ID: 1162975651

View in Genome Browser
Species Human (GRCh38)
Location 19:14206066-14206088
Sequence CTTCCCCCCAGCCCCGGCTC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 650
Summary {0: 2, 1: 0, 2: 5, 3: 58, 4: 585}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162975651_1162975661 2 Left 1162975651 19:14206066-14206088 CCGGAGCCGGGGCTGGGGGGAAG 0: 2
1: 0
2: 5
3: 58
4: 585
Right 1162975661 19:14206091-14206113 GGTAGGAGGTGGCGGGACGAGGG 0: 1
1: 1
2: 1
3: 33
4: 518
1162975651_1162975660 1 Left 1162975651 19:14206066-14206088 CCGGAGCCGGGGCTGGGGGGAAG 0: 2
1: 0
2: 5
3: 58
4: 585
Right 1162975660 19:14206090-14206112 GGGTAGGAGGTGGCGGGACGAGG 0: 1
1: 0
2: 5
3: 66
4: 629
1162975651_1162975658 -6 Left 1162975651 19:14206066-14206088 CCGGAGCCGGGGCTGGGGGGAAG 0: 2
1: 0
2: 5
3: 58
4: 585
Right 1162975658 19:14206083-14206105 GGGAAGCGGGTAGGAGGTGGCGG 0: 1
1: 1
2: 11
3: 139
4: 2100
1162975651_1162975659 -5 Left 1162975651 19:14206066-14206088 CCGGAGCCGGGGCTGGGGGGAAG 0: 2
1: 0
2: 5
3: 58
4: 585
Right 1162975659 19:14206084-14206106 GGAAGCGGGTAGGAGGTGGCGGG 0: 1
1: 1
2: 5
3: 61
4: 685
1162975651_1162975662 5 Left 1162975651 19:14206066-14206088 CCGGAGCCGGGGCTGGGGGGAAG 0: 2
1: 0
2: 5
3: 58
4: 585
Right 1162975662 19:14206094-14206116 AGGAGGTGGCGGGACGAGGGCGG 0: 1
1: 2
2: 2
3: 79
4: 983
1162975651_1162975664 30 Left 1162975651 19:14206066-14206088 CCGGAGCCGGGGCTGGGGGGAAG 0: 2
1: 0
2: 5
3: 58
4: 585
Right 1162975664 19:14206119-14206141 TCCGTGTCCCTTCCTTCCCCTGG 0: 2
1: 1
2: 5
3: 15
4: 318
1162975651_1162975657 -9 Left 1162975651 19:14206066-14206088 CCGGAGCCGGGGCTGGGGGGAAG 0: 2
1: 0
2: 5
3: 58
4: 585
Right 1162975657 19:14206080-14206102 GGGGGGAAGCGGGTAGGAGGTGG 0: 1
1: 4
2: 9
3: 145
4: 1552

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162975651 Original CRISPR CTTCCCCCCAGCCCCGGCTC CGG (reversed) Exonic
900106633 1:984230-984252 TTGCCCCCCAGGCCCGGGTCTGG - Intergenic
900429884 1:2596466-2596488 CTCCCACCCCGCCCAGGCTCAGG - Intronic
900467037 1:2830894-2830916 CTTCCCCCTCGCCGGGGCTCCGG - Intergenic
900513187 1:3069829-3069851 CCTCCGCCCCTCCCCGGCTCGGG - Intronic
900813348 1:4825071-4825093 CAGCCCTCCAGCCCCTGCTCTGG + Intergenic
901324334 1:8357919-8357941 CTTCCCTCCATCCCAGGCACAGG + Intronic
901443404 1:9292958-9292980 CCTCCCCGCGGCCCCGGCCCCGG - Exonic
901513423 1:9729841-9729863 CCCCGCCCCAGCCCCTGCTCAGG - Exonic
901556195 1:10033085-10033107 CCTCCCCCCTACCCGGGCTCCGG + Intronic
901637037 1:10675370-10675392 CTTCCCGCCAGCCTTGCCTCGGG - Intronic
901654819 1:10763160-10763182 CTTTCCCACAGCCCAGGCCCCGG + Intronic
901672840 1:10866340-10866362 CCCCCCACCAGCCCCGGCCCTGG + Intergenic
902273470 1:15323275-15323297 CCCGCCCCCAGCCCCAGCTCTGG - Intronic
902287495 1:15416127-15416149 CTTCCCCACACCCCCGGCCCAGG + Intronic
902671506 1:17977664-17977686 CTTCTCTCCTGCCCCTGCTCAGG - Intergenic
902675421 1:18005309-18005331 CTTCCCTCCACCCCAGTCTCAGG - Intergenic
902839457 1:19066031-19066053 TTTCCACCCAGCCCTGGCTTCGG + Intergenic
902962003 1:19970453-19970475 CTTCCGCCCTGCCCCATCTCAGG + Intergenic
903019991 1:20387036-20387058 CTCCCCCTCAGCCCTGCCTCGGG - Intergenic
903129044 1:21266399-21266421 CTTCCCCCCAGCACAGGATGGGG - Intronic
903349585 1:22710169-22710191 CCTCCCCCCAGCCCCACCCCAGG + Intergenic
903373644 1:22852572-22852594 ATTGCCCCCAGCCCCAGGTCTGG - Intronic
903448445 1:23437099-23437121 CCTCCCTCCTGCCCCGGCCCCGG + Intronic
903750279 1:25617048-25617070 CAGCCGCCCAGCCGCGGCTCCGG + Intergenic
904037920 1:27568690-27568712 CTTTCCCCCGGCCGCGGCGCGGG + Intronic
904066393 1:27755195-27755217 CTTCTCCCCAGACCTGGCTCTGG + Exonic
904613712 1:31738760-31738782 CTTCCCACCAGCCAGGCCTCTGG + Intronic
904615216 1:31745906-31745928 CTGCCACCCAGCCCAGCCTCTGG + Intronic
905798906 1:40831024-40831046 CTCACCCCCACCCCCAGCTCTGG + Intronic
905912254 1:41662708-41662730 CTCCGCGCCCGCCCCGGCTCCGG + Intronic
906117862 1:43367719-43367741 CTCCCCCACACCCCCGTCTCTGG - Exonic
906430293 1:45750609-45750631 CTTCCCTCCGGCGCCCGCTCAGG + Exonic
906798593 1:48716816-48716838 CTTGACCCCAGCCCAAGCTCAGG - Intronic
906944797 1:50286491-50286513 CTGACTCCCAGACCCGGCTCTGG - Intergenic
906960984 1:50419371-50419393 CCTCCGCCCAGCCCTGGCGCCGG + Exonic
907258328 1:53197010-53197032 CGGCCCCTCAGCGCCGGCTCCGG + Exonic
907287160 1:53389351-53389373 CTTCCCCCCACCCCCAGCCTGGG - Intergenic
907909483 1:58814318-58814340 CTTCCTTCCTGCCCCGGGTCAGG + Intergenic
912450556 1:109765226-109765248 TTTCACCCCAGCCCTGGCTTGGG + Intronic
912804401 1:112744010-112744032 CTTCCTCCCAGCCCCAGGGCTGG - Intergenic
914242019 1:145858770-145858792 CTGCCCCGCAGCCCCGCCCCCGG + Intronic
915534327 1:156525956-156525978 CATCCCCCCAGTCCCTGCCCAGG + Exonic
915914760 1:159934321-159934343 CTTTCCCCCAGACCCAGCCCAGG - Exonic
916533982 1:165685829-165685851 CTTGCCTCCAGCCCTGGCCCAGG - Intronic
916726049 1:167525320-167525342 CTTCCTCTCAGCTCCAGCTCTGG - Intergenic
917096647 1:171404901-171404923 CACCCCCCCACCCCCGGGTCCGG - Intergenic
917869557 1:179229488-179229510 CTCCCTCCCAGCCCAGGCCCTGG + Exonic
917978608 1:180255780-180255802 CTTCACCCCAGGCCCCACTCGGG - Intronic
919767984 1:201139580-201139602 TTACCCCCCAGCCCAGCCTCTGG + Intronic
919800778 1:201353504-201353526 CTTCCCCCAACCCCCGCCCCAGG + Intergenic
919870303 1:201815565-201815587 CTACCCCCCTGCCCAGCCTCTGG - Intronic
920263542 1:204705981-204706003 TGTCCTCCCAGCCCCAGCTCTGG + Intergenic
920367714 1:205456889-205456911 CAGCCCCCCAGCCCCGGGGCCGG + Intergenic
920985357 1:210883953-210883975 CTTCCTCCCAGCCCATGCTCTGG + Intronic
922602998 1:226870963-226870985 CTGCCGCCGAGCCCCGGCTGGGG + Intronic
922753770 1:228082945-228082967 CGTCCGCCCAGCCCCGACTCCGG - Intronic
923280346 1:232437644-232437666 CTGACCCCCAGCCCAGGCTGAGG + Intronic
923592169 1:235328496-235328518 CCTCCCCCCCGCCCCCGCACCGG - Intronic
1062843507 10:688821-688843 CCTCCCCCCGGGCCGGGCTCCGG - Intronic
