ID: 1162977950

View in Genome Browser
Species Human (GRCh38)
Location 19:14219436-14219458
Sequence GGGCATAATCACCATCAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162977945_1162977950 4 Left 1162977945 19:14219409-14219431 CCAGTTGCGACAAATTTCTGTTG No data
Right 1162977950 19:14219436-14219458 GGGCATAATCACCATCAGATGGG No data
1162977942_1162977950 7 Left 1162977942 19:14219406-14219428 CCCCCAGTTGCGACAAATTTCTG No data
Right 1162977950 19:14219436-14219458 GGGCATAATCACCATCAGATGGG No data
1162977939_1162977950 27 Left 1162977939 19:14219386-14219408 CCATTACGTACCAGCAGCACCCC No data
Right 1162977950 19:14219436-14219458 GGGCATAATCACCATCAGATGGG No data
1162977944_1162977950 5 Left 1162977944 19:14219408-14219430 CCCAGTTGCGACAAATTTCTGTT No data
Right 1162977950 19:14219436-14219458 GGGCATAATCACCATCAGATGGG No data
1162977940_1162977950 17 Left 1162977940 19:14219396-14219418 CCAGCAGCACCCCCCAGTTGCGA No data
Right 1162977950 19:14219436-14219458 GGGCATAATCACCATCAGATGGG No data
1162977941_1162977950 8 Left 1162977941 19:14219405-14219427 CCCCCCAGTTGCGACAAATTTCT No data
Right 1162977950 19:14219436-14219458 GGGCATAATCACCATCAGATGGG No data
1162977943_1162977950 6 Left 1162977943 19:14219407-14219429 CCCCAGTTGCGACAAATTTCTGT No data
Right 1162977950 19:14219436-14219458 GGGCATAATCACCATCAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162977950 Original CRISPR GGGCATAATCACCATCAGAT GGG Intergenic
No off target data available for this crispr