ID: 1162975544

View in Genome Browser
Species Human (GRCh38)
Location 19:14205771-14205793
Sequence TCCCAGGCCCCTCGCCAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 1, 2: 4, 3: 20, 4: 214}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162975520_1162975544 22 Left 1162975520 19:14205726-14205748 CCCGTCCGCACCCCCGCGCCCCG 0: 2
1: 0
2: 2
3: 49
4: 534
Right 1162975544 19:14205771-14205793 TCCCAGGCCCCTCGCCAGTGGGG 0: 1
1: 1
2: 4
3: 20
4: 214
1162975525_1162975544 12 Left 1162975525 19:14205736-14205758 CCCCCGCGCCCCGGGCGCTCCGT 0: 1
1: 1
2: 1
3: 26
4: 230
Right 1162975544 19:14205771-14205793 TCCCAGGCCCCTCGCCAGTGGGG 0: 1
1: 1
2: 4
3: 20
4: 214
1162975529_1162975544 9 Left 1162975529 19:14205739-14205761 CCGCGCCCCGGGCGCTCCGTGGG 0: 1
1: 1
2: 1
3: 17
4: 206
Right 1162975544 19:14205771-14205793 TCCCAGGCCCCTCGCCAGTGGGG 0: 1
1: 1
2: 4
3: 20
4: 214
1162975526_1162975544 11 Left 1162975526 19:14205737-14205759 CCCCGCGCCCCGGGCGCTCCGTG 0: 1
1: 1
2: 2
3: 28
4: 218
Right 1162975544 19:14205771-14205793 TCCCAGGCCCCTCGCCAGTGGGG 0: 1
1: 1
2: 4
3: 20
4: 214
1162975527_1162975544 10 Left 1162975527 19:14205738-14205760 CCCGCGCCCCGGGCGCTCCGTGG 0: 1
1: 1
2: 0
3: 19
4: 181
Right 1162975544 19:14205771-14205793 TCCCAGGCCCCTCGCCAGTGGGG 0: 1
1: 1
2: 4
3: 20
4: 214
1162975534_1162975544 3 Left 1162975534 19:14205745-14205767 CCCGGGCGCTCCGTGGGGGCCGC No data
Right 1162975544 19:14205771-14205793 TCCCAGGCCCCTCGCCAGTGGGG 0: 1
1: 1
2: 4
3: 20
4: 214
1162975536_1162975544 -7 Left 1162975536 19:14205755-14205777 CCGTGGGGGCCGCCCCTCCCAGG 0: 1
1: 3
2: 2
3: 31
4: 389
Right 1162975544 19:14205771-14205793 TCCCAGGCCCCTCGCCAGTGGGG 0: 1
1: 1
2: 4
3: 20
4: 214
1162975521_1162975544 21 Left 1162975521 19:14205727-14205749 CCGTCCGCACCCCCGCGCCCCGG 0: 2
1: 0
2: 4
3: 51
4: 509
Right 1162975544 19:14205771-14205793 TCCCAGGCCCCTCGCCAGTGGGG 0: 1
1: 1
2: 4
3: 20
4: 214
1162975524_1162975544 17 Left 1162975524 19:14205731-14205753 CCGCACCCCCGCGCCCCGGGCGC 0: 1
1: 1
2: 10
3: 88
4: 793
Right 1162975544 19:14205771-14205793 TCCCAGGCCCCTCGCCAGTGGGG 0: 1
1: 1
2: 4
3: 20
4: 214
1162975533_1162975544 4 Left 1162975533 19:14205744-14205766 CCCCGGGCGCTCCGTGGGGGCCG 0: 1
1: 1
2: 2
3: 17
4: 131
Right 1162975544 19:14205771-14205793 TCCCAGGCCCCTCGCCAGTGGGG 0: 1
1: 1
2: 4
3: 20
4: 214
1162975535_1162975544 2 Left 1162975535 19:14205746-14205768 CCGGGCGCTCCGTGGGGGCCGCC 0: 1
1: 1
2: 2
3: 16
4: 187
Right 1162975544 19:14205771-14205793 TCCCAGGCCCCTCGCCAGTGGGG 0: 1
1: 1
2: 4
3: 20
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162975544 Original CRISPR TCCCAGGCCCCTCGCCAGTG GGG Intronic
900139889 1:1135183-1135205 TCCCAGGCCCCTCCCTGGGGAGG - Intergenic
900335586 1:2161446-2161468 TCCCAGAGCCCTGGGCAGTGAGG + Intronic
