ID: 1162977632

View in Genome Browser
Species Human (GRCh38)
Location 19:14217651-14217673
Sequence GAGCTGAGCGTGTTTGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162977621_1162977632 30 Left 1162977621 19:14217598-14217620 CCAGGTGCTCAGGGAGTTGGGGT No data
Right 1162977632 19:14217651-14217673 GAGCTGAGCGTGTTTGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162977632 Original CRISPR GAGCTGAGCGTGTTTGAGAT GGG Intergenic
No off target data available for this crispr