ID: 1162983490

View in Genome Browser
Species Human (GRCh38)
Location 19:14254261-14254283
Sequence CTGTGGATAAGGATGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162983471_1162983490 21 Left 1162983471 19:14254217-14254239 CCCAAACCCCCGGTTTGGAGAGG 0: 1
1: 0
2: 0
3: 10
4: 67
Right 1162983490 19:14254261-14254283 CTGTGGATAAGGATGGAGGGAGG No data
1162983479_1162983490 12 Left 1162983479 19:14254226-14254248 CCGGTTTGGAGAGGAGGGTCTGG No data
Right 1162983490 19:14254261-14254283 CTGTGGATAAGGATGGAGGGAGG No data
1162983473_1162983490 20 Left 1162983473 19:14254218-14254240 CCAAACCCCCGGTTTGGAGAGGA 0: 1
1: 1
2: 1
3: 5
4: 89
Right 1162983490 19:14254261-14254283 CTGTGGATAAGGATGGAGGGAGG No data
1162983476_1162983490 15 Left 1162983476 19:14254223-14254245 CCCCCGGTTTGGAGAGGAGGGTC No data
Right 1162983490 19:14254261-14254283 CTGTGGATAAGGATGGAGGGAGG No data
1162983478_1162983490 13 Left 1162983478 19:14254225-14254247 CCCGGTTTGGAGAGGAGGGTCTG No data
Right 1162983490 19:14254261-14254283 CTGTGGATAAGGATGGAGGGAGG No data
1162983477_1162983490 14 Left 1162983477 19:14254224-14254246 CCCCGGTTTGGAGAGGAGGGTCT No data
Right 1162983490 19:14254261-14254283 CTGTGGATAAGGATGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162983490 Original CRISPR CTGTGGATAAGGATGGAGGG AGG Intergenic
No off target data available for this crispr