ID: 1162990373

View in Genome Browser
Species Human (GRCh38)
Location 19:14298102-14298124
Sequence GCGGCTGCTGGGAGCCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162990369_1162990373 -4 Left 1162990369 19:14298083-14298105 CCAAGACTGGGGGAAGGATGCGG No data
Right 1162990373 19:14298102-14298124 GCGGCTGCTGGGAGCCAGAGAGG No data
1162990368_1162990373 1 Left 1162990368 19:14298078-14298100 CCGGGCCAAGACTGGGGGAAGGA No data
Right 1162990373 19:14298102-14298124 GCGGCTGCTGGGAGCCAGAGAGG No data
1162990366_1162990373 2 Left 1162990366 19:14298077-14298099 CCCGGGCCAAGACTGGGGGAAGG No data
Right 1162990373 19:14298102-14298124 GCGGCTGCTGGGAGCCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162990373 Original CRISPR GCGGCTGCTGGGAGCCAGAG AGG Intergenic
No off target data available for this crispr