ID: 1162979652

View in Genome Browser
Species Human (GRCh38)
Location 19:14230397-14230419
Sequence CAGGGTGACCCTTCTGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162979652_1162979667 25 Left 1162979652 19:14230397-14230419 CCCCCTTCAGAAGGGTCACCCTG No data
Right 1162979667 19:14230445-14230467 AGAGGGAGTTGTGGGAGGGAAGG No data
1162979652_1162979661 7 Left 1162979652 19:14230397-14230419 CCCCCTTCAGAAGGGTCACCCTG No data
Right 1162979661 19:14230427-14230449 CTTTAAGGATAGGCAGACAGAGG No data
1162979652_1162979657 -8 Left 1162979652 19:14230397-14230419 CCCCCTTCAGAAGGGTCACCCTG No data
Right 1162979657 19:14230412-14230434 TCACCCTGGCTGCTACTTTAAGG No data
1162979652_1162979663 16 Left 1162979652 19:14230397-14230419 CCCCCTTCAGAAGGGTCACCCTG No data
Right 1162979663 19:14230436-14230458 TAGGCAGACAGAGGGAGTTGTGG No data
1162979652_1162979660 -3 Left 1162979652 19:14230397-14230419 CCCCCTTCAGAAGGGTCACCCTG No data
Right 1162979660 19:14230417-14230439 CTGGCTGCTACTTTAAGGATAGG No data
1162979652_1162979662 8 Left 1162979652 19:14230397-14230419 CCCCCTTCAGAAGGGTCACCCTG No data
Right 1162979662 19:14230428-14230450 TTTAAGGATAGGCAGACAGAGGG No data
1162979652_1162979666 21 Left 1162979652 19:14230397-14230419 CCCCCTTCAGAAGGGTCACCCTG No data
Right 1162979666 19:14230441-14230463 AGACAGAGGGAGTTGTGGGAGGG No data
1162979652_1162979665 20 Left 1162979652 19:14230397-14230419 CCCCCTTCAGAAGGGTCACCCTG No data
Right 1162979665 19:14230440-14230462 CAGACAGAGGGAGTTGTGGGAGG No data
1162979652_1162979664 17 Left 1162979652 19:14230397-14230419 CCCCCTTCAGAAGGGTCACCCTG No data
Right 1162979664 19:14230437-14230459 AGGCAGACAGAGGGAGTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162979652 Original CRISPR CAGGGTGACCCTTCTGAAGG GGG (reversed) Intergenic
No off target data available for this crispr