1063298102 10:4826434-4826456 CTTCTCCCCAGCCCCGGCCTGGG - Intronic
1063661560 10:8037706-8037728 CTTCCCCGCGGCCCCGGCCCCGG - Intergenic
1063956643 10:11273459-11273481 CTTCCCCTCAACCCCTGGTCTGG + Intronic
1064397078 10:14990711-14990733 CTGCCCCCCTCCCCCGGCCCCGG - Intergenic
1065326150 10:24552369-24552391 CTTCCCTGCAGTCCCAGCTCAGG - Intergenic
1065925509 10:30431797-30431819 CTCCTCCCCAACCCCGGCCCAGG + Intergenic
1065970055 10:30798920-30798942 CTCACCTCCAGCCCCGTCTCAGG - Intergenic
1065983840 10:30930205-30930227 CTTCCCGCCAGGCAGGGCTCGGG - Intronic
1067143812 10:43679003-43679025 CTACCTCCCAGCACCGTCTCAGG + Intergenic
1070148050 10:73788966-73788988 CTCCCCCCCACCCCCCGCCCTGG + Intronic
1070679648 10:78439556-78439578 CTTCCCACCAGGCCTGGGTCAGG - Intergenic
1070812387 10:79305023-79305045 ATTCCACCCAGCCCCAGCCCGGG + Intronic
1072449703 10:95530214-95530236 CTTCATCCCAGCTCCAGCTCAGG + Intronic
1072757471 10:98030553-98030575 CTTGCTCCCAGCCCCGGTCCCGG + Exonic
1074137016 10:110636861-110636883 CTTCCTCTCAGCCCAGACTCTGG - Intergenic
1074778927 10:116786331-116786353 CTTGCCCCTAGCCTGGGCTCAGG + Intergenic
1075999793 10:126905591-126905613 CTCGCCCCAAGCCCAGGCTCCGG + Intronic
1076022589 10:127086230-127086252 CATCCCCCCACCCCCGGTGCAGG + Intronic
1076603863 10:131676999-131677021 CCTCCCCCCGGCCCCGCCCCAGG + Intergenic
1076718966 10:132384570-132384592 CTTCTCCCCTGCCTCGGCTGAGG + Intergenic
1076797483 10:132805243-132805265 GTTCCCGGCAGCCCGGGCTCTGG - Intergenic
1076850108 10:133088453-133088475 CTGCGCCCCACTCCCGGCTCCGG - Intronic
1076857584 10:133124825-133124847 CCTTCCCCCGGCCCCGGCCCCGG + Intronic
1076880032 10:133235632-133235654 CCTCCGTCCACCCCCGGCTCTGG - Intergenic
1077058244 11:606300-606322 CTCCCCCACAGCCCTGGCTCCGG - Intronic
1077080975 11:724648-724670 CTGCCCCCCAGCCACTGCCCAGG + Intronic
1077103317 11:831665-831687 CGGCCCCCCAGACGCGGCTCTGG + Exonic
1077183585 11:1226949-1226971 CCCCCCCCCAGCCCTGGCCCAGG - Intronic
1077341044 11:2026455-2026477 CTTGTCCCCAGCCCCTGCTCAGG - Intergenic
1077360418 11:2138183-2138205 CGCCGCCCCAGCCCCGGCCCCGG + Intronic
1077419585 11:2444311-2444333 CCTCCCCCCAACCCCAACTCCGG + Intergenic
1077503384 11:2919285-2919307 CTGTTCCCCTGCCCCGGCTCAGG + Exonic
1077888409 11:6402546-6402568 CCACCCCCTACCCCCGGCTCAGG + Intronic
1078551964 11:12287377-12287399 CTCCACCCCACCCCTGGCTCAGG + Intronic
1079898874 11:26155857-26155879 CTTCCACCCAGTCGAGGCTCTGG - Intergenic
1080404368 11:31965784-31965806 TTTGCCCACAGCCCCAGCTCTGG - Intronic
1081099699 11:38986597-38986619 CTACCCTCCAGCCCAGGCTGTGG - Intergenic
1081611811 11:44567437-44567459 CTTACCCCCACCCCCTGCCCTGG - Intronic
1082087016 11:48058615-48058637 CCTCTCCCCAGCCACCGCTCTGG + Intronic
1083610193 11:64000685-64000707 CTTCCCCGTCACCCCGGCTCGGG - Intronic
1083658370 11:64241144-64241166 GCTCCCCCCAGCCCGGGCTGTGG - Intronic
1083668140 11:64286211-64286233 CATCCCCCCATCCTTGGCTCTGG + Intronic
1083876077 11:65525078-65525100 TCTCCGCCCCGCCCCGGCTCGGG + Exonic
1083958887 11:66002935-66002957 CTTCCGCGCAGCCCTGGCTACGG + Intronic
1084000259 11:66292107-66292129 CGCCGCCCCAGGCCCGGCTCCGG - Intronic
1084010428 11:66345332-66345354 GATCCCCCCACCCCCAGCTCAGG + Intergenic
1084260981 11:67978385-67978407 CTCCCCCCCTCCCCCGGCCCCGG - Intergenic
1084428919 11:69100769-69100791 GGTACCCCCAGCCCAGGCTCGGG - Intergenic
1084689768 11:70718343-70718365 CTTCCCTCCAGCGTAGGCTCAGG - Intronic
1084937735 11:72596009-72596031 CTTCCGCCCAGCCTCAGCCCTGG + Intronic
1085261257 11:75205921-75205943 CTTCCCCCCACCCCCAGCACAGG - Exonic
1085269116 11:75259753-75259775 CCTCACCCCAGCCCCAGCCCTGG - Intergenic
1085276379 11:75302813-75302835 CCTGCCCCCACCCCCTGCTCAGG + Intronic
1085280233 11:75325260-75325282 CCTCACCCCAGCCCCTACTCTGG + Intronic
1085784405 11:79438147-79438169 CTTCCCCCCAGCCCGCAGTCAGG - Intronic
1085784604 11:79439121-79439143 CTTCCCCCCACCCCCCACCCCGG + Intronic
1085800064 11:79581000-79581022 ATTCCCCCCAGCCACATCTCAGG - Intergenic
1086189026 11:84056222-84056244 CTTCCCCACAACCCCGGAACAGG + Intronic
1087212541 11:95458469-95458491 CTTCCCCCCCCCCCCGCCACTGG - Intergenic
1087983704 11:104650642-104650664 CTTCCCTCAAACCCCAGCTCAGG + Intergenic
1088590161 11:111396047-111396069 CTTCTCCTCAGCCCCTGCCCAGG + Intronic
1089174793 11:116540681-116540703 CTACCTCTCAGCCCAGGCTCGGG + Intergenic
1089688236 11:120170216-120170238 CCCTCCCCCAGCCCCGCCTCTGG - Exonic
1089737600 11:120560931-120560953 CTTCCCCCCTTCCACGCCTCTGG + Intronic
1090387324 11:126364660-126364682 CTTCCCCCAGGCCCCAGCCCTGG + Intronic
1090389888 11:126381858-126381880 CTTCCCCCAGGCCCCAGCCCTGG + Intronic
1090464749 11:126924181-126924203 CTTCCCCCTTTCCCTGGCTCAGG + Intronic
1202824029 11_KI270721v1_random:81644-81666 CTTGTCCCCAGCCCCTGCTCAGG - Intergenic
1092046164 12:5432959-5432981 CCTCCCCCCAGCCCACGCCCGGG - Intronic
1092229020 12:6766673-6766695 CTCCCCGCCAGCCCCGGCCCCGG + Exonic
1092778400 12:11963875-11963897 CTGGCCCCCAACCCCTGCTCAGG - Intergenic
1094827794 12:34286290-34286312 CTTCCCAGCAGCCCCTGCCCTGG + Intergenic
1094829569 12:34293877-34293899 CTTCCCAACAGCCCCTGCGCGGG - Intergenic
1094831020 12:34300338-34300360 CTTCCCAGCAGCCCCTGCGCAGG + Intergenic
1094832360 12:34306202-34306224 CTTCCCAGCAGCCCCTGCGCGGG + Intergenic
1094832454 12:34306621-34306643 CTTCCCAGCAGCCCCTGCGCGGG + Intergenic
1094834289 12:34315007-34315029 CTTCCCAGCAGCCCATGCTCAGG - Intergenic
1094834897 12:34317720-34317742 CTTCCCAACAGCCCCTGCACGGG - Intergenic
1094835309 12:34319414-34319436 CTTCCCAGCAGCCCCTGCACGGG - Intergenic
1094836095 12:34322769-34322791 CTTCCCAGCAGCCCCTGCTTGGG - Intergenic
1094836610 12:34325065-34325087 CTTCCCAGCAGCCCCTGCACGGG - Intergenic
1094837767 12:34330173-34330195 CTTCCCACCAGCCCCTGCGTGGG - Intergenic
1094838010 12:34331236-34331258 CTTCCCCCCAGCCCCTGCACAGG - Intergenic
1095097320 12:38155605-38155627 CTTCCCTGCAGCCCCTGCGCCGG + Intergenic