900540302 1:3199389-3199411 TCCGGAGCCCCTTGCCAGTGGGG + Intronic
900610581 1:3542963-3542985 TCCCAGGCCCCTGGGCAGGTGGG - Intronic
901225521 1:7610936-7610958 TCCCAGGCCCCCAGGCAGAGGGG + Intronic
901811826 1:11771697-11771719 TCCCCCGCCCCTGCCCAGTGTGG - Intronic
902339272 1:15772255-15772277 TCCCAGGCTCACCACCAGTGAGG + Intronic
902391039 1:16106667-16106689 TCCGTGGACCCTTGCCAGTGGGG - Intergenic
903459261 1:23509326-23509348 TCCCAGCCCCCACCACAGTGGGG + Exonic
903462553 1:23529897-23529919 TCCCAGGCTCGTTGCCAGAGAGG - Intronic
905240331 1:36576894-36576916 TCCCAGGCCTCTCCCCAGGTTGG - Intergenic
905479120 1:38249124-38249146 CCCCCTGCCCCTCTCCAGTGAGG + Intergenic
909864580 1:80651588-80651610 CCCCAGTACCCTCTCCAGTGTGG + Intergenic
915561628 1:156691440-156691462 ACCCAGGCCCCTCGCTGGTGAGG + Intergenic
920396118 1:205647407-205647429 TCCCAGGCCCCAGGACTGTGAGG - Intergenic
921219530 1:212963320-212963342 TCCCAGCCCCCTGCCCACTGGGG + Intronic
1068845140 10:61663158-61663180 TCCCAGGCCGCTCACCAGCCGGG - Exonic
1070301989 10:75210570-75210592 TCCCCGCCCCCTCGCCTCTGAGG + Intronic
1070519939 10:77243898-77243920 TTCAAGGCCTCTCACCAGTGAGG + Intronic
1075725158 10:124607225-124607247 TCACAGGGCACTGGCCAGTGTGG + Intronic
1075778133 10:125001094-125001116 TCCCAGGCCCCCTGTCATTGAGG + Intronic
1076632356 10:131858700-131858722 TCGACGGCCCCTCGGCAGTGCGG + Intergenic
1076689145 10:132212013-132212035 TCCCAGGCCCCTCCTCGCTGTGG - Intronic
1076796776 10:132802177-132802199 ACCCAGGCTCCTCGCAACTGTGG + Intergenic
1077106298 11:843961-843983 GCCCAGGGCCCTGGCCAGGGTGG - Intronic
1077178923 11:1203635-1203657 TCCCAGACACCTGGGCAGTGGGG + Intergenic
1077244897 11:1531963-1531985 TCCCGTCCCCCTCGGCAGTGGGG + Intergenic
1079552669 11:21719561-21719583 TCTCAGGCGCTTCGCCAATGAGG - Intergenic
1080616042 11:33945659-33945681 TGCTAGGCCCCTAGGCAGTGTGG - Intergenic
1083311806 11:61787666-61787688 TCCCAGCCCCCTCCCCAATTTGG + Exonic
1084660261 11:70542589-70542611 TCCCAGAGCCCTGCCCAGTGAGG - Intronic
1085113284 11:73907651-73907673 TCCCATTCCCCTACCCAGTGGGG - Intronic
1085278357 11:75314252-75314274 TCCCAGGCCCCTTGCCATTGTGG - Intronic
1085532610 11:77200926-77200948 TCCCACCCCCCTCCCCACTGAGG - Intronic
1085838165 11:79978604-79978626 TTCCAGGCCCATAGCCAGTGTGG - Intergenic
1086437549 11:86797236-86797258 TCCCATTTCCCTCCCCAGTGGGG - Intronic
1089119769 11:116125233-116125255 TCCCAGGACCCTCACAAGTGAGG - Intergenic
1089688397 11:120171076-120171098 TGTCAGGCCACTGGCCAGTGGGG + Exonic
1090404085 11:126466908-126466930 TCCAAGGCCTCCCTCCAGTGTGG + Intronic
1090763328 11:129855905-129855927 ACCCAGGCCCCTCGCTGGTCTGG + Intronic
1091819824 12:3467634-3467656 TCCCAGGCCCCTGTCGACTGTGG + Intronic
1092256726 12:6929987-6930009 TCCCAGGCCCATCCCAGGTGAGG + Intronic
