ID: 1162984749

View in Genome Browser
Species Human (GRCh38)
Location 19:14262477-14262499
Sequence CTGTAATCCCAGATACTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162984749_1162984752 -4 Left 1162984749 19:14262477-14262499 CCCTCAAGTATCTGGGATTACAG No data
Right 1162984752 19:14262496-14262518 ACAGGCACAAGCCACCACCCCGG No data
1162984749_1162984753 3 Left 1162984749 19:14262477-14262499 CCCTCAAGTATCTGGGATTACAG No data
Right 1162984753 19:14262503-14262525 CAAGCCACCACCCCGGCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162984749 Original CRISPR CTGTAATCCCAGATACTTGA GGG (reversed) Intergenic
No off target data available for this crispr