTGCATGCTCACCATTAGCACGG + Intergenic
977926449 4:102705619-102705641 CCCCATCCTCCCCAGGAGCAGGG + Intronic
989420903 5:41239225-41239247 TCTCAGCCTCCCCATGAGCTGGG + Intronic
997691113 5:135828085-135828107 TCTCTTCATCCCCATGAGCAGGG - Intergenic
997747723 5:136314156-136314178 TTCCATCTTCACCATGAGCTGGG + Intronic
998038362 5:138935453-138935475 TGGCATCCCCACCCTAAGCAAGG + Intergenic
998449624 5:142224038-142224060 TCGCACACTTACCATGAGCCAGG + Intergenic
1005850394 6:29816581-29816603 TTGCATCCTCACCAGAAGGAAGG + Intergenic
1005863005 6:29915842-29915864 TTGCATCCTCACCAGAAGGAAGG + Intergenic
1005867644 6:29948226-29948248 TTGCATCCTCACCAGAAGGAAGG + Intergenic
1005874579 6:30001352-30001374 TTGCATCCTCACCAGAAGCAAGG + Intergenic
1008389544 6:50933848-50933870 TCCCACCCTCACCATGATCGTGG + Intergenic
1011211980 6:84965055-84965077 TGGTACCCCCACCATGAGCAAGG + Intergenic
1013487636 6:110612585-110612607 TTGCACCCTCACCATGTGCCTGG - Exonic
1014961317 6:127688929-127688951 ATTCATCCTCTCCATGAGCATGG + Intergenic
1015250911 6:131126773-131126795 TTGTAACCACACCATGAGCAGGG - Intergenic
1019748737 7:2715442-2715464 TCCCACCCTCAGCATGAGCCAGG - Exonic
1019812559 7:3175276-3175298 TAGGATCCTCATCATGAGAAAGG + Intergenic
1019877185 7:3824120-3824142 TCACACCCTCACCAGGAGCAGGG - Intronic
1020939703 7:14516832-14516854 TCTCTTCCTGTCCATGAGCATGG - Intronic
1028156995 7:87441463-87441485 TCGCATGTTCATAATGAGCAGGG + Intronic
1038018626 8:23534939-23534961 TCCCGTCCTCACCCTGAGGATGG + Intronic
1046819249 8:118618542-118618564 TTTAATCCTCACAATGAGCAGGG + Intronic
1047548507 8:125843571-125843593 AGGCATCCTCACTATGTGCATGG - Intergenic
1051725267 9:20082492-20082514 TCGCATCCTTGCCAGGAGCATGG + Intergenic
1053118802 9:35529735-35529757 TTCCATCCTCAGAATGAGCATGG + Intronic
1054338242 9:63828718-63828740 TCTCATACTCACCATCATCACGG + Intergenic
1062703508 9:137920787-137920809 TCACATCCACTCTATGAGCAAGG - Intronic
1202784279 9_KI270718v1_random:32567-32589 TCTCATACTCACCATCATCACGG - Intergenic
1186059831 X:5692402-5692424 TTGCATCCTCAGCAGGAACAGGG - Intergenic
1186601279 X:11040441-11040463 TAGCAACTTCACTATGAGCAGGG - Intergenic
1187269753 X:17769040-17769062 CCTCATCCAGACCATGAGCAAGG - Intergenic
1189246194 X:39565416-39565438 TCCCATCCTCACACTGAGCTCGG + Intergenic
1192265650 X:69535834-69535856 TTGCAGCCTCAGCATGGGCAAGG + Intergenic
1194962749 X:100254564-100254586 ACTCTTCCTCTCCATGAGCATGG - Intergenic