1096548298 12:52356299-52356321 CCCTAGGCCCCTCACCACTGGGG + Intergenic
1096647987 12:53048528-53048550 TTCCAGGCCCCCGGCCAGTGTGG - Intronic
1096850534 12:54432855-54432877 ACCCAGACCCATCCCCAGTGGGG - Intergenic
1097178345 12:57156505-57156527 TCCCATTCCCCTTGCCAGTCTGG + Intronic
1097223509 12:57463745-57463767 TCTCCGGCCCCTCCCCAGTCAGG + Exonic
1097233547 12:57525889-57525911 CCCCAGGCCCCTCCACCGTGGGG - Exonic
1097246603 12:57610901-57610923 CCCCTGGCCCCTCGCCAGCCCGG + Intronic
1100372519 12:93981389-93981411 TCCCATGCCACTTGCCAGAGGGG - Intergenic
1101220616 12:102635404-102635426 TCCCTGGCCTCACGTCAGTGAGG - Intergenic
1101333863 12:103779184-103779206 TCCCAGCCTCCTCGGAAGTGAGG + Intronic
1101517653 12:105451703-105451725 TCCCAGGGACTTCGCCATTGTGG - Intergenic
1101845701 12:108361512-108361534 CCCCAGGCCCAACACCAGTGGGG + Intergenic
1106235580 13:27857709-27857731 TCCTAGGACCCTAGCCATTGAGG - Intergenic
1107228975 13:38085994-38086016 TCCCAGAGCCCACTCCAGTGTGG + Intergenic
1107923881 13:45239115-45239137 TCCCTGGCCCCTCCCCAGTTTGG + Intronic
1113799555 13:113079279-113079301 TCCCTGGCCCTGCACCAGTGAGG - Intronic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1115939059 14:38588978-38589000 TCCCAGGACCTTCACCTGTGTGG + Intergenic
1115985951 14:39103449-39103471 TCCCACGCCCCTCGGCCGTCCGG - Exonic
1116113973 14:40624876-40624898 TCTCAGTCCCTTTGCCAGTGGGG + Intergenic
1117954304 14:61110924-61110946 TCCCTGGCCCCTGGCCCCTGGGG - Intergenic
1118380637 14:65214808-65214830 TCCTAGGTCCCTCGCCTGGGTGG - Intergenic
1120787566 14:88551267-88551289 ACCCCGGCCCCTCTCCAGGGTGG + Intronic
1122501629 14:102204038-102204060 TCTCAGACCCCAGGCCAGTGTGG - Intronic
1123112885 14:105881287-105881309 TCCCAGCCCCCTCCCCATTGAGG - Intergenic
1123411648 15:20065968-20065990 TCCCAGGCACCCCTGCAGTGAGG - Intergenic
1123441388 15:20294733-20294755 TCCTAGGCCCCGCGCCATGGGGG + Intergenic
1123520994 15:21073087-21073109 TCCCAGGCACCCCTGCAGTGAGG - Intergenic
1125599204 15:40906469-40906491 CCCCAGGGCCCTCTCCAGGGCGG - Intergenic
1125749411 15:42018714-42018736 TCCCAGCCCCCTCCCCAGCCTGG + Intronic
1128303316 15:66581029-66581051 TCCCAGGCCCACAGCCAGTGGGG - Intergenic
1129781720 15:78276692-78276714 TCCCAGCCCCACGGCCAGTGAGG - Intronic
1131817222 15:96234152-96234174 TGCCTGGCCCCTAGCCAGTGGGG - Intergenic
1132090551 15:98945030-98945052 TCCCAGGCCCTTGGGCACTGTGG + Intronic
1132344352 15:101099389-101099411 TCCCAGGAGCCTCTCCACTGGGG + Intergenic
1132354730 15:101162936-101162958 TCCCAGCCCTCTGGCCACTGAGG + Intergenic
1132695150 16:1198777-1198799 GCCCAGGCCCCACCCCCGTGAGG + Intronic
1132713248 16:1278526-1278548 CCCCCGGCCCCTCGCCTGTCAGG + Intergenic
1136247686 16:28984969-28984991 TCCCACCCCACCCGCCAGTGGGG - Intronic