1095097447 12:38156027-38156049 CTTCCCGGCAGCCCCTGCGCCGG + Intergenic
1095097633 12:38156812-38156834 CTTCCCGACAGCCCCTGCGCTGG + Intergenic
1095945952 12:47753515-47753537 CTTCCGCCCAGCCCTGGGCCAGG - Intronic
1096231857 12:49901166-49901188 CTTCCCCCCAGCCCCCACAGCGG - Exonic
1096589265 12:52646665-52646687 TTTGCCTCCAGCCCTGGCTCTGG + Intronic
1096863925 12:54549993-54550015 CTTCCCCCCATTCCCGGGCCGGG - Intronic
1096882820 12:54686435-54686457 CTTCCCCCCATCCCCAGCATGGG - Intergenic
1097183278 12:57183202-57183224 CTTCCTCCCGGCCCATGCTCTGG + Intronic
1101846850 12:108369670-108369692 CTTCCCACCAGCACTGGCACTGG - Intergenic
1101942678 12:109111451-109111473 CTGGCCCGCAGCCCAGGCTCAGG + Intergenic
1103212391 12:119176401-119176423 CCTCACCCCAGCCCCTGCCCAGG + Intergenic
1103347838 12:120263294-120263316 ATTCCTCCCACCCCAGGCTCCGG + Intronic
1103359627 12:120346148-120346170 CCTGCCCCCAGCACCGGCTTCGG - Exonic
1103506103 12:121443123-121443145 CCTCCCTCCAGCCCCTCCTCTGG - Intronic
1104355847 12:128086644-128086666 ATTCTCCCCAGCCCTGGCTTTGG - Intergenic
1104953786 12:132454145-132454167 CTGCCCCCCACCCCCAGCCCGGG + Intergenic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1106470063 13:30046389-30046411 CTTCCTCCCACCCCCGGAACTGG - Intergenic
1107470845 13:40689782-40689804 CCTGCCCACAGCCCCTGCTCTGG + Intergenic
1107549117 13:41458274-41458296 CCTGCCCGCAGCCCCGGCCCTGG + Exonic
1108594221 13:51936242-51936264 CTTGTCCCCAGAGCCGGCTCAGG - Intronic
1108751512 13:53452525-53452547 CTTCCCGCCAGGCAGGGCTCGGG - Intergenic
1113748903 13:112765149-112765171 CCTCCCCCCCGCCCCGGCTCTGG + Intronic
1113753346 13:112791509-112791531 CTTCCCGCCAGCCCCTGCCAGGG - Intronic
1113874403 13:113585162-113585184 CCTGGCCCCAGCCCCGGCCCCGG - Intronic
1113946673 13:114048432-114048454 CTTCCTCTGGGCCCCGGCTCTGG - Intronic
1114075014 14:19157254-19157276 CTTCCCATCAGCCCCTGCGCTGG + Intergenic
1114075065 14:19157451-19157473 CTTCCCATCAGCCCCTGCGCTGG + Intergenic
1114087204 14:19242526-19242548 CTTCCCATCAGCCCCTGCGCTGG - Intergenic
1114087254 14:19242722-19242744 CTTCCCATCAGCCCCTGCGCTGG - Intergenic
1114199810 14:20509551-20509573 CTTCCCTCCAGCCTCAGCTTAGG + Intronic
1114673738 14:24428251-24428273 CTGGCCCCCATCCCCGGCTCAGG - Intronic
1114682660 14:24499350-24499372 GTTCCTCCCAGCTCAGGCTCTGG + Intergenic
1115407039 14:33028976-33028998 CTTCCCCCCCGCCCCTGATGGGG + Intronic
1115644211 14:35356116-35356138 CCTGCCCCCAGCCCTGGTTCTGG - Intergenic
1116450891 14:45064074-45064096 CTGACCCCCACCCCCCGCTCTGG + Intronic
1119027794 14:71167723-71167745 CCTCCCCGCAGGCCGGGCTCGGG + Intergenic
1119174496 14:72559380-72559402 CTTCCCCAAAGCCCCGGGCCAGG + Intronic
1119194599 14:72708230-72708252 CCTCTCCCCAGCCCTGCCTCTGG + Intronic
1119481981 14:74963583-74963605 CTTCACCCCAGTGCCAGCTCCGG - Intergenic
1120204683 14:81574866-81574888 CTTCCCCCAAGCCTCCGCTGAGG - Intergenic
1121468084 14:94128726-94128748 CTTCCCCCCGCCCCCCGCTTAGG + Intronic
1121690964 14:95876863-95876885 CTCCCGCCGAGCCCCGGCGCGGG + Intergenic
1122077998 14:99247883-99247905 TTTCCCCCCATCCCCTGCCCTGG - Intronic
1122286276 14:100654720-100654742 CTGCCTCCCAGCCCCGACACAGG - Intergenic
1122824530 14:104363179-104363201 CTTCCCACCAGCCTCTGCTGTGG + Intergenic
1123030197 14:105447956-105447978 CCTCCACCCAGCCCCTGCTGGGG + Intronic
1202898421 14_GL000194v1_random:22824-22846 CTTCCCATCAGCCCCTGCGCTGG - Intergenic
1202898477 14_GL000194v1_random:23041-23063 CTTCCCATCAGCCCCTGCACTGG - Intergenic
1202854933 14_GL000225v1_random:44158-44180 CTTCCCCCCACCCCCTCCACCGG + Intergenic
1124291733 15:28457540-28457562 CTTCCCCCCGGCCCCCGGCCTGG + Intergenic
1124507753 15:30293260-30293282 TTTCCATCCAGCCCTGGCTCTGG - Intergenic
1124735803 15:32245398-32245420 TTTCCATCCAGCCCTGGCTCTGG + Intergenic
1125535028 15:40437666-40437688 CCTCCCTCCAGCCCCTGCCCAGG - Intergenic
1125674455 15:41494799-41494821 CTTACCCCCCGCCCCCTCTCCGG + Intronic
1125688027 15:41575191-41575213 GTTACCCACAGCCCAGGCTCAGG - Intronic
1125716506 15:41822691-41822713 CTACCCCCCAGCAGCAGCTCTGG + Intronic
1126994817 15:54428942-54428964 CTTCCCCCCAGCCCCCAATCGGG + Intronic
1127221740 15:56887405-56887427 CTTCCCGCCACCCCTGCCTCGGG - Intronic
1128128068 15:65207428-65207450 CTTCCCACCAGCCTGTGCTCTGG + Intronic
1128153239 15:65376612-65376634 CCTCCCCCCGTCCCCGGCCCAGG + Intronic
1129116990 15:73369847-73369869 CTTCCCCCCAACCCCCGCCAAGG + Intergenic
1129394787 15:75237838-75237860 CTGCCTCCCAGCCCAAGCTCCGG + Intergenic
1129670769 15:77606560-77606582 GCTTCCCCCAGCCCCAGCTCTGG + Intergenic
1129749576 15:78052069-78052091 CTCTCCCCCAGCTCTGGCTCTGG + Intronic
1129781865 15:78277626-78277648 ATGCTTCCCAGCCCCGGCTCAGG - Intronic
1129854220 15:78812154-78812176 CGTGGCCCCAGCCCTGGCTCTGG + Intronic
1130417310 15:83705767-83705789 CTTCACCCCAGTCCCAGCTCTGG - Intronic
1130540389 15:84817470-84817492 CCGCGCCCCAGCCCCGGCTGGGG - Exonic
1130814810 15:87420212-87420234 CTTCCCCTAAGCCCCGGCCCTGG + Intergenic
1131714344 15:95091859-95091881 CTTGCCCTCTGCCCCAGCTCGGG - Intergenic
1132087958 15:98923327-98923349 CTTCCTCACAGGCCGGGCTCGGG + Intronic
1132142833 15:99409226-99409248 CTCCAGCCCAGCCCTGGCTCTGG - Intergenic
1132356365 15:101174138-101174160 CTTCCTCCCAGCACCAGCTCAGG - Intergenic
1132527834 16:426226-426248 CCTCCCTCCAGCCCCGGGGCCGG - Exonic
1132570783 16:642987-643009 CTCCTCCCCAGCACCGCCTCAGG - Intronic
1132658572 16:1051619-1051641 CTTCCCCAGAGCTCCCGCTCTGG + Intergenic
1132678281 16:1129669-1129691 CAGCCCCCCACCCCAGGCTCCGG + Intergenic
1132712230 16:1274145-1274167 CCTGCCCCCAGCCTCAGCTCAGG + Intergenic
1132736590 16:1389045-1389067 CTTGCCCCCTCCCCCGGCCCCGG + Intronic
1132842295 16:1984078-1984100 TCTGCCCCCAGCCCCGGCTCGGG + Intronic
1133099432 16:3470269-3470291 CTTCCCACCAGGCCTGGCTTGGG + Intronic
1133575863 16:7088917-7088939 CTTCCCTCCAGTCCCTGCTCTGG + Intronic
1133784438 16:8963611-8963633 CGGCCCCGCAGCCCCGGCCCCGG - Intronic
