ID: 1162990136

View in Genome Browser
Species Human (GRCh38)
Location 19:14296617-14296639
Sequence CATTGGGAGCAGTAGTAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162990136_1162990145 21 Left 1162990136 19:14296617-14296639 CCAATCTACTACTGCTCCCAATG No data
Right 1162990145 19:14296661-14296683 TAGGACGCTAAAGTTGACCCAGG No data
1162990136_1162990141 2 Left 1162990136 19:14296617-14296639 CCAATCTACTACTGCTCCCAATG No data
Right 1162990141 19:14296642-14296664 AGCCACATCATGTCCAGCCTAGG No data
1162990136_1162990146 22 Left 1162990136 19:14296617-14296639 CCAATCTACTACTGCTCCCAATG No data
Right 1162990146 19:14296662-14296684 AGGACGCTAAAGTTGACCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162990136 Original CRISPR CATTGGGAGCAGTAGTAGAT TGG (reversed) Intergenic
No off target data available for this crispr