1137291030 16:47052066-47052088 GGCCAGGACCCTCCCCAGTGAGG + Intergenic
1138659401 16:58508643-58508665 CCCCAGTGCCCTCGGCAGTGAGG - Intronic
1140865736 16:79060331-79060353 GCCCATGTCCCTCTCCAGTGAGG + Intronic
1142358097 16:89613593-89613615 TCCCAGGCCCCTCCTCAGGAAGG - Intronic
1142398991 16:89849366-89849388 TCCCTGTCCCCACGTCAGTGTGG + Intronic
1142598995 17:1043956-1043978 TCTCAGGCCCTTCTCCAGTCTGG + Intronic
1144339020 17:14297640-14297662 TCCCGCTCCCCTCGCCAGCGAGG - Intergenic
1144495524 17:15742663-15742685 TCCCTGGGCCCTCGCAAGTCGGG - Intronic
1144637962 17:16923111-16923133 TCTCAGCCCCCTCCACAGTGTGG + Intergenic
1145763839 17:27444308-27444330 TCTCAGCCCCCACACCAGTGGGG - Intergenic
1146183247 17:30710003-30710025 TCCCGGGCCCCTCGCCAGTGGGG - Intergenic
1146793710 17:35766854-35766876 TCCGGGGCCCCAAGCCAGTGTGG - Exonic
1146838701 17:36134400-36134422 TCCCAGGACTCTGGCCAGTGGGG + Intergenic
1147479431 17:40745234-40745256 TCCCAGGCCCCTCACCTTGGAGG + Intergenic
1147635689 17:41962466-41962488 CTCTAGGCCCCTCTCCAGTGGGG - Intronic
1149599522 17:57884581-57884603 TGCCAGTTCCCTAGCCAGTGAGG + Intronic
1150643877 17:66966121-66966143 ATCCAGGCCCCTCCCCAGTAGGG - Intronic
1151540260 17:74761236-74761258 TCCCAGTCCCCTCCCCATTCAGG + Intronic
1151549546 17:74814242-74814264 TCCCAGGCCCCCTTCCTGTGGGG + Intronic
1152419104 17:80182561-80182583 CCCCAGGCCTCTCCCCCGTGGGG + Intronic
1152624514 17:81382092-81382114 TCCCGTGCCCATCGCCAGAGAGG - Intergenic
1152644643 17:81463155-81463177 TCCCAGGTCCCTCCCCACAGTGG + Intronic
1153313823 18:3702787-3702809 TGGCAGGCCCCTTACCAGTGGGG + Intronic
1155378328 18:25187691-25187713 TCCCAGGGCTCTCTCCATTGAGG + Intronic
1156491946 18:37501543-37501565 TCCCAGGCCCATCCCCAGGCAGG - Intronic
1157278382 18:46328894-46328916 TCCCAGACCCCCTGGCAGTGAGG - Intronic
1158901032 18:61961970-61961992 TCCTAGGCCTCTCCCTAGTGAGG - Intergenic
1160972492 19:1775719-1775741 TCCCAGCCCCCTCTCCATTCAGG + Exonic
1161039319 19:2101587-2101609 TCCCAGGCCACGCGCCAGCCAGG - Exonic
1161487273 19:4543144-4543166 ACCCAGGCCCCTGGCGTGTGTGG - Exonic
1161512449 19:4679237-4679259 TCCCACCCTCCTCGCCATTGAGG + Intronic
1161593057 19:5137383-5137405 GCCCCGGCCCCACTCCAGTGGGG + Intronic
1161767778 19:6216568-6216590 TCCAGGGCCCCTCGCCCATGAGG + Intronic
1162320507 19:9968600-9968622 TCCCAGCCCCCCAGCCAGGGAGG + Intronic
1162975544 19:14205771-14205793 TCCCAGGCCCCTCGCCAGTGGGG + Intronic
1163437608 19:17304689-17304711 CCCCAGGCCCCTGGCCCTTGAGG + Intronic
1163600572 19:18246980-18247002 TCCCAGGCCCATCACCTGAGTGG - Intronic
1167300081 19:48673029-48673051 TCTCAGGCCCCAGGCTAGTGGGG + Intronic
1167359283 19:49021331-49021353 GACCAGGCCCCTCGGCAGGGAGG - Intergenic
1167461448 19:49626522-49626544 TCCCAGAGCCCTGGGCAGTGGGG + Intergenic