1134267074 16:12701643-12701665 CTTCCCTCCACCCCCAGGTCCGG - Intronic
1134567866 16:15266661-15266683 CCTCCCCTCAGCCCCAGCCCCGG + Intergenic
1134734569 16:16489692-16489714 CCTCCCCTCAGCCCCAGCCCCGG - Intergenic
1134932897 16:18222214-18222236 CCTCCCCTCAGCCCCAGCCCCGG + Intergenic
1135992068 16:27224337-27224359 CCTCCCCCCACCCACTGCTCAGG - Intergenic
1136008703 16:27348363-27348385 CTTCCCCCCAGCCCATCCTTGGG - Intronic
1136035011 16:27532565-27532587 CTTCGCCACAGCCTCTGCTCTGG + Intronic
1136481777 16:30546499-30546521 CCTCCCCACAGCCCCAGCTTAGG - Intronic
1136858641 16:33681136-33681158 CCCCCCCCCACCCCCGGCCCCGG - Intergenic
1137602588 16:49766631-49766653 CTTCCCCACGGCTCAGGCTCAGG - Intronic
1137732310 16:50697873-50697895 GTTCCCCCCACCCCCAGCCCAGG + Intronic
1138245208 16:55462354-55462376 CCTCCCCCCAGGCCGGGCTGAGG - Intronic
1138657699 16:58500485-58500507 GCTCCCCCCAGCCCCTGCTATGG - Intronic
1139357965 16:66378684-66378706 CTTCCCCACAGGCCCTCCTCTGG + Intronic
1139387157 16:66579924-66579946 CTTCCCCCCACCCTCGGCCAAGG - Intronic
1139478887 16:67217335-67217357 CTTCCTCCTAGTCCTGGCTCTGG + Intronic
1139964323 16:70737172-70737194 CTTCCGCCCACCTCCGGCTCTGG + Intronic
1141618167 16:85221816-85221838 CTGGCCCCCAGCCCCGGCAAGGG - Intergenic
1141674473 16:85510373-85510395 CTTCCCCGCAGCCCAGGACCAGG + Intergenic
1142247759 16:88977563-88977585 CCTCTCCTCAGCCCCTGCTCCGG + Intergenic
1142282335 16:89155025-89155047 CTTTTCCCCAGACCCAGCTCCGG + Exonic
1142285833 16:89171237-89171259 CTTCCCCACAGCCTGGCCTCTGG + Intergenic
1203120211 16_KI270728v1_random:1529630-1529652 CCCCCCCCCACCCCCGGCCCTGG - Intergenic
1142614138 17:1125221-1125243 CATCCCCCCCGCCCTGGCTGCGG + Exonic
1142752556 17:1997785-1997807 GGACCTCCCAGCCCCGGCTCAGG - Intronic
1142813585 17:2408298-2408320 ATACCCCCCAGCCCCGCCCCAGG - Intronic
1143030311 17:3963985-3964007 CCAGCCCCCAGCCCCGGCGCCGG + Intronic
1143174796 17:4949692-4949714 CTTGCCCCTAGCCCAGGCTCCGG - Intronic
1143723175 17:8828015-8828037 ATCCCCCACATCCCCGGCTCAGG - Intronic
1144626143 17:16845316-16845338 CTTCCCCCCAACTCCTGCCCTGG - Intergenic
1144775728 17:17783697-17783719 CCTCGCCCCCGCCCCGGATCTGG + Intronic
1144816628 17:18039680-18039702 ACTCCCCCCAGCCCTGGCTCCGG + Exonic
1146163313 17:30571254-30571276 CTTCCCCCCAACTCCTGCCCTGG - Intergenic
1146183143 17:30709708-30709730 CTTCCCCCCAGCCCCGGCTCCGG + Intergenic
1146770901 17:35568020-35568042 CCTCCCACCAGCCCCGCCTCAGG + Intergenic
1146899698 17:36575214-36575236 CTCAGCCCCAGCCCCGGCCCCGG + Intronic
1147141944 17:38465089-38465111 CCTCCGCCCACCCCCAGCTCCGG - Intronic
1148142545 17:45338725-45338747 CTTCCTCCCAGCCCCTGGTCTGG - Intergenic
1148161545 17:45453176-45453198 CTCCTCCCCAGCCCCGGCTGGGG - Intronic
1148547194 17:48527516-48527538 CTTCCACCCAGCCACTCCTCGGG - Intergenic
1148547865 17:48530793-48530815 CTTTCCCCCAAGCTCGGCTCAGG - Exonic
1148846775 17:50534245-50534267 CTTCCCCCCAGCCCCTGCAGGGG + Intronic
1149624072 17:58067199-58067221 CATCCTCCTAGCCACGGCTCAGG - Intergenic
1150174614 17:63038098-63038120 TTTCCCCCCAGCCAACGCTCAGG - Intronic
1150266905 17:63837855-63837877 CCTCCTCCCAGCCCAGGTTCTGG - Intronic
1150392781 17:64799821-64799843 CTCCTCCCCAGCCCCGGCTGGGG - Intergenic
1151554091 17:74837869-74837891 CTTGCCCCCAGCCCTGGGCCTGG + Exonic
1151766304 17:76135157-76135179 CTTCCCCCCAGCACAGGCCTGGG + Intergenic
1151826578 17:76527288-76527310 CTGTCCCCCATCCCCGGTTCTGG - Intergenic
1151966001 17:77432032-77432054 CTGCCCCCCACCCCCAGCTGGGG - Intronic
1151977170 17:77489504-77489526 CCTCCTCCCAGCCCTGGCTCAGG - Intronic
1152020960 17:77780021-77780043 CTCTCCCCCAGCCCCGGGACAGG + Intergenic
1152129902 17:78469905-78469927 CATTCCCCCAGCCCCGCCCCTGG - Intronic
1152290781 17:79438802-79438824 CCTCCCCTCAGCTCCTGCTCGGG - Intronic
1152327720 17:79651219-79651241 TTTCCCCCAAGCCTTGGCTCAGG + Intergenic
1152419674 17:80185663-80185685 CTTTCCCCCAGCCCAGGGTCGGG + Intronic
1152447304 17:80353310-80353332 CTTCCTTCCAGCCTGGGCTCTGG - Intronic
1152550140 17:81025512-81025534 CTTCACACCAGCCTCGTCTCTGG + Intergenic
1152753698 17:82078180-82078202 CCCCGGCCCAGCCCCGGCTCTGG + Intergenic
1152757988 17:82095031-82095053 CGTCACTCCAGCCCCGGCCCCGG + Intronic
1152861499 17:82698897-82698919 CTCCGCCCCTGCCCCGTCTCCGG - Intergenic
1152908711 17:82984747-82984769 CTTCCCCGCCGTCCCAGCTCAGG - Intronic
1203162161 17_GL000205v2_random:62788-62810 CTTCCCTTCAACCCCTGCTCTGG - Intergenic
1203162438 17_GL000205v2_random:63874-63896 CTTCCCATCAGCCTCTGCTCTGG - Intergenic
1153872606 18:9334689-9334711 CTTCCCCTCCGCCCCCGCTGGGG - Intergenic
1156798241 18:41075192-41075214 CTTCCTCCCAGCCCCGGGCTTGG - Intergenic
1157544634 18:48539261-48539283 CCTTCCCCCACCCCCGACTCGGG + Exonic
1157557008 18:48619527-48619549 TTTCCCACCAGTCCCGGCCCAGG + Exonic
1157724343 18:49952336-49952358 ATTTCCCCCACCCCCGGCCCTGG + Intronic
1158107985 18:53906515-53906537 CATACCCACAGCCCTGGCTCGGG + Intergenic
1159798080 18:72867707-72867729 CCTCTCCCCGGCCCCGGCCCCGG - Exonic
1160015021 18:75133817-75133839 CTCCCGCACAGCCCCGGCCCTGG - Intergenic
1160724756 19:613179-613201 CTTCCCCCTCGCCCTGCCTCTGG - Intronic
1160840613 19:1145580-1145602 CTTCCTACCAGCCCCAGCCCTGG - Intronic
1161216196 19:3096020-3096042 CTTCCCCACCGCCCCGCCCCCGG - Intronic
1161349103 19:3782777-3782799 CCTCCCCACAGCCCAGCCTCAGG - Intronic
1161349982 19:3786114-3786136 TTTCCCCCCACCCCGGCCTCGGG + Intronic
1161388365 19:4008488-4008510 CTTCCCCCAAGCGCCCACTCCGG - Intronic
1161778456 19:6276660-6276682 CCTCCCCCCGGCCCCAGCCCAGG + Intronic
1161813015 19:6481606-6481628 GCTCCCCTCTGCCCCGGCTCAGG + Intronic
1162118124 19:8444660-8444682 CTTCCCCTCTGCTCCAGCTCTGG + Intronic
1162140868 19:8585079-8585101 CTGCCCCGCAGCCCCTGCCCTGG + Intronic
1162152214 19:8654786-8654808 CTCAACCCCAGCCCCGCCTCGGG + Intergenic
1162479339 19:10919699-10919721 CATCCTCCCAGGCCTGGCTCAGG + Intronic
