ID: 1162996807

View in Genome Browser
Species Human (GRCh38)
Location 19:14341141-14341163
Sequence GCAACGTGCACAGCACTTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162996805_1162996807 -7 Left 1162996805 19:14341125-14341147 CCATTTGGAAGGGAGTGCAACGT No data
Right 1162996807 19:14341141-14341163 GCAACGTGCACAGCACTTTTGGG No data
1162996800_1162996807 24 Left 1162996800 19:14341094-14341116 CCTATATTTGAAATACATTCTTA No data
Right 1162996807 19:14341141-14341163 GCAACGTGCACAGCACTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162996807 Original CRISPR GCAACGTGCACAGCACTTTT GGG Intergenic
No off target data available for this crispr