1167934234 19:52893244-52893266 CCCCAGGCACCTCCCCAATGCGG + Intronic
1167973097 19:53201214-53201236 TCCCAGGACCATGCCCAGTGGGG - Intergenic
1167988964 19:53341519-53341541 TCCCAGGACCATGCCCAGTGCGG - Intronic
1168152662 19:54457196-54457218 TCCCAGGCCCGTGGGCTGTGGGG + Intronic
925306202 2:2849488-2849510 GCCCAGGCCCCTTGGCTGTGGGG + Intergenic
925318185 2:2940704-2940726 TCCCAGGCACAGAGCCAGTGAGG - Intergenic
927041421 2:19234451-19234473 TGCCAAGCCCCTTGCCAGGGAGG + Intergenic
927690039 2:25201993-25202015 GCCCTGGTCCCTCTCCAGTGGGG + Intergenic
928168439 2:28987897-28987919 TCCAAGGCCCCCCGCCACTCAGG - Intronic
929079234 2:38106049-38106071 ACCCAGACCCCTCGTCAGGGCGG - Intronic
938262717 2:129906885-129906907 TCCCAGGGCCATCCCCAGGGTGG + Intergenic
938932080 2:136095339-136095361 TCACAGACTCCTCACCAGTGAGG + Intergenic
941993576 2:171579900-171579922 TCTCAGGCCCCACTCCAGAGAGG - Intergenic
942295560 2:174513930-174513952 TTCCATGCCCCTTGCCAGCGGGG + Intergenic
948206230 2:236164116-236164138 CCCCAGGCCCCTCCGCCGTGGGG + Intergenic
948455229 2:238101671-238101693 TCCTGGGCCCGTCCCCAGTGTGG - Intronic
948609507 2:239157871-239157893 GCCCAGGCACCTGGGCAGTGGGG + Intronic
948749651 2:240124315-240124337 CCCCAGGCCCCTCCAGAGTGGGG + Intergenic
1171047258 20:21821883-21821905 TCCCAGCTCCCTCTCCATTGTGG + Intergenic
1172525912 20:35600613-35600635 TCTCAGGCCCCTCGGCACCGGGG + Intergenic
1173872296 20:46349780-46349802 CACCAGTCCCCTCCCCAGTGGGG - Exonic
1173877365 20:46382648-46382670 TCCCAGGCCCCTCGGCTCTTAGG + Intronic
1174040733 20:47697650-47697672 TCCCAGGCCCCTGGTAACTGGGG + Intronic
1174267171 20:49340354-49340376 TCCCAGGTCCCTCGGCACCGGGG - Intergenic
1175389881 20:58620330-58620352 TCCCAGGCAGGTCCCCAGTGAGG + Intergenic
1175401158 20:58700857-58700879 TCTCCTGCCCCTGGCCAGTGTGG - Intronic
1175416601 20:58805315-58805337 GCCCAGGCCCCTCTCCAATGTGG + Intergenic
1175679413 20:60975042-60975064 TCCCAGGTCCCTAAGCAGTGAGG - Intergenic
1175722111 20:61293825-61293847 TTCCTGGCCCCTCACCAGGGTGG + Intronic
1175904857 20:62374767-62374789 CCACTGGCCCCTCGCCAGTGTGG + Intergenic
1175905515 20:62377690-62377712 TCCCAGGCTCCCAGCCAGGGAGG - Intergenic
1176040161 20:63060952-63060974 ACCCAGGCCCCTAACCACTGTGG - Intergenic
1179213633 21:39348794-39348816 TCCCGGGCCCGTCGCCACCGTGG + Intronic
1180135341 21:45858682-45858704 TCCCAGGTCCCCCTTCAGTGAGG + Intronic
1180995832 22:19964758-19964780 ACTCAGGGTCCTCGCCAGTGGGG - Intronic
1181849560 22:25740359-25740381 TCCCATGCCACTCTCCACTGGGG + Intergenic
1183107595 22:35625954-35625976 TCCCAGCCTCCTCTGCAGTGAGG - Intronic
1183383025 22:37499943-37499965 TCCCAGCCCCCTCCCCAGTCAGG + Intronic
1183746975 22:39697711-39697733 TGCCAGGCCCCCAGCCAGAGAGG - Intergenic
