ID: 1162978283

View in Genome Browser
Species Human (GRCh38)
Location 19:14221601-14221623
Sequence CCACCGCCAGGGTGTCAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162978283_1162978290 1 Left 1162978283 19:14221601-14221623 CCGGCCTGACACCCTGGCGGTGG No data
Right 1162978290 19:14221625-14221647 ATGATGAAGTGGTGCTTGCCGGG No data
1162978283_1162978289 0 Left 1162978283 19:14221601-14221623 CCGGCCTGACACCCTGGCGGTGG No data
Right 1162978289 19:14221624-14221646 CATGATGAAGTGGTGCTTGCCGG No data
1162978283_1162978293 8 Left 1162978283 19:14221601-14221623 CCGGCCTGACACCCTGGCGGTGG No data
Right 1162978293 19:14221632-14221654 AGTGGTGCTTGCCGGGTGGGCGG No data
1162978283_1162978291 4 Left 1162978283 19:14221601-14221623 CCGGCCTGACACCCTGGCGGTGG No data
Right 1162978291 19:14221628-14221650 ATGAAGTGGTGCTTGCCGGGTGG No data
1162978283_1162978288 -10 Left 1162978283 19:14221601-14221623 CCGGCCTGACACCCTGGCGGTGG No data
Right 1162978288 19:14221614-14221636 CTGGCGGTGGCATGATGAAGTGG No data
1162978283_1162978292 5 Left 1162978283 19:14221601-14221623 CCGGCCTGACACCCTGGCGGTGG No data
Right 1162978292 19:14221629-14221651 TGAAGTGGTGCTTGCCGGGTGGG No data
1162978283_1162978294 11 Left 1162978283 19:14221601-14221623 CCGGCCTGACACCCTGGCGGTGG No data
Right 1162978294 19:14221635-14221657 GGTGCTTGCCGGGTGGGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162978283 Original CRISPR CCACCGCCAGGGTGTCAGGC CGG (reversed) Intergenic