1162481281 19:10928467-10928489 CTTCCCCCCCGCCCCCGAGCCGG + Intronic
1162940497 19:14006190-14006212 CCACCCCCCAGGCCCGGCCCGGG - Exonic
1162975651 19:14206066-14206088 CTTCCCCCCAGCCCCGGCTCCGG - Exonic
1162995689 19:14333678-14333700 CTTCCCGCCAGCCCAGCCCCTGG + Intergenic
1163271701 19:16258521-16258543 GTTCCCCACAGCCCCTGCCCAGG + Intergenic
1163347036 19:16749842-16749864 CTTGCCCCCTGCCCAGGTTCTGG + Exonic
1163556900 19:17998314-17998336 CTGCCTCCCAGGCCCGGCCCCGG + Exonic
1163617278 19:18336876-18336898 CTGCCCCCCAACCCCGGCCGAGG + Intergenic
1164146964 19:22518218-22518240 CTCCAGCCCGGCCCCGGCTCCGG + Intronic
1164399271 19:27891561-27891583 CTTCTTCCCAGCCCAGCCTCTGG - Intergenic
1164401351 19:27904429-27904451 TTTCACCCCAGGCCTGGCTCTGG - Intergenic
1164558284 19:29269929-29269951 CTTCCCCCCCCCCCCCGCTGTGG + Intergenic
1164643423 19:29842608-29842630 CTCCCCTCCACCCCCGGCCCAGG - Intergenic
1165058724 19:33194732-33194754 CTGCCCCGCGGCTCCGGCTCCGG - Exonic
1165164716 19:33843921-33843943 TTACCCCCCAGCCCTGGCCCTGG - Intergenic
1165312825 19:35039324-35039346 CCTCCTCCCTGCCCGGGCTCCGG - Intronic
1165386809 19:35514616-35514638 CCTCTCCCCAGTCCCAGCTCGGG + Intergenic
1165495572 19:36150556-36150578 CCTCCCTCCAGCCCAGACTCTGG - Intergenic
1165923667 19:39314280-39314302 CGTCCCCCCGGACCCGGGTCCGG + Exonic
1166072069 19:40393639-40393661 GTTCCCCTCAGGCCAGGCTCAGG + Intergenic
1166107753 19:40605733-40605755 CGTCCCCGCTGCCCGGGCTCCGG + Exonic
1166255589 19:41601958-41601980 CCTCAACCCAGCCCCGGCACAGG - Intronic
1166345296 19:42161830-42161852 CTTCCCCCCAGCCCCCGCCCTGG + Intronic
1166735090 19:45079316-45079338 CCTCTCCCCGGCCCCAGCTCTGG + Exonic
1167116736 19:47492915-47492937 CTTCCACCCTGCCCCCTCTCAGG - Intronic
1167209934 19:48127840-48127862 CTTCCACCCAGTCCTGGCTGTGG - Intronic
1167550014 19:50153995-50154017 CTCCCCCCCAGCCCCTTCTCCGG - Intronic
1167792076 19:51689242-51689264 CTTCCCCCCTGCCCCGGAGCTGG - Intergenic
1168280881 19:55304809-55304831 CCACCCCCCAGCCCCGGCGGTGG + Exonic
1168305499 19:55433131-55433153 CAGCCCCCCAGACCCGGCCCTGG + Exonic
1202647929 1_KI270706v1_random:158300-158322 CTTCCCATCAGCCCCTGCACTGG + Intergenic
924982964 2:239984-240006 CCTTCCCCCAGCCCCTGGTCAGG + Intronic
925111105 2:1338528-1338550 CTTCTCCCAATCCCCAGCTCCGG + Intronic
925369489 2:3334168-3334190 CCTCCCACCAGCCCAGGCACCGG + Intronic
925590852 2:5507827-5507849 CTCCCCCCCACCCCCAGCCCCGG - Intergenic
926077140 2:9951073-9951095 CTTCCCCCGAGAGCCGTCTCCGG - Intergenic
926198009 2:10775221-10775243 CCTCCCCCCAGACCCTGCTCAGG - Intronic
928237971 2:29561816-29561838 CTACCCCCCATGCCCGGCCCCGG - Intronic
929533948 2:42768871-42768893 CCACCCCCAAGCCCCGCCTCTGG + Intronic
929831020 2:45346304-45346326 CTTCTTCCCAGCCCCTGCACTGG + Intergenic
929962536 2:46507297-46507319 CTTCTCTCCAGGCCTGGCTCTGG - Intronic
931495726 2:62804956-62804978 CTTCACCCCAGCCCTGGTCCTGG + Intronic
932221906 2:70006186-70006208 TTACCCCCCAGCCCCAGCACAGG - Intergenic
932451488 2:71813432-71813454 CTTGCCTCCAGCCCCTGCTTTGG - Intergenic
932773924 2:74515906-74515928 CTTCTCACCAGGCCCTGCTCGGG - Intronic
934565910 2:95340987-95341009 CTTCCACACAGCCTCTGCTCTGG - Intronic
935589690 2:104835191-104835213 CCTCTCCCCAACCCCGTCTCCGG - Intergenic
937124366 2:119464015-119464037 CTTCCCCCAAGCCCCTGCTGAGG - Intronic
937657545 2:124393736-124393758 GTTCTGCCCAGCCCAGGCTCAGG + Intronic
938489277 2:131753581-131753603 CTTCCCATCAGCCCCTGCGCTGG + Intronic
938489335 2:131753797-131753819 CTTCCCATCAGCCCCTGCGCTGG + Intronic
938489602 2:131754797-131754819 CTTCCCATCAGCCCCTGCACTGG + Intronic
938489659 2:131755016-131755038 CTTCCCATCAGCCCCTGCACTGG + Intronic
938489712 2:131755235-131755257 CTTCCCATCAGCCCCTGCACTGG + Intronic
938489771 2:131755434-131755456 CTTCCCATCAGCCCCTGCACTGG + Intronic
938900729 2:135796764-135796786 CCTCCCCCTGGCCCTGGCTCGGG + Intronic
942173896 2:173312809-173312831 GTTCCCCCCAGCCCCACCCCAGG + Intergenic
945821212 2:214668182-214668204 CTTCCCCCCAACCCCCGAACAGG + Intergenic
946396867 2:219447789-219447811 CCTCTCCCCAGCACCTGCTCTGG + Intronic
946415484 2:219537941-219537963 CCTCCACTCGGCCCCGGCTCGGG - Exonic
946428894 2:219614221-219614243 TCACCCCCCAGCACCGGCTCTGG + Exonic
947870732 2:233436454-233436476 CTCCCCTCCAGCCCGGGCGCAGG - Intronic
947991998 2:234495763-234495785 CTGCCCCCCACCCCCAGCTCAGG - Exonic
948047041 2:234952470-234952492 CCGCCCCCCAACCCCGGCTCTGG + Intronic
948252859 2:236544494-236544516 CAGCCCCCCAGCCCTGGCACTGG - Intergenic
948524777 2:238564707-238564729 CTTGCCAGCAGCCCCTGCTCCGG - Intergenic
948616685 2:239203725-239203747 CTCACCCCCAGCCCTGGCTGGGG + Intronic
948862113 2:240757658-240757680 AAGCCCCCCAGCCCCGGCCCCGG - Intronic
948954364 2:241275175-241275197 ATTCCCCCCCACCCCGCCTCAGG + Intronic
1168769731 20:407889-407911 CCGCCCTCCAGCCCCGGCTCCGG + Intronic
1170436541 20:16336681-16336703 ATTCCCTCCAGTCCCAGCTCTGG + Intronic
1170771951 20:19340586-19340608 CTTCCTCCCTGCCCAGGCTGTGG - Intronic
1171489264 20:25504977-25504999 CTTCCCACACGCCCCGGATCTGG + Exonic
1172699297 20:36843113-36843135 CTTCCTCCCAGCCCCAGCGAGGG - Intronic
1172841089 20:37903164-37903186 CTCCGGCCCAGCCCCGGCTTCGG - Exonic
1172881487 20:38202707-38202729 CTTCCCTCCACCCCCAGGTCAGG - Intergenic
1173497218 20:43528484-43528506 CCTCCCCTCAGCCCCGTGTCTGG + Intronic
1173851751 20:46222855-46222877 CTTCCTCCCAGGCCCCGTTCCGG + Intronic
1173858774 20:46268539-46268561 CCTCCCACCACCCCGGGCTCGGG + Intronic
1174272791 20:49381705-49381727 AGTCCTCCCAGCCCCAGCTCAGG + Intronic
1174447769 20:50602114-50602136 ACTCCACCCAGCCCCAGCTCCGG - Exonic
1174522005 20:51138917-51138939 CGTCCCCAGAGCCCAGGCTCAGG - Intergenic
1175466586 20:59193981-59194003 CTTTCTCCCAGCCCAGCCTCAGG + Exonic
1175521603 20:59605459-59605481 CCTCCGCCCAGCGCCGGTTCTGG + Intronic
1175575225 20:60055933-60055955 CCTCCACCCGGCCCAGGCTCAGG - Exonic
1175834957 20:61987605-61987627 CTTCCCAGCAGCCACGGCTGAGG - Intronic