1184036564 22:41920814-41920836 CCCCAGGGCCCTGGCCGGTGGGG - Intergenic
1184373439 22:44097244-44097266 TCCCAGGGCACTTGGCAGTGAGG + Intronic
1184683611 22:46085973-46085995 TGCCAGGCCTCCCGCCTGTGCGG + Intronic
1184837334 22:47031726-47031748 ACCCCGGCCCCTCACCTGTGAGG - Intronic
1184932376 22:47690812-47690834 TCCCAGGCCCCCCGCTGCTGGGG - Intergenic
1185158514 22:49208472-49208494 TCCCAGGCACCTCATCATTGAGG + Intergenic
1185266400 22:49906509-49906531 TCCCAGGCCCGAGGGCAGTGCGG + Intronic
950636583 3:14319757-14319779 TCCCAGGCTCCTCTGCAGTGAGG + Intergenic
950699071 3:14727546-14727568 TCCCAGGCCCATCAGCAGTCAGG - Intronic
950707819 3:14793873-14793895 TCCCAGGCCCCTCGCCACCCTGG + Intergenic
951490476 3:23265414-23265436 TCCCAGTCACCTCTCCAGTCTGG - Intronic
951630432 3:24714215-24714237 TCTCAGGCCCCTCCCCAGGCCGG - Intergenic
954883188 3:53849649-53849671 TCCCAGGGCCATCTCCAGAGTGG + Exonic
956110804 3:65868179-65868201 TCACAGCCACCTTGCCAGTGAGG + Intronic
956891961 3:73622452-73622474 GCCCAGGCCCCTCCCCAGGAAGG + Intronic
961666374 3:128495683-128495705 GCCCATGCCCCTCCCCAGTGAGG - Intergenic
961740889 3:129032661-129032683 TCCCAGGCTCCTGTGCAGTGAGG - Intronic
962370580 3:134817863-134817885 TCCCAAGCCCCTGCCCAGAGGGG + Intronic
962391587 3:134977212-134977234 TCCCAGGCCACTCGCAACAGTGG - Intronic
967723252 3:192837497-192837519 TCCGAGGCCCCTCGGCACAGAGG + Intronic
968088545 3:195885616-195885638 TCCCAGGCCCCTTCCCAGCAAGG - Intronic
968225265 3:196968954-196968976 CCCCAGGACCCTCCCCAGCGCGG - Intronic
977145910 4:93439809-93439831 TGGCATGCCCCTCTCCAGTGTGG - Intronic
977323684 4:95549215-95549237 TCCGGGTCCCCTCGCCTGTGAGG + Intergenic
980926249 4:139141118-139141140 TCCCAGGCCCCTTGAAAATGAGG - Intronic
986294973 5:6430615-6430637 TCCCAGGCCCAGGGCCAGTGGGG + Intergenic
986299347 5:6466072-6466094 TCCCAGGGCCCTGAGCAGTGCGG + Intronic
987577344 5:19747170-19747192 TCCCAGCACCCTCTCCAGTAAGG + Exonic
989117796 5:37972746-37972768 TCCAAGAGCCCTCACCAGTGGGG - Intergenic
989736011 5:44707862-44707884 TCCCAGGCCGCGGGCAAGTGAGG + Intergenic
992910836 5:81394283-81394305 TCCCAGGACTATCGCGAGTGGGG + Intergenic
995552308 5:113293789-113293811 CCCCAGACCCCTCCCCAGCGCGG + Intronic
996709672 5:126531945-126531967 TCCCAGGGCTCTCTCCACTGTGG - Intergenic
998139517 5:139692006-139692028 TCCCTGGGCTCTCTCCAGTGTGG - Intergenic
998170861 5:139871266-139871288 TGCCAGGCTCCTCGCTATTGGGG + Intronic
998403898 5:141862979-141863001 TCACAGGTCTCTCCCCAGTGGGG + Intronic
999365466 5:151020822-151020844 TCCCAGGCTCCCCGCCAGATGGG + Intronic
1001650339 5:173311323-173311345 TCCCAGCCCCTGCCCCAGTGAGG - Intergenic
1002057999 5:176609796-176609818 TTCCAGGCTCCTCGCCGGGGCGG - Intronic
1002539897 5:179899783-179899805 CTCCAGGCCCCTGGCCAGCGAGG + Intronic
