ID: 1162983388

View in Genome Browser
Species Human (GRCh38)
Location 19:14253868-14253890
Sequence GTGCCCTCCCCCATTTCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162983381_1162983388 10 Left 1162983381 19:14253835-14253857 CCCAGATTCAGGAGGGAGGTCCA No data
Right 1162983388 19:14253868-14253890 GTGCCCTCCCCCATTTCCCAAGG No data
1162983386_1162983388 -10 Left 1162983386 19:14253855-14253877 CCAAGGGGTACCAGTGCCCTCCC No data
Right 1162983388 19:14253868-14253890 GTGCCCTCCCCCATTTCCCAAGG No data
1162983382_1162983388 9 Left 1162983382 19:14253836-14253858 CCAGATTCAGGAGGGAGGTCCAA No data
Right 1162983388 19:14253868-14253890 GTGCCCTCCCCCATTTCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162983388 Original CRISPR GTGCCCTCCCCCATTTCCCA AGG Intergenic
No off target data available for this crispr