1175931464 20:62495799-62495821 GCTCCTCCCAGCCCCGGCCCGGG + Intergenic
1175937626 20:62521609-62521631 CTTCCCAGCAGCCACGGCTGAGG + Intergenic
1175957888 20:62620964-62620986 CTTCCCCCCACCCCCAGGCCTGG - Intergenic
1176005577 20:62860952-62860974 CTCCGCCCCGGCCCCGGCCCCGG + Intronic
1176041668 20:63068930-63068952 CCACCCACCACCCCCGGCTCTGG + Intergenic
1176131651 20:63498977-63498999 CTGCCCCCCAGGACCGGCCCCGG + Intronic
1176163134 20:63658660-63658682 CTTCCCTCCAGCCCCGGTCAAGG - Intronic
1176240373 20:64073106-64073128 CTTCTCCCCAGCCCTGAGTCTGG + Intergenic
1176242689 20:64082442-64082464 TTTCTCCCCAGCCCCGGCCAGGG - Intronic
1176554027 21:8245314-8245336 CTTCCCCCCACCCCCTCCCCAGG + Intergenic
1176572949 21:8428338-8428360 CTTCCCCCCACCCCCTCCCCAGG + Intergenic
1176603920 21:8814429-8814451 CTTCCCATCAGCCCCTGCACTGG - Intergenic
1176618105 21:9038815-9038837 CTTCCCATCAGCCCCTGCGCTGG - Intergenic
1176618160 21:9039031-9039053 CTTCCCATCAGCCCCTGCACCGG - Intergenic
1176706201 21:10121315-10121337 CTTCCCATCAGCTCCTGCTCTGG + Intergenic
1176706529 21:10122844-10122866 CTTCCCATCAGCCCCTGCGCTGG + Intergenic
1176706577 21:10123039-10123061 CTTCCCATCAGCCCCTGCCCTGG + Intergenic
1176706627 21:10123235-10123257 CTTCCCATCAGCCCCTGCGCTGG + Intergenic
1177749426 21:25262003-25262025 ATTCCCCCCAGCCCCATCCCAGG - Intergenic
1177781900 21:25630840-25630862 CTTTCCCCCAGCTCCCGCTAAGG + Intergenic
1178937313 21:36874822-36874844 CGGCCACCCAGCCACGGCTCTGG + Intronic
1179783856 21:43719020-43719042 CTTCCTCCCAGCCCGGGGGCGGG + Intergenic
1179792970 21:43766100-43766122 CTCCCCCCCGGCCCCCGCCCAGG - Intergenic
1180041665 21:45283301-45283323 CGTCCCCCCCCCCCCGCCTCAGG - Intronic
1180290664 22:10850169-10850191 CTTCCCATCAGCCCCTGCGCTGG + Intergenic
1180290713 22:10850365-10850387 CTTCCCATCAGCCCCTGCGCTGG + Intergenic
1180346204 22:11706006-11706028 CTTCCCATCAGCCCCTGCACTGG - Intergenic
1180493465 22:15879590-15879612 CTTCCCATCAGCCCCTGCGCTGG + Intergenic
1180493514 22:15879787-15879809 CTTCCCATCAGCCCCTGCGCTGG + Intergenic
1180871377 22:19149090-19149112 ATTCCCCCCATCCCCAGGTCTGG - Exonic
1181160514 22:20957286-20957308 CTGGCCCTCAGCCCCGCCTCAGG - Intergenic
1181462779 22:23095195-23095217 CCTCCCCGCAGCCCCACCTCAGG - Intronic
1182049985 22:27305280-27305302 CTTCCCCCCAGCCCTGACTCCGG + Intergenic
1182905283 22:33930780-33930802 CTTCCTCCCACCCCCCACTCCGG + Intergenic
1183305036 22:37078222-37078244 CTCCCCTCCAACCCCGGCTTGGG - Intronic
1183976277 22:41514255-41514277 CTTCCCCACATCCCCGGGTGGGG + Intronic
1184017316 22:41795801-41795823 CTTCCCCCTAGCACCTCCTCAGG + Exonic
1184038183 22:41928410-41928432 GTTCCCTCCAGCCCTGGCCCTGG - Intergenic
1184089300 22:42283904-42283926 CTCCTCCCCCGCCTCGGCTCAGG - Intronic
1184095637 22:42314859-42314881 CCTCCCTCCAGCCCCGACCCAGG + Intronic
1184108421 22:42381801-42381823 CTTGCTCCCACCCCCAGCTCTGG + Exonic
1184117738 22:42431909-42431931 CCTCCCCCCTGCCCCGCCCCTGG + Intronic
1184580406 22:45413177-45413199 CTTCCACTCGGCCCCGCCTCGGG - Intronic
1203259032 22_KI270733v1_random:162352-162374 CTTCCCCCCACCCCCTCCCCAGG + Intergenic
949363049 3:3252110-3252132 CTTCCCACCAGCCCACGCACTGG - Intergenic
950429719 3:12943854-12943876 CTGCAGCCCAGCCCTGGCTCAGG - Intronic
954710213 3:52501785-52501807 CTCCCACCCAGCCCCAGCTCTGG + Intronic
954876301 3:53805197-53805219 CTCTCCCCCAACCCCCGCTCTGG + Intronic
958423048 3:93950115-93950137 CTTCCCCCCAGCCTTGCTTCTGG - Intronic
960925925 3:122795025-122795047 CCTCCCCGCCGGCCCGGCTCGGG + Exonic
960969084 3:123126332-123126354 CTTCCCCCCATCCCCCGCTGTGG + Intronic
961506468 3:127373938-127373960 CCACCCCCCAGCCTGGGCTCAGG + Intergenic
961573363 3:127816310-127816332 CTTTCCCCCACCCCCTGCTTTGG - Intronic
961775238 3:129279330-129279352 CTTCCCCCCAGTCCCCGCTGGGG - Intronic
963598414 3:147356800-147356822 CTCCCCACCTGCCCCGGCGCTGG + Intergenic
963697880 3:148584705-148584727 CTGCACCCCAGCCCCTGCTATGG - Intergenic
964801916 3:160566078-160566100 CTGGCCCCCAGACCCGGCCCTGG - Intergenic
968135381 3:196216601-196216623 CTTGCCCCCCACCCCGGCCCAGG + Exonic
968235966 3:197030085-197030107 CTGCCCTCCAGCCCCGACTCTGG - Intergenic
968744614 4:2353202-2353224 CTGCACCCCAGCCCTGGCTCTGG - Intronic
968968894 4:3783393-3783415 CTCCCTCCCAGCCCTGGCACAGG - Intergenic
969053400 4:4387542-4387564 CTTCCCCCCCGCCCCGCCCCGGG + Intronic
969138789 4:5051619-5051641 CTTCCGCCGTGCCCCGCCTCGGG - Exonic
969365803 4:6693704-6693726 CTTTCCCCCAGCCAAGGCCCAGG - Exonic
969497194 4:7533013-7533035 CTTCTTCCCAGCCCCAGCCCTGG + Intronic
969499895 4:7546314-7546336 CTTCTCCCCTTCCCCGGCACCGG + Intronic
969614112 4:8242383-8242405 CTTCCCTCCAGCCCCGCGGCGGG - Intergenic
969651378 4:8470107-8470129 CTTCCCTGTTGCCCCGGCTCTGG - Intronic
969708991 4:8831949-8831971 CCGGCCCCCAGCCCCCGCTCCGG - Intergenic
969861278 4:10037486-10037508 CTTCACCCCAGTCTCAGCTCTGG - Intronic
970141640 4:12989328-12989350 CTGCCCCCCATCCCCGCCGCCGG - Intergenic
973374197 4:49276486-49276508 CTTCCCATCAGCCCCTGCGCTGG + Intergenic
973383215 4:49333753-49333775 CTTCCCATCAGCCCCTGCGCTGG - Intergenic
973840201 4:54853237-54853259 GTTCCCTACAGCCCCTGCTCCGG - Intergenic
973961762 4:56117509-56117531 CCTCCCCCCACCCCCTCCTCTGG - Intergenic
975801060 4:78059098-78059120 CCGCCGCCCAGCCGCGGCTCTGG - Intronic
977693776 4:99946254-99946276 CCTGGCCCCAGCCCCGGCTCCGG - Intronic
977790430 4:101094010-101094032 CTTCTCCCCAGCTACAGCTCAGG + Intronic
979920499 4:126490289-126490311 CTACCCGCCTGCCCCTGCTCCGG + Intergenic
982175834 4:152704700-152704722 CTTCCACCTTGCCCCAGCTCTGG + Intronic
982194518 4:152897269-152897291 CTTCTCCCCAGCACCCACTCAGG - Intronic
982897123 4:160945498-160945520 CTTCCCCCCAGCTCCTGCCTTGG - Intergenic
984024181 4:174522852-174522874 CTCCCTCCCGGCCCCGACTCCGG + Exonic
984632856 4:182078726-182078748 CTGCTCCCCACCCCCAGCTCAGG - Intergenic