1002759219 6:188961-188983 TCCCTGGCCACTGGACAGTGAGG - Intergenic
1005375213 6:25174896-25174918 TCCTAAGCCCCTCGGCAGTGTGG - Intergenic
1007184891 6:39961393-39961415 TCTCAGGCCCCCAGCCAGTCTGG + Intergenic
1007288067 6:40762403-40762425 TTCCAGGCCCCAGGCCTGTGAGG + Intergenic
1010196902 6:73248628-73248650 TCCCAGCCCCTTGGTCAGTGAGG + Intronic
1017719941 6:157236792-157236814 GCCTGGGCCCCTCGCCAGGGTGG - Intergenic
1018774400 6:166999602-166999624 GCCCCGGTCCCTCGCCAGGGAGG - Intronic
1018854019 6:167662808-167662830 CCTCAGGCCACCCGCCAGTGAGG + Intergenic
1019712982 7:2525803-2525825 TCCCAGGCTCCTCGCCACTGTGG + Intronic
1023862929 7:44226565-44226587 CCGAGGGCCCCTCGCCAGTGGGG - Exonic
1024632750 7:51262888-51262910 TCCCAGGCTCCTGGCAAGTTGGG - Intronic
1026104211 7:67408184-67408206 TTCCAGGCCCCAGGCCAATGGGG - Intergenic
1029457275 7:100677653-100677675 GGCCAGGCCCCTCACCAGTGTGG - Exonic
1029622705 7:101699975-101699997 TCCCAGGGCCCTCTCCACTGTGG + Intergenic
1033025379 7:137766982-137767004 TCCTAGGCCACTCTGCAGTGGGG + Intronic
1038613387 8:29072779-29072801 ACCAAGGCCCCTCGCCACAGAGG + Intronic
1045665185 8:104477176-104477198 TCCCAGGCCCCAGGGGAGTGAGG - Intergenic
1048277251 8:133076283-133076305 ACCCAGGCCCCAGTCCAGTGAGG + Intronic
1049222689 8:141435112-141435134 TCCCAGGCCTCTCACCAGGCAGG + Intergenic
1049487661 8:142874924-142874946 GCCCAGGCCCCTCCCCAGCCCGG + Intronic
1049602749 8:143515525-143515547 TCCCAGGCCCCTCCACTGTTTGG + Intronic
1049647303 8:143741230-143741252 CCCCAGACGCCTAGCCAGTGAGG - Intergenic
1049808752 8:144553752-144553774 TCCCTGGCCCTTGGCCAGTGTGG - Intronic
1049967928 9:796102-796124 TCCCAGGCCCCACCTCAGAGGGG + Intergenic
1052487323 9:29118706-29118728 TCCCAGGTCCCTTGGCAGTTGGG - Intergenic
1053067637 9:35079597-35079619 GCCCAGGCCCCTCCCCGCTGGGG - Exonic
1056177023 9:84045378-84045400 TCCCAGGCCCCTAGACAGTGTGG + Intergenic
1056721791 9:89078501-89078523 TCCCAGCAGCCTCACCAGTGCGG - Intronic
1061421766 9:130476687-130476709 TCCCAGGCCTCTGGCAAGCGAGG + Intronic
1062122185 9:134839711-134839733 TCTCTGGCTCCTCGCCGGTGGGG + Intronic
1062355463 9:136160031-136160053 CCCCAGGGTCTTCGCCAGTGTGG + Intergenic
1062589673 9:137267902-137267924 TCCCAAGCCCCTCGCCAGTTAGG - Intronic
1186167080 X:6838120-6838142 TCTTATCCCCCTCGCCAGTGAGG + Intergenic
1189107808 X:38255670-38255692 TCCCAGGCCGCTTTCCCGTGGGG - Intronic
1189365821 X:40387703-40387725 TCCCAGGCCGCTTTCCCGTGGGG - Intergenic
1189922361 X:45915050-45915072 TTGCAGACCCCTCACCAGTGGGG + Intergenic
1194756044 X:97741205-97741227 TCCCAGCCCCTTCTCCAGAGAGG - Intergenic
1195471558 X:105235962-105235984 TCCCAGGCCCATTGCCGGAGAGG - Intronic
1195641840 X:107183851-107183873 TCCCAACACCCTCGCCAGGGTGG + Intronic
1198232608 X:134706276-134706298 TCCCAATCACCTAGCCAGTGTGG + Intronic