985228528 4:187789382-187789404 CAGCCACCCAGCCACGGCTCTGG + Intergenic
985546809 5:514065-514087 CAAGGCCCCAGCCCCGGCTCGGG + Intronic
985782138 5:1876861-1876883 TTTCCTCCCAGTCCCGCCTCCGG + Intergenic
988977455 5:36529097-36529119 CTTCCTCCCAGCTCTGCCTCAGG + Intergenic
989229866 5:39074039-39074061 CTGGCCCCCAGCCCCGGACCCGG + Intronic
991044813 5:62211455-62211477 CTGCCCTCCAGCCTTGGCTCTGG - Intergenic
992056718 5:72997663-72997685 CTTTCCCCCAACCCCAACTCAGG - Intronic
993721344 5:91324547-91324569 CTTCCCCTCACCCCTGGCACAGG + Intergenic
994043567 5:95284501-95284523 CCTCCTTCCAGGCCCGGCTCTGG - Exonic
994670371 5:102755494-102755516 CATCCCCCCACCCCCGACCCGGG - Intronic
995751073 5:115453800-115453822 CTTCCACCCTGCCCAGCCTCAGG + Intergenic
997253626 5:132410677-132410699 CTCCCGCCCAGCCCGGGCCCGGG + Intronic
997353003 5:133244227-133244249 TTTGCCCCCAGCCCCTGCTGTGG - Intronic
997658760 5:135574524-135574546 CTTCCCACCAGACCCAGCTGTGG - Intronic
998130360 5:139648655-139648677 CTCCCCCCCCTCCCCGCCTCGGG + Exonic
999110478 5:149116114-149116136 CTGCCCACCAGCCCCACCTCGGG + Intergenic
999685436 5:154098473-154098495 CTTTCCCCCAGCTCCAGCTATGG - Intronic
1001515260 5:172350888-172350910 CTTCCCAGCAGCCCCAGCTCTGG + Intronic
1001681252 5:173558541-173558563 CTTCCTCCCACCCCTGACTCAGG - Intergenic
1001963768 5:175896022-175896044 CTTCCCCCCTCCCCCAGCTCAGG + Intergenic
1002170357 5:177371109-177371131 CCTCCGCCCGGCCCCGGCCCCGG - Intronic
1002466428 5:179411093-179411115 CTTCCCCCCAGCCCTGCGCCTGG + Intergenic
1002787824 6:417818-417840 CTGCCCACCAGCACAGGCTCTGG + Intergenic
1002924506 6:1597240-1597262 CCTCCCCCCAGCTCCAGTTCTGG + Intergenic
1003158798 6:3618262-3618284 CTGCCCCCCACCCCCGGCACTGG - Intergenic
1003268720 6:4589027-4589049 CAGCCCCCCACCCCCAGCTCGGG + Intergenic
1003642528 6:7887804-7887826 TGTTCCCCCAGCCCCAGCTCTGG + Intronic
1006097008 6:31662374-31662396 CTCCCTCCCAGCCACAGCTCGGG + Exonic
1006103732 6:31703273-31703295 CTTCGCCATGGCCCCGGCTCGGG + Exonic
1006361646 6:33590329-33590351 CTTCCACCCGGCCCCAGCTCGGG - Intergenic
1006780619 6:36629965-36629987 CTTCCTCCCACCTCCGCCTCTGG - Intergenic
1006814139 6:36839469-36839491 TTGCCGCCCAGCCCAGGCTCTGG - Exonic
1006860798 6:37170498-37170520 CTTCGGCACAGCCCCGGCTCCGG + Exonic
1007048776 6:38804494-38804516 CTTCTCCCCAGCTGCTGCTCAGG + Intronic
1007257453 6:40538779-40538801 CTTCCCCCCAGCCCCAGTCCTGG - Intronic
1007725168 6:43911674-43911696 CATCCCCCCTCCCCCAGCTCCGG + Intergenic
1013099149 6:106973673-106973695 CTTCGCCCCCGCCCCCGCTAGGG + Exonic
1014205523 6:118651613-118651635 CGCGGCCCCAGCCCCGGCTCTGG - Intronic
1014490213 6:122053378-122053400 CTGCCCCGCAGCCCCACCTCTGG - Intergenic
1017725671 6:157274728-157274750 CATCCCCGCAGCCCCGGTCCCGG + Intergenic
1017760519 6:157564341-157564363 CTTCCCCCCAACCCCACTTCTGG - Intronic
1018924053 6:168194418-168194440 CTTCCCCCTCACCCAGGCTCAGG - Intergenic
1018930840 6:168239407-168239429 CTTCCCCTCAGCCCCTGCCCCGG - Intergenic
1019528987 7:1494357-1494379 CTCCCCTCCAGCCCCGCCTGGGG - Intronic
1019709223 7:2510760-2510782 CTCCCACCCAGCTCCAGCTCAGG + Intergenic
1020028602 7:4917296-4917318 CCTCCCCACAGCCCCGTGTCAGG - Intronic
1020125313 7:5530034-5530056 CTTCGCCCCAGCCCAGGCCGCGG + Intronic
1020139552 7:5605151-5605173 CCACCCTCCAGTCCCGGCTCCGG - Intronic
1020311362 7:6871109-6871131 CTCCCCCCCTCCCCCGGCCCCGG - Intergenic
1021958804 7:25852590-25852612 CCGCGCCCCCGCCCCGGCTCGGG + Intergenic
1023093762 7:36640130-36640152 TTTCCCTGCAGCCCCGGCCCTGG - Intronic
1023393558 7:39732578-39732600 CTCCACCCCAGCCTCTGCTCTGG - Intergenic
1023793575 7:43772479-43772501 CTTCCCCCCTGCCCCAGGGCTGG + Intronic
1023873768 7:44276163-44276185 CTTTCCCTCCTCCCCGGCTCAGG - Intronic
1024604340 7:51012169-51012191 CTTCTGCCCAGCCCCTCCTCTGG + Intergenic
1025635889 7:63318552-63318574 CTGCCCCCCAGGCCCGTCTATGG + Intergenic
1025646807 7:63429628-63429650 CTGCCCCCCAGGCCCGTCTATGG - Intergenic
1026840383 7:73667629-73667651 CTGCGCCCCAGCACCGGCCCTGG - Intergenic
1026962673 7:74418389-74418411 CTGTCCCCCACCCCCAGCTCAGG + Intergenic
1028373421 7:90119618-90119640 CTTCCCCCCCGCCTCCGCCCCGG + Intergenic
1028582570 7:92422910-92422932 CTGCCCTCCAGCCCCATCTCCGG - Intergenic
1029305564 7:99617134-99617156 CCTCCGCTCAGCCCCGGCTGAGG + Intronic
1030332093 7:108281761-108281783 CTTTGCCCCTTCCCCGGCTCAGG - Intronic
1031604088 7:123748488-123748510 CCTCCCGCCAGCCCCGGCCCCGG - Intronic
1032306121 7:130733804-130733826 CCCGCCCCCAGCCCCGGCGCGGG - Exonic
1032391301 7:131556740-131556762 CGCCCGCCCAGCCCCGGCCCCGG - Intronic
1032784401 7:135188884-135188906 CCTTGCCCCAGCCCAGGCTCTGG + Intronic
1032787322 7:135211299-135211321 CTTCCCCCCAGCACTGCCTCCGG - Intronic
1032877329 7:136051464-136051486 CTTCCACCCAGAACCCGCTCTGG - Intergenic
1034088239 7:148339609-148339631 CTTCCCGCCAGCCCCGGTTCAGG - Intronic
1034252293 7:149701953-149701975 CAGCCACCCAGCCACGGCTCTGG - Intergenic
1034440539 7:151083519-151083541 CTTCCCCGCCGCCGCGGCCCGGG + Intronic
1035021643 7:155804152-155804174 CTTCCCTCCCGCCCCGGCGCGGG + Intronic
1035340589 7:158158304-158158326 GTTCCCCGCAGCCCAGTCTCAGG - Intronic
1035439602 7:158885198-158885220 CTGACCCCCACCCCCAGCTCTGG - Intronic
1036664785 8:10731067-10731089 GCGGCCCCCAGCCCCGGCTCCGG - Intronic
1036692088 8:10950388-10950410 CTCTCCCCCAGCCCTGGCACAGG - Intronic
1036905855 8:12707938-12707960 CTACTCCCCTCCCCCGGCTCCGG - Intergenic
1038491644 8:27976111-27976133 CCACCCCTCAGCCCCGGCTGCGG - Intronic
1038537967 8:28368166-28368188 CCTCCCTCCAGTCCTGGCTCTGG - Intronic
1039546394 8:38414104-38414126 CTTGCCCCAAGGCCTGGCTCAGG + Intronic
1040111080 8:43567463-43567485 CTTCCCGGCAGCCCCCGCACCGG - Intergenic
1042188320 8:66159193-66159215 CTTCCCCGCATCCCTGCCTCTGG + Intronic
1043032580 8:75156070-75156092 CTTCCCACCTTCCCAGGCTCTGG + Intergenic
1044554012 8:93542447-93542469 CCTCCCCCCGGCCCCCGCTCTGG - Intergenic
1047499154 8:125429312-125429334 TTTCCCACCGGCCCTGGCTCAGG + Intergenic
1048276034 8:133066862-133066884 CAACCCCCCAGCCCCTGCACGGG - Intronic
1048993235 8:139773619-139773641 CTTCCCCACAGCCCCCACCCTGG + Intronic
1049423030 8:142525220-142525242 CCTCCCCACAGCCCTGGCTGTGG + Intronic
1049428973 8:142550525-142550547 CTGCCCCCCAGCCCCAGGTGGGG - Intergenic
1049538498 8:143194336-143194358 CTCTCCCCCAGCCCCTGCACTGG - Intergenic
1049538511 8:143194383-143194405 CTCTCCCCCAGCCCCTGCACTGG - Intergenic
1049538525 8:143194430-143194452 CTCTCCCCCAGCCCCTGCACTGG - Intergenic
1049538581 8:143194631-143194653 CTCTCCCCCAGCCCCTGCACTGG - Intergenic
1049790879 8:144472283-144472305 CTTCTCCCCACCCCTGGCCCAGG + Intronic
1049805531 8:144537127-144537149 CTTCCCCCAGGCCCTGGCTCAGG - Intronic
1052955694 9:34251690-34251712 CTTCCCCACCTCCCCAGCTCAGG - Exonic
1053398958 9:37800910-37800932 CGGCTCCTCAGCCCCGGCTCCGG - Exonic
1053643486 9:40108432-40108454 CTTCCCATCAGCTCCTGCTCTGG + Intergenic
1053643821 9:40109962-40109984 CTTCCCATCAGCCCCTGCGCTGG + Intergenic
1053643870 9:40110158-40110180 CTTCCCATCAGCCCCTGCCCTGG + Intergenic
1053643922 9:40110355-40110377 CTTCCCATCAGCCCCTGCGCTGG + Intergenic
1053762230 9:41355134-41355156 CTTCCCATCAGCCCCTGCGCTGG - Intergenic
1053762282 9:41355331-41355353 CTTCCCATCAGCCCCTGCCCTGG - Intergenic
1053762330 9:41355527-41355549 CTTCCCATCAGCCCCTGCGCTGG - Intergenic
1053762665 9:41357058-41357080 CTTCCCATCAGCTCCTGCTCTGG - Intergenic
1054324341 9:63705660-63705682 CTTCCCATCAGCTCCTGCTCTGG + Intergenic
1054324676 9:63707190-63707212 CTTCCCATCAGCCCCTGCGCTGG + Intergenic
1054324725 9:63707386-63707408 CTTCCCATCAGCCCCTGCCCTGG + Intergenic
1054324778 9:63707584-63707606 CTTCCCATCAGCCCCTGCGCTGG + Intergenic
1054350373 9:64014190-64014212 CTTCCCATCAGCCCCTGCACTGG - Intergenic
1054350734 9:64015586-64015608 CTTCCCATCAGCCCCTGCGCTGG - Intergenic
1054540827 9:66266254-66266276 CTTCCCATCAGCCCCTGCGCTGG - Intergenic
1054540876 9:66266450-66266472 CTTCCCATCAGCCCCTGCCCTGG - Intergenic
1054540925 9:66266646-66266668 CTTCCCATCAGCCCCTGCGCTGG - Intergenic
1054541266 9:66268172-66268194 CTTCCCATCAGCTCCTGCTCTGG - Intergenic
1055583676 9:77733603-77733625 CTTCCTCCCATCCCCAGCACAGG + Intronic
1056565874 9:87771765-87771787 CTTGCCCCCACCCTCTGCTCAGG - Intergenic
1057310641 9:93940859-93940881 CTTCCCACCTGCCACAGCTCAGG + Intergenic
1057869239 9:98706371-98706393 CTACCCCAAAGCCCTGGCTCTGG + Intronic
1058235676 9:102487113-102487135 CTTCCCCCCGGGCAGGGCTCTGG - Intergenic
1059251551 9:112891166-112891188 CTTCCTTCCAGCCCCTGCCCCGG - Intergenic
1059325940 9:113504042-113504064 CTTCCCACCAGCCCCGGGCCTGG - Intronic
1059437180 9:114283918-114283940 CTCCACCCCAACCACGGCTCTGG - Intronic
1059473429 9:114524718-114524740 CTCCCCCCCACCTCCAGCTCTGG - Intergenic
1059769860 9:117414895-117414917 CTCAGCCCCGGCCCCGGCTCGGG - Exonic
1060215690 9:121737076-121737098 CCTGCCCCAAGCCCCGCCTCTGG - Intronic
1060222567 9:121772475-121772497 CATCTCCCCAGCGCTGGCTCAGG + Intronic
1060227768 9:121805807-121805829 CTCCTCCCCTGCCCAGGCTCTGG - Intergenic
1060989140 9:127838366-127838388 CTTCCCCCAAGCCCAGGCAGGGG + Intronic
1061183563 9:129038724-129038746 CTTCCCCCCAGCCTCACCTCTGG - Intronic
1061236026 9:129343029-129343051 CCTCCTCCCAGCCCAGCCTCTGG - Intergenic
1061261609 9:129483371-129483393 CTTCCACCCACGCCCGGCCCTGG - Intergenic
1061487240 9:130926119-130926141 CTTCCCTCCTGCCCCGGTTGGGG - Intronic
1061646442 9:132006207-132006229 CTGCCCACCAGCCCAAGCTCAGG + Intronic
1061952120 9:133942484-133942506 CGTAGCCCCTGCCCCGGCTCAGG - Intronic
1061975707 9:134067348-134067370 CTTGCCCCCCGCCCCGGCCGCGG + Intronic
1062032167 9:134366586-134366608 CTTCCTCCCTGCCCCAGCCCTGG - Intronic
1062448908 9:136607380-136607402 CTCCCCTCCTGCCCCAGCTCTGG - Intergenic
1062524302 9:136972090-136972112 CTTCCCTGCAGCCCCTCCTCCGG - Intergenic
1202791236 9_KI270719v1_random:91403-91425 CTTCCCATCAGCTCCTGCTCTGG + Intergenic
1203697871 Un_GL000214v1:114398-114420 CTTCCCATCAGCCCCTGCACTGG + Intergenic
1203475223 Un_GL000220v1:144361-144383 CTTCCCCCCACCCCCTCCCCAGG + Intergenic
1203551334 Un_KI270743v1:166589-166611 CTTCCCATCAGCCCCTGCGCTGG - Intergenic
1186237637 X:7530782-7530804 CTTCTTCCCAGCCTCGGTTCAGG + Intergenic
1186466233 X:9786343-9786365 CTCCCCGCCAGCCCCGGCCCCGG + Intergenic
1187266217 X:17736863-17736885 CTTCCTACCAGACCTGGCTCAGG + Intergenic
1187399385 X:18946364-18946386 CTTTCCTCCAACCCCGGCACTGG + Intronic
1189553420 X:42116209-42116231 CATCCCCCCACCCCCACCTCTGG - Intergenic
1190243554 X:48676378-48676400 CTTTCCCGGAGCCCGGGCTCTGG + Intergenic
1191249630 X:58254213-58254235 CTTCCCAGCAGCCCTGGCGCTGG - Intergenic
1191251155 X:58260838-58260860 CTTCCCCACAGCCCCTGTGCTGG + Intergenic
1191251970 X:58264112-58264134 CTTCCCAGCAGCCCCTGCGCCGG + Intergenic
1191252402 X:58265826-58265848 CTTCCCAGCAGCCCCTGCGCAGG - Intergenic
1191253327 X:58269485-58269507 CTTCCCGGCAGCCCCTGCGCAGG - Intergenic
1192234166 X:69285571-69285593 CTTTCCCTCTGCCCTGGCTCGGG - Intergenic
1193701953 X:84773842-84773864 CCTCCCCCCTCCCCCGACTCTGG + Intergenic
1194913532 X:99676513-99676535 CTTCCCCCCAGCCCCACAACAGG - Intergenic
1195980297 X:110570170-110570192 CCTCCCCCCACCCCAGTCTCTGG + Intergenic
1196425097 X:115561693-115561715 CTTCCCTCCCGCCCGGACTCAGG + Intronic
1197254730 X:124250622-124250644 TTTCCCTCCAGCCCCGCCACTGG + Intronic
1199702362 X:150392065-150392087 CTTCCCACCAGCCCATGCTAGGG + Intronic
1200099807 X:153684879-153684901 CAACCCCCCAGCCCCAGCTGGGG + Intronic
1200142107 X:153907532-153907554 CTGCCCCTCAGCCCTGGCCCAGG - Exonic
1200211514 X:154348763-154348785 CTTCCCCTCAACCCCGGCCCAGG - Exonic
1201151489 Y:11097651-11097673 CTTCCCATCAGCCCCTGCGCTGG - Intergenic
1201151549 Y:11097868-11097890 CTTCCCATCAGCCCCTGCACTGG - Intergenic
1201152407 Y:11101334-11101356 CTTCCCATCAGCCCCTGCACTGG - Intergenic
1201152611 Y:11102196-11102218 CTTCCCATCAGCCCCTGCGCTGG - Intergenic